ID: 1005343126

View in Genome Browser
Species Human (GRCh38)
Location 6:24862266-24862288
Sequence CTCCATTGAAGCTTGATGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 97}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005343123_1005343126 22 Left 1005343123 6:24862221-24862243 CCAGCTTACAATCTGGATGCTGC 0: 1
1: 0
2: 0
3: 4
4: 94
Right 1005343126 6:24862266-24862288 CTCCATTGAAGCTTGATGCAGGG 0: 1
1: 0
2: 0
3: 9
4: 97
1005343124_1005343126 0 Left 1005343124 6:24862243-24862265 CCTCTGCTATGCTAAGCAGCAGT 0: 1
1: 0
2: 0
3: 7
4: 137
Right 1005343126 6:24862266-24862288 CTCCATTGAAGCTTGATGCAGGG 0: 1
1: 0
2: 0
3: 9
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005343126 Original CRISPR CTCCATTGAAGCTTGATGCA GGG Intronic
904410586 1:30322505-30322527 CTCCACTGGAGCCTGATGCAGGG + Intergenic
908227230 1:62068141-62068163 CTCCCTTGCAGCCTGATGCCTGG + Intronic
909597982 1:77428530-77428552 CTCCTTTGAAGCTGGTTGAATGG - Intronic
912968182 1:114255605-114255627 CTTCAGTGAAGCTGGAGGCAGGG + Intergenic
913073682 1:115323288-115323310 CTCCATTGAAGCATGATCTCTGG - Intronic
913109489 1:115644551-115644573 CAGTATTGAAGTTTGATGCAAGG + Intronic
915859013 1:159422407-159422429 CTCCATTGCAGGCTGGTGCAAGG - Intergenic
924730262 1:246704636-246704658 CTCGATTGAAGATTGAAGCCTGG + Intergenic
1063615426 10:7596164-7596186 TTCCAGTGCAGCTTCATGCAGGG - Intronic
1063816315 10:9777877-9777899 CACCATTAATTCTTGATGCATGG - Intergenic
1064557881 10:16565976-16565998 CTTCATCCAAGCTTGAAGCAGGG + Intergenic
1067535548 10:47107310-47107332 CTCCATTGCAGCTGGCTACATGG - Intergenic
1068037032 10:51773348-51773370 ATCCATGGAATCTTGATTCATGG + Intronic
1068939691 10:62668737-62668759 GACCATTGAAGCTTACTGCATGG - Intronic
1069977989 10:72231138-72231160 CTCCATTGAAACTTTATGTAGGG + Intronic
1076024980 10:127104055-127104077 CTCCATAGAAGATAGATGGATGG - Intronic
1076640278 10:131911210-131911232 TTCCATTAAATCTTGATGCTGGG - Intronic
1077827378 11:5825844-5825866 CTCCCTAGAGGCTTGTTGCATGG + Intronic
1077969761 11:7177014-7177036 CTGCATGGCAGCTTGGTGCAGGG + Intergenic
1089856010 11:121545346-121545368 CTCCATTGAAGCATGTGGCATGG - Exonic
1094013114 12:25829946-25829968 CCCCATAGAAGCTGGGTGCAGGG + Intergenic
1094635791 12:32226575-32226597 CTCCCTTTAAGCTTCATGCCTGG - Intronic
1095201470 12:39389498-39389520 CTCCATTGAAAATAGATGCATGG - Intronic
1100250854 12:92822076-92822098 ATCCACTGAAGCTTGAGGAAAGG - Intronic
1106478388 13:30117470-30117492 CTCCATTGCTGATTTATGCAGGG - Intergenic
1107190628 13:37580670-37580692 CTGCATTGAAAATTCATGCATGG - Exonic
1109789186 13:67225902-67225924 CTGCTTTGAACCTTGATGCATGG + Exonic
1111461528 13:88549297-88549319 CTCCATTGTTGCTTTATTCAGGG - Intergenic
1116101821 14:40447966-40447988 CTTGATTAAAGCTTGATGCCTGG - Intergenic
1121307087 14:92913292-92913314 CTGCCTTTGAGCTTGATGCAGGG + Intergenic
1122086611 14:99312050-99312072 CTGTCTTGAAGCTTGATGCTGGG - Intergenic
1125192192 15:37006464-37006486 CTCCATCACAGCTTGATCCATGG + Intronic
1137568807 16:49551311-49551333 CTCCATTGGAGATTTTTGCAAGG + Intronic
1144327982 17:14200014-14200036 CTCCAGTGAACCTTGGTGCTGGG - Intronic
1154039647 18:10841750-10841772 CTCCATTGAAGGTAAATACATGG + Intronic
1158980081 18:62751619-62751641 CTGCATAGAAGCTTTATTCAGGG + Intronic
1160010662 18:75105316-75105338 CTCCGTGGAAGCTTGCTGAATGG + Intergenic
1160243985 18:77142703-77142725 CTCCCTAGAAACTTGTTGCATGG + Intergenic
1162486251 19:10962085-10962107 CTGCATTCAAGCTTGATTCCTGG + Intronic
926587169 2:14699468-14699490 TTGAATTGAATCTTGATGCATGG - Intergenic
932736711 2:74259555-74259577 CTCCATTGCAGCTAAGTGCAGGG + Intronic
932751820 2:74376119-74376141 CTCCAATGATGGTTGATGAAAGG + Intronic
933867634 2:86536315-86536337 CTCCATTAAAGGTAGATTCATGG - Intronic
936057712 2:109273358-109273380 CTCCATTGAGCCTTAACGCATGG + Intronic
937494692 2:122405710-122405732 TCCCGTTGAAGCATGATGCAAGG - Intergenic
940049508 2:149447478-149447500 GTCCATAGAAGCTAGATGCTGGG - Intronic
940860702 2:158767898-158767920 CTCCCTTGCAGCTAGATGTAAGG + Intergenic
946978936 2:225185243-225185265 CTTCAGTGAAGCCTGGTGCAAGG - Intergenic
1170614448 20:17937630-17937652 TTCCACTGAAACTTGCTGCAAGG - Intergenic
1172884776 20:38223574-38223596 CTCGATGGAAGCTTGTAGCAGGG + Exonic
1172962167 20:38806726-38806748 CTCCAGTGAAGCTGGAGGCCGGG - Intronic
1174040389 20:47695201-47695223 CTCCAGTAAAGCTTTATGTATGG + Intronic
1178567124 21:33697821-33697843 CTTTATTGAAGCTTTATGAATGG + Intronic
1182447033 22:30395858-30395880 CTCCATAGACGCCTGCTGCAGGG - Intronic
1183229744 22:36574347-36574369 GTGAATTGAAGCTTGATGGATGG + Intronic
950001450 3:9659747-9659769 CTGAATTGGAGCTTGATGTAGGG + Intronic
952733717 3:36666822-36666844 TTCCATTGAAGCTTGATATCTGG - Intergenic
954289709 3:49643174-49643196 CTCCCTTGAACCTTGATGAGAGG + Intronic
959838930 3:110951584-110951606 ATCCATGGCAGCCTGATGCAAGG - Intergenic
959973330 3:112431318-112431340 CTCCCTAGAAGCTTGTTGAATGG + Intergenic
963030596 3:140970972-140970994 CTCGGTTACAGCTTGATGCAAGG + Exonic
963905066 3:150766645-150766667 ATGCATTGGAGCTTGCTGCATGG + Intergenic
969993661 4:11290158-11290180 CTCCATGGAAGCCTGTTGCTGGG - Intergenic
970533402 4:17004862-17004884 CTCCACTGCAGCTTGTTGCTAGG - Intergenic
971304892 4:25471200-25471222 TTCCCTTTTAGCTTGATGCAGGG + Intergenic
971949206 4:33322175-33322197 CTACATTTAAGCTTCATACAAGG - Intergenic
973864416 4:55097483-55097505 CTCCTTTGTAGCTTTATGCCAGG - Intronic
974078775 4:57192107-57192129 CTGCATTAAAGCTTGGTTCAAGG + Intergenic
975872589 4:78796976-78796998 CTTCATTTCAGCTTTATGCATGG + Intronic
977216564 4:94292109-94292131 CTTCATTAAAGCTTGATGTGGGG + Intergenic
982697917 4:158624612-158624634 CTCCATTAAAGCTTGCAGCTAGG + Intronic
986607525 5:9536808-9536830 CTTCATTGAAGCTTGAGCCTAGG - Intronic
988218267 5:28306308-28306330 CTCCAATGAAGATAGATGAAGGG + Intergenic
989298864 5:39864471-39864493 CTCCACTCAAGCCTCATGCATGG + Intergenic
991191759 5:63882593-63882615 GTCCATTGAAACTTGAAGCCAGG + Intergenic
996074212 5:119170514-119170536 CTCCATTAAAGTTGGATGCAAGG + Exonic
1000534024 5:162457992-162458014 CTCAATAGAAGCTTGCAGCAGGG - Intergenic
1000656305 5:163883279-163883301 CTCAATTGATCCTTTATGCATGG - Intergenic
1001384483 5:171327301-171327323 CTCCTATGATTCTTGATGCATGG - Intergenic
1003364026 6:5455898-5455920 AACAAATGAAGCTTGATGCATGG - Intronic
1005343126 6:24862266-24862288 CTCCATTGAAGCTTGATGCAGGG + Intronic
1006605692 6:35255311-35255333 CTACACTGAATCTTGATGCATGG + Intergenic
1007772322 6:44201640-44201662 CTCCTTGGAGGCCTGATGCAAGG - Intergenic
1007814203 6:44508913-44508935 CTCCTCTGAGGCTTGATGTAGGG - Intergenic
1010917820 6:81642205-81642227 CTCCATGGGAGATAGATGCAAGG + Intronic
1013198583 6:107868044-107868066 ATCCATTTAAACTTGATGCTAGG - Exonic
1021320394 7:19203106-19203128 ATCCAGTGAAGTTTCATGCAAGG - Intergenic
1024029342 7:45444610-45444632 TTCCATTAAAGATTGTTGCATGG + Intergenic
1031827347 7:126582619-126582641 CTCCTTTGAAGCTTGAAGCCAGG - Intronic
1038336494 8:26649828-26649850 CTCCATCAAACCATGATGCAGGG - Intronic
1039422745 8:37457979-37458001 CTCCATACATGCTTGATTCAGGG + Intergenic
1041311922 8:56525900-56525922 CTCCTCTGAGCCTTGATGCAAGG + Intergenic
1041801897 8:61809338-61809360 CTACATGGAAGGCTGATGCAGGG + Intergenic
1050458746 9:5858804-5858826 CTCCATAGAAGCTGGAAGGATGG + Intergenic
1056972003 9:91213093-91213115 CCACAGTGAAGCTTGCTGCAGGG + Intergenic
1061981054 9:134103861-134103883 CTCGATGGATGCTTGATGGATGG - Intergenic
1188266238 X:28079152-28079174 CTATATTGAAGATTGATGCAGGG + Intergenic
1188827825 X:34858157-34858179 TCCCATTCAAGCTTGATGAAGGG - Intergenic
1191951392 X:66597528-66597550 CTGCATTGCAGCATGAGGCAGGG - Exonic
1194090457 X:89578440-89578462 CTCAATTGAGGCTTGATTTATGG + Intergenic
1199458719 X:148059366-148059388 CTCAATTGAACCTTGAGACAAGG + Intergenic
1199605159 X:149572021-149572043 TTCCAGTGAACCTTGCTGCATGG + Intergenic
1200443110 Y:3234494-3234516 CTCAATTGAGGCTTGATTTATGG + Intergenic
1201761329 Y:17542401-17542423 ATCCACTGAAGTTTGAGGCAAGG - Intergenic
1201840223 Y:18363589-18363611 ATCCACTGAAGTTTGAGGCAAGG + Intergenic
1201851951 Y:18494250-18494272 CTACAGTTAAACTTGATGCAGGG + Intergenic
1201881369 Y:18826130-18826152 CTACAGTTAAACTTGATGCAGGG - Intronic