ID: 1005339380

View in Genome Browser
Species Human (GRCh38)
Location 6:24829188-24829210
Sequence CTGTAATCACAGCTACTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005339373_1005339380 26 Left 1005339373 6:24829139-24829161 CCTGTTTCTACTAAAAATATAAA 0: 221
1: 13068
2: 192200
3: 221605
4: 128329
Right 1005339380 6:24829188-24829210 CTGTAATCACAGCTACTGGGTGG No data
1005339372_1005339380 27 Left 1005339372 6:24829138-24829160 CCCTGTTTCTACTAAAAATATAA 0: 99
1: 5537
2: 80350
3: 180851
4: 199756
Right 1005339380 6:24829188-24829210 CTGTAATCACAGCTACTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005339380 Original CRISPR CTGTAATCACAGCTACTGGG TGG Intronic
No off target data available for this crispr