ID: 1005345413

View in Genome Browser
Species Human (GRCh38)
Location 6:24884585-24884607
Sequence CTCACTCCTCAGCAAGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1343
Summary {0: 1, 1: 5, 2: 126, 3: 423, 4: 788}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005345413 Original CRISPR CTCACTCCTCAGCAAGGGGA TGG Intronic
900117739 1:1035677-1035699 CTCCCTGTTCAGCAAGGGGTGGG + Intronic
900300844 1:1976323-1976345 CTCACTCGTCACCAAGGAGACGG - Intronic
900501363 1:3006429-3006451 CTCATTCATCACCCAGGGGATGG - Intergenic
900501640 1:3008515-3008537 CTCACTCATCACCAAAGGGATGG - Intergenic
900566304 1:3333763-3333785 CTCACTCATCACCAAGGGGATGG - Intronic
900708875 1:4098337-4098359 CTCATTCATCACCAAAGGGATGG + Intergenic
900749972 1:4389447-4389469 CTCACTCATCATCAAGAGGATGG - Intergenic
901478787 1:9509595-9509617 CTCACTCCTCAGCTTGCAGACGG + Intergenic
901627256 1:10631305-10631327 CTCCCTCCCCAGCAGAGGGAGGG - Intergenic
901753165 1:11424437-11424459 CTCACTCATCACCGAGGGGATGG - Intergenic
901826418 1:11864683-11864705 CTTGTTCCTAAGCAAGGGGAGGG - Intergenic
901839887 1:11947616-11947638 CTCACTCATTACCAAGGAGATGG + Intronic
902161040 1:14530544-14530566 CTCACTCATTACCATGGGGAGGG - Intergenic
902167953 1:14587687-14587709 CTCACTCATCACCAAGGGTTTGG + Intergenic
902389093 1:16092381-16092403 CGCACACCTCAGGAAAGGGAGGG - Intergenic
902732643 1:18379502-18379524 CTCACTCATCACCAAAGAGATGG - Intergenic
902826432 1:18977673-18977695 CTTACTCATCACCAAGGGGATGG + Intergenic
902972209 1:20061992-20062014 GTCACTCATCACCAAAGGGATGG - Intronic
903298189 1:22359206-22359228 TTCACTCATCACCAAGGGGATGG - Intergenic
903300724 1:22376755-22376777 CTCACTTGTCACCAAGTGGATGG - Intergenic
903527390 1:24002107-24002129 CTCACTCATTACCATGGGGATGG + Intergenic
903542773 1:24106202-24106224 CACCCTGCTCAGCTAGGGGAGGG - Intronic
904022282 1:27476409-27476431 CTCACTTATCACCAAGGGGATGG + Intronic
904386356 1:30144968-30144990 CTCACTCATCACCAAGGAGATGG + Intergenic
904817165 1:33212714-33212736 CTCATTCATCACCAAGGGAATGG + Intergenic
904830920 1:33306457-33306479 CTCACTGCTAAGCTAAGGGAAGG + Intergenic
904887529 1:33752299-33752321 TTCACTCATCACCAAGGGGATGG - Intronic
905622218 1:39458077-39458099 CTCACTCATTACCATGGGGAGGG + Intronic
906058192 1:42931945-42931967 CTTCCTCCCCAGCAAGGGGTTGG - Intronic
906708105 1:47909653-47909675 CTCACTCATTATCATGGGGAGGG + Intronic
906887030 1:49659871-49659893 ATCACTCCTCAGCAAATGCAAGG + Intronic
907009344 1:50948873-50948895 TTCACTCATCACCAAGGGGATGG + Intronic
908539886 1:65112262-65112284 CTCACTCATTGCCAAGGGGATGG + Intergenic
909032243 1:70556011-70556033 CTCCCTCCTGAGCAAAGGGTGGG - Intergenic
909104592 1:71392574-71392596 CTCACTTTTCACCAAGGAGATGG - Intergenic
909280586 1:73746872-73746894 CTCACTTATCATCAAGGGGATGG + Intergenic
909363952 1:74798362-74798384 CTCACTTATCACCAAGGGGATGG + Intergenic
909529964 1:76671193-76671215 CTAACTTATCACCAAGGGGATGG + Intergenic
909553403 1:76925171-76925193 TTCACTCATCACCAAGAGGATGG + Intronic
909860742 1:80602331-80602353 CTCACTTATCACCAAGGGGATGG + Intergenic
910359473 1:86400911-86400933 CTCACTTATCATCAAGGGGATGG - Intergenic
910395246 1:86786847-86786869 CTCATTCATCACCAAGGGGATGG - Intergenic
910423777 1:87099458-87099480 CTCAGTTATCACCAAGGGGATGG + Intronic
910424212 1:87102407-87102429 CTCAGTCATCACCAAGGGGATGG + Intronic
910903985 1:92153994-92154016 CTCACTCATCACCATGGGGATGG - Intergenic
910975114 1:92898349-92898371 CCCACTCATCACCAAGGGGATGG + Intronic
911506317 1:98756967-98756989 CTCACTTATCACCAAAGGGATGG - Intronic
911529129 1:99022896-99022918 CTCACTTATCACCAAGGGGAAGG - Intergenic
911951963 1:104184723-104184745 CTCACTCCTCAGCCTGTGGGAGG + Intergenic
912050365 1:105522223-105522245 CTTACTCCTCAGCATGCAGATGG - Intergenic
912078480 1:105908819-105908841 CTCACTTATCACCAAGGGGATGG + Intergenic
912108053 1:106305488-106305510 CTCACTTATCACCCAGGGGATGG + Intergenic
912109667 1:106325709-106325731 CTCACTTGTCACCAAGGGGATGG - Intergenic
912137866 1:106683249-106683271 CTCACTTATCACCAAGGGGATGG - Intergenic
912667960 1:111599886-111599908 TTCACTCATCACCAAGGGAATGG - Intronic
912717820 1:111994375-111994397 CTCACTCATTACCATGGGGAGGG - Intergenic
912936099 1:114004912-114004934 CTCACTCCTCACCAAGGGGACGG + Intergenic
913478094 1:119258481-119258503 CTCACTCATCACCAAGGGGATGG - Intergenic
914782538 1:150798716-150798738 CTCACTCATCACCAAGGCGATGG - Intronic
915504836 1:156347679-156347701 CTCACTCATCGCCAAGGGGATGG + Intronic
915684179 1:157615162-157615184 GTCACTTATCACCAAGGGGATGG + Intergenic
915818961 1:159000843-159000865 CTCACTCATCAACCAGGGGATGG - Intronic
915884020 1:159703631-159703653 CTCACTCATCACTTAGGGGATGG + Intergenic
916062047 1:161106067-161106089 CTCACTTATCATCAAGGGGATGG - Intronic
916251449 1:162742532-162742554 CTCACTTATCACCAAGGGCATGG + Intronic
916281459 1:163055793-163055815 CTCACTCATCAAGAAGGGGATGG + Intergenic
916492466 1:165314032-165314054 CTCACCCCACAGCTATGGGAAGG + Intronic
916899192 1:169202268-169202290 CTCACTTATCACCAAAGGGATGG - Intronic
917069118 1:171129892-171129914 CTTACTCATCACCAAGGGAATGG + Intergenic
917406619 1:174713477-174713499 CTCACTCATTGCCAAGGGGATGG - Intronic
917408630 1:174735866-174735888 TTCACTCATCACCAAGGGGATGG + Intronic
917408928 1:174737925-174737947 TTCACTCATCACCAAGGGGAAGG + Intronic
917410972 1:174759828-174759850 CTAGCTCATTAGCAAGGGGATGG + Intronic
917433380 1:174994822-174994844 CTACCTCCTCTGCAAGGGAAAGG - Intronic
917759476 1:178141078-178141100 CTCACTTATCACCAAGGGAATGG + Intronic
917792564 1:178508658-178508680 CCCACCCCTCAGGAAGGGGCTGG + Intergenic
917806772 1:178620904-178620926 CTCACTCATTACCATGGGGAGGG + Intergenic
918043046 1:180924764-180924786 CTTTGTCGTCAGCAAGGGGAAGG - Intronic
918834955 1:189450137-189450159 CTCACTTATTACCAAGGGGATGG - Intergenic
918842801 1:189565353-189565375 TTCACTCATCACCAAGAGGACGG + Intergenic
918981151 1:191560885-191560907 CTCACTTATCACCAAGGGGATGG - Intergenic
919096685 1:193045406-193045428 CTCACTTAACACCAAGGGGATGG - Intronic
919474366 1:198016629-198016651 CTAACTCGTCACCAAAGGGATGG + Intergenic
920438261 1:205962022-205962044 GTCTCTCCCCAGCCAGGGGATGG - Intergenic
920502003 1:206491360-206491382 CTTAGTCCTCAGGAAAGGGAAGG - Exonic
920691669 1:208151526-208151548 CTCACTCCTCAAAAGGGGGCAGG + Intronic
920869998 1:209786049-209786071 CTCAGTCTTAAGCAAGGTGAAGG + Exonic
921364985 1:214365136-214365158 TTCACTCATCAGTGAGGGGAAGG - Intronic
922074212 1:222226926-222226948 CTCACTCATCCGCAAGAGGGTGG + Intergenic
922183080 1:223251393-223251415 CTCACTCATCACCAAGGGGATGG + Intronic
922799497 1:228358691-228358713 CTCAGTGCTCAGCAAGGTCAGGG + Intronic
922998080 1:229982748-229982770 CTCACTCATTACCACGGGGAGGG + Intergenic
922999543 1:229995359-229995381 CTCACTTATCACCAAGAGGATGG - Intergenic
923067555 1:230532729-230532751 CTCACTCATCACCAAAAGGATGG - Intergenic
923188715 1:231599020-231599042 CTCACTTATCACCAAGGTGATGG + Intronic
923995008 1:239484356-239484378 TTTACTCATCACCAAGGGGACGG + Intronic
924125783 1:240849614-240849636 CTTACTCATCACCAAGGGGAGGG - Intronic
924199410 1:241643211-241643233 CTCACTTATCACAAAGGGGATGG - Intronic
924278078 1:242408462-242408484 CTCACTCATCACCAACAGGATGG - Intronic
924287504 1:242503245-242503267 CTCACTCATCACCAGTGGGATGG - Intronic
924446025 1:244132254-244132276 CTCACTCATTACCATGGGGAGGG + Intergenic
924455480 1:244215630-244215652 CTCACTCATCACCAAGAGGATGG + Intergenic
924504833 1:244672249-244672271 CTCACTCATCAGCAAAGGGATGG - Intronic
1063094574 10:2898491-2898513 CTCATTCATCACCAAGGGGAGGG + Intergenic
1064010084 10:11728680-11728702 CTCACGCATCGCCAAGGGGATGG + Intergenic
1064317404 10:14271138-14271160 CTCACTTATCACCAAGGAGATGG + Intronic
1064569785 10:16680684-16680706 CTCACTCATCACCAAGAGGACGG + Intronic
1064584036 10:16821910-16821932 CTCACTTATCACCAAGGGTATGG - Intergenic
1064856685 10:19776210-19776232 CTCACTCATTACCAGGGGGATGG + Intronic
1064877023 10:20005722-20005744 CGCACTCATCACCAAGGGAATGG + Intronic
1065084789 10:22163850-22163872 CTCATTCATCACCATGGGGAGGG + Intergenic
1065189136 10:23194757-23194779 CTTACTCCTCACAAAGGAGATGG + Intergenic
1065244381 10:23742639-23742661 CTCACTTATCACCAAGGGGATGG + Intronic
1065376669 10:25050131-25050153 CTCACTCATCACCAAGGGGATGG + Intronic
1065692126 10:28345291-28345313 CCCACTCATCACCAAGGAGATGG - Intergenic
1066151430 10:32623896-32623918 CTCACTTCTTCCCAAGGGGATGG + Intronic
1066684036 10:37963625-37963647 CTCACTCATTATCAAGGGAATGG - Intronic
1066694044 10:38062121-38062143 CTCACATGTCAGAAAGGGGAGGG - Intronic
1066973898 10:42346178-42346200 CTCATTGATCACCAAGGGGATGG + Intergenic
1067128510 10:43540761-43540783 CTCACTCATCACCAAGGGAATGG - Intergenic
1067295044 10:44970917-44970939 CTCACTTATCACCACGGGGATGG + Intronic
1067321879 10:45228946-45228968 CTCACTTATCACCAAGGGGATGG - Intergenic
1068047092 10:51899873-51899895 CTCACTCATCACCAAGGGCATGG - Intronic
1068050195 10:51940664-51940686 CTCACTCCTCAGAAACAGAATGG - Intronic
1068432152 10:56947805-56947827 CTCACTTATCACCAAGGGAATGG - Intergenic
1068762009 10:60722723-60722745 CTCACTCATCACCAAGGGGATGG - Intronic
1069598958 10:69690930-69690952 CTCACTCATCACCAAGAGGATGG - Intronic
1069772843 10:70910519-70910541 CTCGCTCATCACCAAGGGGATGG + Intergenic
1069969718 10:72156132-72156154 CTCATTTATCACCAAGGGGATGG - Intronic
1069975563 10:72209944-72209966 CTCACTCATCGCCAAGGAGATGG - Intronic
1070373995 10:75811283-75811305 TTCAGACCTCAGCAAGGGGTGGG - Intronic
1070476165 10:76831106-76831128 CTCACTCATCAACAAGGGGATGG - Intergenic
1071119450 10:82261005-82261027 CTCACTCATCACCAAGGGGATGG - Intronic
1071147085 10:82588268-82588290 CTCACTCATCATCAAGAGGATGG - Intronic
1071249601 10:83803543-83803565 CTCACCCCTCACCAAGGAGATGG + Intergenic
1071308438 10:84321134-84321156 CTCACTTATCACCAAGGGGATGG - Intergenic
1071308452 10:84321226-84321248 CTCACTTATCACCAAGGGGATGG - Intergenic
1071379104 10:85039956-85039978 CTCACTCATTACCAAGGGGAGGG + Intergenic
1071664781 10:87543800-87543822 GTCACTCATCACCAAGGGGATGG + Intronic
1071884922 10:89939391-89939413 CTCACTCATCACCAAGGGGATGG - Intergenic
1071995767 10:91147757-91147779 CTCACTTATCACCAAGGGGATGG + Intergenic
1072072521 10:91933084-91933106 CTCACCCCTCCTCAAGGGGGTGG - Intronic
1072295891 10:94009305-94009327 CTCACTCATCACCAAGGGGATGG + Intronic
1072313967 10:94183884-94183906 CTTACTCATCACCAAGGGGATGG + Intronic
1074003056 10:109391539-109391561 CTCACTTATCACCAAGGGGATGG + Intergenic
1074707999 10:116152542-116152564 CTCACTCATCACCAATGCGATGG + Intronic
1074737492 10:116451555-116451577 CTCACTCATCATCAAGAGGATGG - Intronic
1074737765 10:116453603-116453625 CTCACTCATCACCAAGGGGGTGG - Intronic
1074773842 10:116751798-116751820 CTCACTCATCACCAAGGGGATGG - Intergenic
1074959825 10:118433157-118433179 CTCATTCATCACCAAGGGAATGG + Intergenic
1075017449 10:118920466-118920488 CTCACTCATCATCAAGGAGATGG - Intergenic
1075269810 10:121038834-121038856 TTCCCTCCTCAGCCAGGTGAAGG + Intergenic
1075316665 10:121458823-121458845 CTCACCCCACAGCCAGAGGATGG + Intergenic
1075427595 10:122353877-122353899 CTCACTCATTACCATGGGGAGGG - Intergenic
1075666594 10:124234984-124235006 CTCACTCGTCAGTGAGGCGAAGG + Intergenic
1075673828 10:124282268-124282290 CCCACTCATCATCAAGGGGATGG + Intergenic
1075739123 10:124682742-124682764 CTCTCTCATCAGCCAGGGGCAGG - Intronic
1075966277 10:126614515-126614537 CTCAATCCACAGGCAGGGGAAGG - Intronic
1075973587 10:126675285-126675307 TTCACTGTTCAGCAATGGGACGG + Intergenic
1076118015 10:127914058-127914080 CTCACTCATCACTAAAGGGATGG - Intronic
1076294693 10:129375430-129375452 CTCACTCCACTGCAAGAGGAAGG - Intergenic
1076419740 10:130322574-130322596 TTCACTCATCACCAAGGGAATGG + Intergenic
1076465640 10:130679670-130679692 CTCACTCATCACCAAGAGGATGG - Intergenic
1076509895 10:131005818-131005840 CTCACTCATCACCAAGGCCATGG - Intergenic
1076737092 10:132463778-132463800 CCCACTTCCCTGCAAGGGGAAGG - Intergenic
1076763672 10:132618860-132618882 CTCACTTATCACCAAGGGGATGG + Intronic
1077061714 11:620452-620474 CTGACTCCCCATCAAGGGCAGGG + Intronic
1077419349 11:2443291-2443313 CTCCCACCTCAGCAGGAGGAAGG - Intergenic
1077482737 11:2824190-2824212 CTCACACTTCAGCCAGGGGGTGG - Intronic
1078429649 11:11279069-11279091 CCCACTTCTCACCAAGGGGATGG - Intronic
1078613941 11:12847403-12847425 CTCACTCCCCAGCAGTGGGCTGG - Intronic
1078744629 11:14099949-14099971 CTCACTCATCACCAAGCGGAGGG + Intronic
1078936324 11:15954057-15954079 CTCACTTATCACCAAGGGAACGG + Intergenic
1079303791 11:19304537-19304559 CTCACTCATCACCAAGGGGATGG + Intergenic
1079637770 11:22766030-22766052 CTCACTTATCACCAAAGGGATGG + Intronic
1079677359 11:23246883-23246905 CTCACTTAACACCAAGGGGACGG + Intergenic
1079788236 11:24702630-24702652 CTCACTTATCACCAAGGGGATGG + Intronic
1079796765 11:24813581-24813603 CTCACTTGTCAACAAGGGGATGG + Intronic
1080306845 11:30845677-30845699 CTCACTTATCACCAAGGGGATGG + Intronic
1080894890 11:36440951-36440973 CTCACTCATTACCAAGGGGAGGG + Intronic
1080895221 11:36443300-36443322 CTCACTTATCACCAAGGGGAGGG + Intronic
1081181807 11:39992962-39992984 CTCACTTATCACCAAGGAGATGG - Intergenic
1081214160 11:40373684-40373706 CTCACTGATCACCAAGGGGATGG - Intronic
1081526384 11:43930458-43930480 CTCACTCATTACCATGGGGAGGG - Intronic
1081997032 11:47372410-47372432 CTCACTCTCCAGCGAGGGGATGG - Intronic
1082101333 11:48175748-48175770 CTCGCACTTCACCAAGGGGATGG + Intergenic
1082194269 11:49283172-49283194 CTCACTCATCTCCAAGGGCAAGG - Intergenic
1082780227 11:57281721-57281743 TTCACTCATCACCAAGGGGATGG - Intergenic
1082993075 11:59225641-59225663 CTCACTTATCACCAAGGGGATGG + Intergenic
1083602616 11:63958319-63958341 TTCACCCTTCAGCAAGGGGATGG - Intergenic
1084465134 11:69318682-69318704 CTCACTCATCACTAAGGGGATGG - Intronic
1084474051 11:69378711-69378733 CTCAGGCCTCAGGAACGGGAGGG - Intergenic
1084798645 11:71526561-71526583 CACACTCATCACCAAGGAGATGG - Intergenic
1085057896 11:73418294-73418316 CTCACTCATCAGCAAGGGGATGG - Intronic
1085145587 11:74192667-74192689 CTCACTCATTACCAAGGTGATGG - Intronic
1085180689 11:74533603-74533625 CACACTTATCACCAAGGGGATGG + Intronic
1085989210 11:81820669-81820691 CTCACTTATCACCAAAGGGACGG + Intergenic
1086093397 11:83026395-83026417 TTCACTCATCACCAAGGGGATGG - Intronic
1086314208 11:85572963-85572985 CTCACTTATCACCAAGGGAATGG - Intronic
1086351470 11:85946092-85946114 CTCACTTATCACCAAGGGGATGG + Intergenic
1086729167 11:90227179-90227201 CTCACTCATCACCCAGGGGATGG + Intergenic
1086807754 11:91266992-91267014 CTCACTCATCATCAAGAGTATGG + Intergenic
1086809855 11:91295694-91295716 CTCACTCATCAACAAGGGGATGG - Intergenic
1086871421 11:92041945-92041967 ATCACTTATCACCAAGGGGATGG - Intergenic
1087124605 11:94611641-94611663 CTCACTCATTACCATGGGGAGGG - Intronic
1087732711 11:101796922-101796944 CTCACTTGTCACCAAGGGGATGG - Intronic
1087768166 11:102178996-102179018 CTCACTTATGACCAAGGGGATGG + Intronic
1087849375 11:103010676-103010698 CTCACTTATCACCAAGAGGATGG + Intergenic
1088054760 11:105561295-105561317 CTCACTCATCACCAAGCGGATGG + Intergenic
1088136502 11:106562022-106562044 CTCACTCATCACCAAGGGAATGG - Intergenic
1088444353 11:109908375-109908397 CATACTCATCATCAAGGGGATGG + Intergenic
1088506909 11:110535793-110535815 CTCATTTATCACCAAGGGGATGG + Intergenic
1088528606 11:110784589-110784611 CTCACTTATCACCAAGGAGATGG - Intergenic
1088546630 11:110965969-110965991 CTCACTCATTACCATGGGGAGGG + Intergenic
1088678111 11:112215983-112216005 CTCACTTGTCACCAAGGGGATGG + Intronic
1088726432 11:112640696-112640718 CTCACTTATCACCAAGGGGATGG - Intergenic
1088827413 11:113507452-113507474 CTCACTTATCACCAAGGGGATGG - Intergenic
1088879430 11:113962020-113962042 CTCACTCATCACCATGGGGAGGG + Intergenic
1088951808 11:114579245-114579267 CTCACTCATTACCATGGGGAGGG + Intronic
1089155626 11:116400074-116400096 CTCATTGCTAAGGAAGGGGATGG + Intergenic
1089565846 11:119371220-119371242 TTCTCTTCTGAGCAAGGGGAGGG + Intronic
1089669384 11:120042975-120042997 CTCACTTTTCACCAAGGAGATGG + Intergenic
1089841910 11:121425954-121425976 CTCACTCATCACCAAGAGGATGG + Intergenic
1089929932 11:122299767-122299789 CACACTCATCACCAAAGGGATGG + Intergenic
1090105766 11:123852414-123852436 CTCCCTCATTACCAAGGGGAGGG - Intergenic
1090871421 11:130753125-130753147 CTCACTTATCACCAAGGGCATGG - Intergenic
1091196553 11:133736365-133736387 CTCACTCATCACCACAGGGACGG + Intergenic
1091348507 11:134873155-134873177 CTCACTCTTCACCATGAGGAGGG - Intergenic
1091490199 12:926145-926167 CTCACTCAACACCAAGGGGATGG - Intronic
1091669523 12:2442859-2442881 CTCACTTATCTCCAAGGGGATGG + Intronic
1091743754 12:2977788-2977810 GGCACTGCTCAGCAAGAGGAAGG + Intronic
1092161760 12:6318910-6318932 CCCTCTTCTCAGCGAGGGGAAGG + Intronic
1092601590 12:10072097-10072119 CTCACTCATCACCAAGAAGAGGG - Intronic
1093186205 12:16022177-16022199 CTCATTCATCACCAAGGGGATGG - Intronic
1093223291 12:16449337-16449359 CCCACTCATCACCAAGAGGATGG + Intronic
1093416232 12:18924156-18924178 CTCACTCCTAAGGAAGGGAGAGG - Intergenic
1093649946 12:21631608-21631630 CTCACTTATCACCAAGGGGATGG + Intergenic
1094084492 12:26574869-26574891 CTCACTTATCACCGAGGGGATGG + Intronic
1094450318 12:30576939-30576961 CTCACTCCTCAGCTTGCTGATGG + Intergenic
1094762020 12:33544920-33544942 CTCACTCATCACCAAGGAGATGG + Intergenic
1095175614 12:39088853-39088875 CTCTCTCATCACCAAGGGGATGG + Intergenic
1095238716 12:39831690-39831712 TTCACTCATCACCAAGGGGATGG - Intronic
1095309938 12:40686973-40686995 CTCACTTATCACTAAGGGGATGG + Intergenic
1095382289 12:41610186-41610208 CTCACTCGTCACCAAGATGATGG + Intergenic
1095843060 12:46715453-46715475 CTCATTCATCACCAAGGGGATGG + Intergenic
1095928159 12:47600051-47600073 CTCACTTATCACCAAGGGGATGG + Intergenic
1096346323 12:50850236-50850258 CTCACTTATCACCAAGGGAATGG - Intronic
1096509964 12:52122193-52122215 CCCAGGCCTCAGCAAGTGGAGGG - Intergenic
1096518085 12:52169207-52169229 CTCACTCATCACCAAGGAGATGG + Exonic
1096970535 12:55662752-55662774 CACACTCCTCAACAAAGGGTGGG - Intergenic
1096972608 12:55679884-55679906 CTCACTCATCACCAAGGGGTTGG - Intergenic
1097184743 12:57190528-57190550 CTCTCTTCTCAGCAAGTAGACGG + Intronic
1097238274 12:57554851-57554873 CTCACTCATTACCATGGGGAAGG + Intronic
1097354558 12:58586760-58586782 CTCACCCCACAACATGGGGAAGG - Intronic
1097594148 12:61606882-61606904 CTCACTCATCACCAAGGGGGTGG - Intergenic
1097717469 12:62981996-62982018 CTCACTTATCACGAAGGGGATGG + Intergenic
1097899106 12:64856231-64856253 CTCACTTATCACCAAGGGAATGG + Intronic
1098146685 12:67504531-67504553 CTCACTTATCACCAAGGGGATGG - Intergenic
1098166421 12:67702948-67702970 CTCACTTATCACCAAGGGGATGG - Intergenic
1098219398 12:68252639-68252661 CTCACTCATCTGCAGGTGGAAGG + Exonic
1098306444 12:69107384-69107406 CTCACTCATCGCCAAGGTGATGG + Intergenic
1098325466 12:69297678-69297700 CTCACTTATCACCAGGGGGATGG - Intergenic
1098325703 12:69299354-69299376 CTCACTTATCACCAAGGGGATGG - Intergenic
1098939709 12:76519825-76519847 CTCACTCATCACCAAGGAGATGG + Intronic
1099624359 12:85050104-85050126 CTCACTTATCACCAAGGGGATGG + Intronic
1099860840 12:88223376-88223398 CTCACTTGTCACCAAGGGGTTGG - Intergenic
1099890973 12:88587880-88587902 CTCACTCATCACCAAGGAGTTGG + Intergenic
1099946920 12:89255381-89255403 CTCACTCATCACCAAGGGGACGG + Intergenic
1099984792 12:89649840-89649862 CTCACTTATCACCAAGGGGATGG - Intronic
1100002558 12:89855123-89855145 CACACTCATTACCAAGGGGATGG + Intergenic
1100429638 12:94519196-94519218 CTCACTCATTATCATGGGGATGG + Intergenic
1100630937 12:96388939-96388961 CTCACTCATCACCAAGGGGATGG + Intronic
1100660012 12:96686643-96686665 CTCACTCATCACCAAGGGGATGG + Intronic
1100807769 12:98305172-98305194 CTCACTCATCACCAAGGGGATGG - Intergenic
1100874067 12:98943947-98943969 CTCATTCATCACCAAGGGGATGG - Intronic
1101353389 12:103954528-103954550 CTCACTCTTCACCACAGGGAGGG + Intronic
1101376991 12:104179755-104179777 GTCACTCATCACCAAGGGGATGG + Intergenic
1101635753 12:106540255-106540277 CTCACTCATCACCAAGGGAATGG + Intronic
1101808369 12:108085274-108085296 CTCACTCATCACCAAGGAGATGG - Intergenic
1102194311 12:111013560-111013582 CTCACTCCTCAGACAGGATAAGG + Intergenic
1102529784 12:113537822-113537844 CTTGCTCATCACCAAGGGGATGG + Intergenic
1102575536 12:113853938-113853960 CTGACACCTCACCAAGGAGAAGG - Intronic
1102893628 12:116581079-116581101 CTCACTTCTCACCAAACGGATGG - Intergenic
1102922181 12:116799962-116799984 CTCACTCATCACCTTGGGGAGGG - Intronic
1103614555 12:122143747-122143769 ATGACTCCCCAGCAAGGGGTGGG - Exonic
1103970319 12:124666777-124666799 CTCAGCCCTGGGCAAGGGGAGGG - Intergenic
1104037092 12:125105065-125105087 CCCACTCATCACCAAGGAGATGG + Intronic
1104120371 12:125793189-125793211 CTCACTTATCACCAAGGGGATGG + Intergenic
1104151375 12:126087219-126087241 CTCACTCATTATCAAGGGGATGG + Intergenic
1104183345 12:126404067-126404089 CTCACTTATCACCAAGGGGATGG + Intergenic
1104190447 12:126477389-126477411 TTCACTCATCACCAAGGAGATGG + Intergenic
1104513739 12:129404746-129404768 CTCATTCATCACCAAGGAGATGG + Intronic
1104588648 12:130067151-130067173 CTCACTCATCTCCAAGGGTAGGG - Intergenic
1104669101 12:130668169-130668191 CTCATTCCTCAGCATTGGGTCGG - Intronic
1105321075 13:19323067-19323089 CTCACTTAATAGCAAGGGGATGG + Intergenic
1105418911 13:20235823-20235845 CTCATTGGTCACCAAGGGGATGG + Intergenic
1105710637 13:23005477-23005499 CTCACTCATCACCAAGGGGATGG + Intergenic
1105714187 13:23045741-23045763 CTCACTCAACACCAAGAGGATGG + Intergenic
1105714319 13:23046832-23046854 CTCACTCATCACCAAAGGGATGG - Intergenic
1105734473 13:23253779-23253801 CCCACTCTTCACCAAGGGTATGG - Intronic
1105734706 13:23255651-23255673 CTTACTCATGACCAAGGGGATGG - Intronic
1106200024 13:27528301-27528323 CTTACTTATCACCAAGGGGATGG - Intergenic
1106366410 13:29085007-29085029 TTCACTCATCACCAAGGGGATGG - Intronic
1106383571 13:29263734-29263756 CTCACTCATCACCAAGGGGGTGG + Intronic
1106733915 13:32570263-32570285 CTCACACATCAGCAAGGATATGG + Intergenic
1106811459 13:33362307-33362329 CTCACTCATCACCAAAGAGATGG + Intergenic
1106919859 13:34551928-34551950 CTCACTCATCACCAAGGGGATGG + Intergenic
1106948968 13:34861446-34861468 CTCGCTCATCACAAAGGGGATGG - Intergenic
1107021142 13:35752900-35752922 CTCACTTATCACCAAGGGCATGG + Intergenic
1107063138 13:36182999-36183021 CTCACTCATCACCAAGGGGATGG - Intronic
1107354814 13:39555917-39555939 CTCACTTACCACCAAGGGGATGG - Intronic
1107355082 13:39557835-39557857 CTCACTCATCATCAAGGGGTTGG - Intronic
1107517178 13:41141468-41141490 CTCACTCATCACCAAGGAGATGG + Intergenic
1107531577 13:41287377-41287399 CTCACTTATCACTAAGGGGATGG + Intergenic
1107702461 13:43061718-43061740 CTCACTTATCACCAAGGGAATGG + Intronic
1107782960 13:43924735-43924757 CTCACTCATTACCAAGAGGATGG + Intergenic
1107816216 13:44246823-44246845 CTCACTTATCACCAAGGGGATGG - Intergenic
1108352090 13:49597055-49597077 CTCACTTATCACCAAGAGGATGG + Intergenic
1108445189 13:50501570-50501592 CTCACTCATTACCATGGGGAGGG + Intronic
1108549122 13:51525720-51525742 CTTACTCATCACCAGGGGGACGG + Intergenic
1108731058 13:53236270-53236292 CTCACTGATCACCAAGGGGATGG - Intergenic
1108769949 13:53687607-53687629 CTCACTTATCACCAAGGGGATGG + Intergenic
1108893457 13:55293490-55293512 CTCACTTATCACCAAGGGCATGG - Intergenic
1109218392 13:59616148-59616170 CTCACTCATCACCAAGGAGATGG + Intergenic
1109279984 13:60344857-60344879 CTCACTTCAAACCAAGGGGATGG - Intergenic
1109889417 13:68588948-68588970 CTCACTCTTCACCAGGGGAATGG + Intergenic
1110635661 13:77765264-77765286 CTCACTTATCACCCAGGGGATGG + Intergenic
1111447881 13:88373820-88373842 CTCACTTATAACCAAGGGGATGG + Intergenic
1111458172 13:88510150-88510172 CTCACTTGTCACCAAGGGGATGG + Intergenic
1111518543 13:89367161-89367183 CTCACTCATCACCAAGGGGTTGG - Intergenic
1111572708 13:90107876-90107898 CTCACCCGCCAGCAAGGGGGTGG + Intergenic
1111877857 13:93919038-93919060 CTCACTCGTCACCAAGGGGATGG - Intronic
1112286254 13:98107149-98107171 CTCACTTATCACCAAGGGGATGG + Intergenic
1112691191 13:101896424-101896446 ATCACTCCTCAGCAAGCCTATGG + Intronic
1112885017 13:104159440-104159462 CTGACTTATCACCAAGGGGATGG + Intergenic
1113173313 13:107531291-107531313 CTCACTCATCACCAAGAGGATGG - Intronic
1113507766 13:110828925-110828947 CTCACTCATGACCAAGGGGATGG + Intergenic
1113570074 13:111347243-111347265 CTCACTTGTCACCAAGAGGATGG - Intergenic
1113615259 13:111676069-111676091 CTCACTCATCACCAAGAGGATGG + Intergenic
1113620726 13:111760982-111761004 CTCACTCATCACCAAGAGGATGG + Intergenic
1113679748 13:112234903-112234925 CTCAGTCATCACCAAGGGAATGG - Intergenic
1113794148 13:113047146-113047168 CTCACCCGTCACCAAGGGGATGG + Intronic
1114013770 14:18404770-18404792 CTCATTGATCACCAAGGGGATGG + Intergenic
1114081547 14:19204939-19204961 CTCACTCATCACCAAGGGGATGG - Intergenic
1114243927 14:20894974-20894996 CCCAGTCATCAGCATGGGGATGG - Intergenic
1114246989 14:20923549-20923571 CCCAGTCATCAGCATGGGGATGG - Intergenic
1114255753 14:21000181-21000203 CTCACTCTCCAGATAGGGGATGG - Intronic
1114365986 14:22027439-22027461 CTGAGTCCTCTTCAAGGGGAAGG - Intergenic
1114400404 14:22405067-22405089 CTCATTCATCACCAAGGGGATGG - Intergenic
1114570047 14:23660579-23660601 CTCACTGCTCAGACAGAGGAAGG - Intergenic
1114599344 14:23941879-23941901 CTCACTCATCACCAAGGGGAGGG + Intergenic
1114789089 14:25635738-25635760 TTTACTCATCACCAAGGGGATGG - Intergenic
1114917233 14:27284279-27284301 CTCACTAATCACCAAGGAGATGG - Intergenic
1115016396 14:28620294-28620316 CTCACTTATCATCAAGGAGATGG - Intergenic
1115286152 14:31714611-31714633 CTCACTTATCACCAAGAGGATGG + Intronic
1116280751 14:42903718-42903740 TTCACTTATCACCAAGGGGATGG - Intergenic
1116290266 14:43026322-43026344 CTCACTCATCACCAAGGGGACGG - Intergenic
1116313047 14:43350689-43350711 CTCACTCATCACCATGGAGATGG + Intergenic
1116526967 14:45917470-45917492 CTCACTTATCACCAAAGGGATGG + Intergenic
1116586917 14:46717687-46717709 CTCACTCATTACCATGGGGATGG + Intergenic
1116681522 14:47976399-47976421 CTAACTTATCACCAAGGGGATGG + Intergenic
1116715141 14:48417322-48417344 CTCACTCATTACCAAGGAGATGG - Intergenic
1117597309 14:57336411-57336433 CTCACTCCTGAGCTAGAGAAAGG - Intergenic
1117778644 14:59208796-59208818 CCCACTCGTCACCAAGGGGATGG - Intronic
1117819791 14:59636273-59636295 CCCACTTATCACCAAGGGGATGG - Intronic
1118316955 14:64731369-64731391 GTCACTCCTCATCAACTGGAAGG + Exonic
1118486788 14:66221990-66222012 CTCACTGCTGAGCAAGGAGATGG - Intergenic
1118755410 14:68839431-68839453 CTCACTTATCACCAAGGAGACGG - Intergenic
1119000912 14:70880899-70880921 CTTACTTATCATCAAGGGGATGG + Intergenic
1119052479 14:71383758-71383780 CTCACTTATCACCAAGGGGATGG + Intronic
1119094518 14:71816623-71816645 CTCGCTCATCACCAAGGGGATGG + Intergenic
1119178647 14:72588573-72588595 CTCATTACTCAGAAGGGGGAAGG - Intergenic
1119208320 14:72811153-72811175 TTCACTCATCACCAAGTGGACGG + Intronic
1119417323 14:74481196-74481218 CTCACTCATCACCAAGGGGACGG - Intronic
1119586546 14:75841078-75841100 CTCACTCATCACCAAGGGGATGG + Intronic
1120437182 14:84495906-84495928 CTCACTTATCACCAAGGGGATGG - Intergenic
1120564079 14:86032834-86032856 CCCAGTCATCACCAAGGGGATGG + Intergenic
1120802295 14:88704169-88704191 CTCACTCATCACCAAGGGGATGG - Intronic
1121139180 14:91525881-91525903 CTCAGTCATCACCAAGGGAATGG + Intergenic
1121162004 14:91752161-91752183 CTCACTAATCACCAAGAGGATGG + Intronic
1121166846 14:91810207-91810229 CTCACTTATCACCAAGGAGATGG + Intronic
1121596327 14:95166113-95166135 CTCACTCATCACCCAGGGAATGG - Intergenic
1121681055 14:95792951-95792973 CTCACTCATCACCAAGGGGATGG - Intergenic
1121707547 14:96010349-96010371 CTCACTTATCATCAAAGGGATGG + Intergenic
1121890749 14:97588237-97588259 GTCACTCATCACCAAGGGGATGG + Intergenic
1122204829 14:100143187-100143209 CTCACTCCTCAGGAGAGGCAGGG - Intronic
1122386752 14:101353598-101353620 CTCACTCATCACCAAGGGGAGGG - Intergenic
1122444312 14:101758191-101758213 CTCACTTATCACCAAGGGGATGG + Intergenic
1122846779 14:104504562-104504584 CTCAGTCCCAAGCAAAGGGATGG - Intronic
1123099492 14:105786809-105786831 ATCACCCATCACCAAGGGGATGG - Intergenic
1123100002 14:105791193-105791215 CTCACTCATCACCAAGAGGATGG - Intergenic
1123100825 14:105798658-105798680 CTCACTCATCACCAAAGGGCTGG - Intergenic
1123155807 14:106224760-106224782 CTCACTCGTCACCAAGTGGATGG + Intergenic
1123402535 15:20002887-20002909 CTCACTCATTACCAAGTGGATGG + Intergenic
1123511873 15:21009541-21009563 CTCACTCATTACCAAGTGGATGG + Intergenic
1123947352 15:25245228-25245250 CTCACGTATGAGCAAGGGGAAGG - Intergenic
1124047519 15:26163945-26163967 CTCACTTCTTACCATGGGGAGGG + Intergenic
1124139296 15:27063438-27063460 CTCACTCATCAGCAAGGGGATGG - Intronic
1124472483 15:30000610-30000632 CTCACTCATTATCAAGGGGATGG - Intergenic
1124507284 15:30289305-30289327 CTCACTCATCACCACAGGGAGGG - Intergenic
1124663314 15:31568735-31568757 CTCACTTATCACCAAGGGGTTGG - Intronic
1124705624 15:31961342-31961364 CTCACTTATCACCAAGGGGATGG - Intergenic
1124722154 15:32119785-32119807 CTGACATCTCAGCAAGAGGAAGG + Intronic
1124736271 15:32249354-32249376 CTCACTCATCACCACAGGGAGGG + Intergenic
1125256344 15:37768368-37768390 CTCACTCATCACCAAGGGGACGG + Intergenic
1125492210 15:40156825-40156847 CTCACCATTCACCAAGGGGATGG + Intergenic
1126503965 15:49381133-49381155 CTCACTCATCACCACAGGGATGG + Intronic
1126658581 15:51008380-51008402 CTGACTTATCACCAAGGGGATGG + Intergenic
1126735258 15:51726442-51726464 CTCACTCTGGAGCCAGGGGAGGG - Intronic
1126855749 15:52837864-52837886 CTCACTCATCACCAAGGGGATGG - Intergenic
1126907475 15:53383598-53383620 CTCGCTCATCACCAAGAGGATGG + Intergenic
1126978049 15:54208212-54208234 CTCACTTATCACCAAGGGGATGG + Intronic
1128467466 15:67924967-67924989 CTCACTCATTACCATGGGGAGGG + Intergenic
1128524548 15:68403384-68403406 CTCACTCATCACCAAGGGGATGG - Intronic
1128575811 15:68774202-68774224 CTCACTCATTACCATGGGGATGG - Intergenic
1128629736 15:69252459-69252481 CTCATTCATCATCAAGGGGATGG + Intronic
1129035062 15:72644154-72644176 CTCACTCATTACCATGGGGAGGG + Intergenic
1129214820 15:74093062-74093084 CTCACTCATTACCATGGGGAGGG - Intergenic
1129314662 15:74734208-74734230 CTCACTTAGCACCAAGGGGATGG - Intergenic
1129390565 15:75218605-75218627 CTCACTCATTACCATGGGGAGGG + Intergenic
1129473711 15:75769014-75769036 CTCACTCATTACCATGGGGAGGG - Intergenic
1129479779 15:75814450-75814472 TTCACTCATCACCAAGGGGATGG + Intergenic
1129731953 15:77937413-77937435 CTCACTCATTACCATGGGGAGGG - Intergenic
1129911484 15:79231029-79231051 CTCACTCATCGCCAAGGGGATGG + Intergenic
1130668442 15:85889483-85889505 TTAACCCCTCAGCTAGGGGAAGG + Intergenic
1130777339 15:86998655-86998677 CTCAGTACTCAACAAGGGAATGG + Intronic
1130865558 15:87930487-87930509 CTCACTCCTCAGAAGGAGGAAGG + Intronic
1131369780 15:91870053-91870075 CTCAATCCTCCCCAAAGGGAAGG - Intronic
1131694691 15:94863877-94863899 CTCACTCATCACCAAGGGGATGG + Intergenic
1131749762 15:95493832-95493854 CTCACTCCTCATCAAGAGGCTGG + Intergenic
1131964065 15:97819835-97819857 TTCACTCATCACCAAGGAGATGG + Intergenic
1132249647 15:100325580-100325602 CTCACTCATCACCACGGGGATGG - Intronic
1132373052 15:101311047-101311069 CTCACTCATCACCAAGGGGATGG - Intronic
1133453404 16:5922215-5922237 CTCACTCATCACCAAGGGGATGG + Intergenic
1133558067 16:6924433-6924455 CTCACTCATCACTAAGGGGATGG + Intronic
1133856655 16:9555880-9555902 CTCACTCATCAGCAAGCAGTGGG + Intergenic
1133866871 16:9652285-9652307 CTCACTCATCACCAAGAGGATGG + Intergenic
1134089361 16:11383420-11383442 CTCACTCTTCACCAAACGGAGGG + Intronic
1134126577 16:11620286-11620308 CTCACTCATCAGCAAGGGGATGG - Intronic
1134356540 16:13487517-13487539 CTCATTTATCACCAAGGGGACGG + Intergenic
1135135625 16:19884187-19884209 CGCATTACTCAGCAAGGGGAGGG - Intronic
1135203688 16:20463457-20463479 CTCACTCATAACGAAGGGGATGG - Intronic
1135203789 16:20464572-20464594 CTCATTTATCACCAAGGGGATGG + Intronic
1135215214 16:20560367-20560389 CTCATTTATCACCAAGGGGATGG - Intronic
1135215313 16:20561479-20561501 CTCACTCATAACGAAGGGGATGG + Intronic
1135477013 16:22785770-22785792 CTCACTCATCACCAAGGGGAAGG + Intergenic
1135487867 16:22881636-22881658 CTAACTTCTCAGCAAGGTGAGGG + Intronic
1135873089 16:26170236-26170258 CTCACTTATCACCAAGGGGATGG - Intergenic
1135876388 16:26204228-26204250 CTCACTCATCACTAAGGGGATGG - Intergenic
1135893640 16:26379103-26379125 CTCACTCATCACCAAGGGGCGGG + Intergenic
1135946634 16:26870674-26870696 CTCACTCATCACCAAAGGGATGG - Intergenic
1136018595 16:27425004-27425026 CTCACTCATCACCAAGCGGATGG + Intronic
1136926242 16:34377411-34377433 CTCCCTCATCACCAAGGGGATGG - Intergenic
1136978332 16:35034396-35034418 CTCCCTCATCACCAAGGGGATGG + Intergenic
1137037690 16:35580236-35580258 CTCATTCCTCATCAAGGCAAGGG + Intergenic
1137652211 16:50130253-50130275 CTCACTTATCACCAAGGGGATGG + Intergenic
1137871424 16:51953984-51954006 CTCAGACTGCAGCAAGGGGATGG - Intergenic
1137954522 16:52815494-52815516 CACACTCCTTGGGAAGGGGAGGG - Intergenic
1138093821 16:54196713-54196735 CTCACTCATCACTAAGGGGATGG + Intergenic
1138199998 16:55081596-55081618 CTTACTCCCCACCAAAGGGATGG + Intergenic
1138221892 16:55258811-55258833 CTCCCTCCTCTGCAGGAGGACGG + Intergenic
1138230959 16:55335883-55335905 CCCACTCCTCACCAAGGAGATGG + Intergenic
1138735612 16:59247287-59247309 CTCACTCATCAGCAAGGAGAGGG - Intergenic
1139128088 16:64106298-64106320 CTCACTTATCACCAAGGGGATGG - Intergenic
1140556244 16:75924742-75924764 CTCACTCATCACCAAGGGGATGG - Intergenic
1140792978 16:78410064-78410086 CTCACTTATCACCAAAGGGATGG - Intronic
1140944175 16:79752212-79752234 CACACTCCTGGTCAAGGGGAGGG + Intergenic
1141008360 16:80374141-80374163 CTCACTTATCACCAAGGGGATGG + Intergenic
1142625161 17:1187167-1187189 CTCACCATTCAGCAAGGCGAGGG + Intronic
1144148134 17:12417961-12417983 CTCACTCATCACCCAGGAGATGG + Intergenic
1144176462 17:12712424-12712446 CTCACTCCTCAGCACAGGGTAGG - Intronic
1144214481 17:13043271-13043293 CTCACTTATCACCAAAGGGATGG + Intergenic
1144357809 17:14462510-14462532 CTCACTCATCACCAAAGGGATGG + Intergenic
1145775409 17:27524504-27524526 CTCCCTCCTTGGGAAGGGGATGG - Intronic
1146296292 17:31653248-31653270 CTCATTCATCACCAAGGAGAGGG + Intergenic
1147037662 17:37693814-37693836 CTCACTTATCACCAAGGGGATGG - Intronic
1147413507 17:40271392-40271414 CTCCCGCCTCAGCAAAGGGCTGG - Intronic
1148560476 17:48603029-48603051 CTCAGTCCTAAGCTAGGAGAGGG - Intronic
1148680252 17:49469771-49469793 CTCCCTCCTCTGCTAGAGGAGGG + Intronic
1148889011 17:50794363-50794385 CTCACTCATTACCATGGGGAGGG + Intergenic
1149002871 17:51775093-51775115 CTCACTCCTCTAAAGGGGGAGGG + Intronic
1149632157 17:58135242-58135264 CTCACTTATTACCAAGGGGATGG + Intergenic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1150526389 17:65927066-65927088 CTCACTTATCACCAAGGGGATGG - Intronic
1150667611 17:67156962-67156984 CTTACTTATCATCAAGGGGATGG - Intronic
1150835322 17:68558458-68558480 CTCATTCATCACCAAGGAGACGG - Intronic
1150938129 17:69659776-69659798 CTCACTCTTCACCAAGGGGATGG + Intergenic
1150956787 17:69868460-69868482 CTCACTCATCACCAAGGGGGTGG + Intergenic
1151415755 17:73961641-73961663 CTCACTTATCACCAAAGGGATGG - Intergenic
1151652513 17:75478813-75478835 CTCCCACCACACCAAGGGGAAGG - Intronic
1151902212 17:77023860-77023882 CTCACTTTTCACCAAGGGGGTGG - Intergenic
1151938366 17:77277931-77277953 CCCACTCCTATGAAAGGGGAGGG - Intergenic
1152300571 17:79493224-79493246 CTCACTCATCACCAAGGGGGTGG + Intronic
1152352423 17:79791130-79791152 CTGACTCCTCAGCAAGGGGCTGG + Intergenic
1153276098 18:3369139-3369161 CTCACTCATCACCAAGGGGATGG - Intergenic
1153525707 18:5992633-5992655 CTCACTTATCACCAAGGGGATGG - Intronic
1153578661 18:6549472-6549494 ATCACTCATCACTAAGGGGATGG + Intronic
1153578944 18:6551573-6551595 CCCACTTATCACCAAGGGGATGG + Intronic
1153607220 18:6846686-6846708 CTCACCCCTCAGCCAGAAGAGGG + Intronic
1153654347 18:7269753-7269775 CTCACTCATCACCACGGGGATGG + Intergenic
1153736782 18:8078873-8078895 TTCACTCATCACCAAGGGGGTGG + Intronic
1153744046 18:8158869-8158891 CTCACTCACCACCAAAGGGATGG + Intronic
1153753820 18:8260517-8260539 CTCACTCATTAGCATGAGGATGG + Intronic
1153774695 18:8442176-8442198 CTCACTCGTCACCAAGGGGATGG - Intergenic
1153966249 18:10184843-10184865 CTCACTTATCACCAACGGGATGG - Intergenic
1154110125 18:11560579-11560601 CTCACTCATCACCAAGCGGCCGG + Intergenic
1154372417 18:13776118-13776140 CTCACTTATCACCAAAGGGATGG + Intergenic
1154484552 18:14863314-14863336 CTTGCTCATCACCAAGGGGATGG - Intergenic
1155084235 18:22440874-22440896 CTCAATCATCATCCAGGGGATGG + Intergenic
1155350411 18:24900557-24900579 CTCACTTATCACCAAAGGGATGG + Intergenic
1155553619 18:26993944-26993966 CTCTCTCCTCGGCTGGGGGATGG + Intronic
1155590395 18:27420896-27420918 CTCACAGATCAGCAAGGGGCTGG + Intergenic
1155621948 18:27789347-27789369 CTCATTTATCACCAAGGGGATGG + Intergenic
1155840903 18:30641231-30641253 CTCTCTCTTCAAAAAGGGGAAGG - Intergenic
1155915894 18:31556921-31556943 CTGGCTCATCACCAAGGGGATGG - Intergenic
1155921816 18:31611060-31611082 TTCACTCCCCAGGAGGGGGAGGG + Intergenic
1156093994 18:33507842-33507864 CTCATTCTTTAGGAAGGGGAAGG - Intergenic
1156134426 18:34019902-34019924 CTCACTCATTACCATGGGGATGG - Intronic
1156454901 18:37287413-37287435 GTGACTCCTGAGCAATGGGAAGG - Intronic
1156524852 18:37757430-37757452 CTCACTTATCACCAAGGGGATGG - Intergenic
1156524977 18:37758401-37758423 CTCACTTATCACTAAGGGGATGG + Intergenic
1156615719 18:38782497-38782519 CTCACTTATCACCAAGGGGATGG + Intergenic
1156622147 18:38865006-38865028 CTTACTCATTACCAAGGGGAGGG - Intergenic
1156909968 18:42400150-42400172 CTCAATCATCACCAAGCGGATGG - Intergenic
1157018989 18:43756474-43756496 CTCACTTATCACCAAGGGTATGG - Intergenic
1157426749 18:47590826-47590848 CTCACTCATCACCAAGGGAATGG - Intergenic
1157516275 18:48313891-48313913 CTCACTCATCACCAAGGAGATGG - Intronic
1157522991 18:48357995-48358017 CTCACTTATCACCAAGGGGATGG - Intronic
1157524944 18:48373611-48373633 CTCACTTATCACCAAGGGGATGG - Intronic
1157623240 18:49028048-49028070 CTCACTCATCCCCAAGGGAATGG + Intergenic
1157685181 18:49637614-49637636 CTCACTCATCACCACGGGGATGG - Intergenic
1157841689 18:50965278-50965300 CTCAGTCATCACCAAGGGCATGG - Intergenic
1157892000 18:51426698-51426720 CTCACTTATCACCAAGGGGATGG - Intergenic
1158446791 18:57529105-57529127 CTCACTGGTCACCAAGGGGATGG + Intergenic
1158504909 18:58038906-58038928 CTCACTTATCACCAAGGTGATGG - Intergenic
1158904602 18:62000112-62000134 CTCACTCATCACCAAATGGATGG + Intergenic
1158904924 18:62002515-62002537 TTCATTCATCACCAAGGGGATGG + Intergenic
1159265111 18:66070587-66070609 CTCACTTACCAACAAGGGGATGG - Intergenic
1159265688 18:66075176-66075198 CTCACTCATTACCAAGGAGATGG - Intergenic
1159714410 18:71804150-71804172 CTCATTCATCATCAAGAGGATGG + Intergenic
1159761469 18:72431374-72431396 GTCACTGCTCAGCAAGTTGATGG + Intergenic
1159772957 18:72569746-72569768 CTCACTCATCACCAAGGGGAAGG + Intronic
1160010032 18:75100367-75100389 CTCACTCATCACCAAGGGGATGG + Intergenic
1160121632 18:76135487-76135509 CTCACTCATTACCATGGGGAGGG + Intergenic
1160131626 18:76230550-76230572 CTCACTGCTCTGGAAGGGTAGGG + Intergenic
1160313761 18:77821488-77821510 CTCATTCATCACCAAGGGGAAGG - Intergenic
1160355883 18:78228188-78228210 CTCACTCCTGGGCAAGGCAAAGG + Intergenic
1161341533 19:3745794-3745816 CCCACTCCTCAGGAGGAGGAGGG + Intronic
1161359756 19:3841276-3841298 CTCACTCCTCGGCAGGGCCATGG + Intronic
1161997740 19:7724326-7724348 CTCACTTATCACCATGGGGATGG + Intergenic
1162841994 19:13363575-13363597 CCCACTCCTCCCCACGGGGAGGG - Intronic
1163796423 19:19340852-19340874 GTTCCTCCTCAGCAAGGGGATGG + Exonic
1164602399 19:29571312-29571334 CTCACTCAACACCAAAGGGATGG + Intergenic
1164710723 19:30355325-30355347 CTCACTCATCACCAATGGGATGG + Intronic
1164775933 19:30853569-30853591 CTCACCCCTGACCCAGGGGATGG + Intergenic
1164801623 19:31081387-31081409 CTCACTCACCATCAAGAGGATGG - Intergenic
1164850804 19:31482647-31482669 CTCACTCATTACCATGGGGATGG + Intergenic
1164858563 19:31544446-31544468 CTCACTCATTACCATGGGGAGGG + Intergenic
1165138037 19:33683094-33683116 CCAACTCATCACCAAGGGGATGG + Intronic
1165706587 19:37980574-37980596 CTCCCTCCAGAGCAGGGGGAAGG + Intronic
1165884357 19:39067083-39067105 CTCACTCACTACCAAGGGGATGG + Intergenic
1165932929 19:39371989-39372011 CTCATCCCTCACCAAGGGGAGGG + Intronic
1166176792 19:41078902-41078924 CCCACTCATCACCAAGGGGATGG + Intergenic
1166281833 19:41799243-41799265 CTGACTTGTCACCAAGGGGATGG - Intronic
1166459577 19:42974386-42974408 CAGCCTCCTCAGCATGGGGATGG - Intronic
1166476895 19:43134422-43134444 CAGCCTCCTCAGCATGGGGATGG - Intronic
1166545805 19:43634523-43634545 CTGACTCCTCAGGAGGGGGAGGG - Intronic
1167295406 19:48646428-48646450 CATCCTCCGCAGCAAGGGGAAGG + Intergenic
1167413370 19:49357759-49357781 GTCACTCATCATCAAGGAGATGG - Intronic
1167557751 19:50206268-50206290 CGGACTCCTCAGCCTGGGGAAGG + Intronic
1167643333 19:50693726-50693748 GCCACTTCTCAGCATGGGGAGGG - Intronic
1168264472 19:55214691-55214713 CTCACTCATCACCATGGGGATGG + Intergenic
1168427831 19:56253129-56253151 CTCACACCTCTGCAAGGGAAAGG - Intronic
925105200 2:1285033-1285055 CTTGCTCCTCAGCTTGGGGATGG - Intronic
925122640 2:1431187-1431209 CTGACTCATCACCAAGAGGATGG - Intronic
925216224 2:2097902-2097924 CTCATTCATCAACAAGGGTATGG - Intronic
925312064 2:2891822-2891844 CTCACTCATCATCAAGGAGATGG + Intergenic
925516528 2:4689716-4689738 CTCACTCATCATCAAGGGGATGG + Intergenic
925516763 2:4691727-4691749 CACACTCATCACCAGGGGGATGG + Intergenic
925559988 2:5181180-5181202 CCCACTCATCACCAAGGGGATGG + Intergenic
925882168 2:8362070-8362092 CTCACTCATCACCAAGGGGATGG - Intergenic
926062024 2:9810415-9810437 CTCTCTCCTGGGCTAGGGGATGG + Intergenic
926142480 2:10376016-10376038 CTCACTCATCACCAGGGGGATGG - Intronic
926335288 2:11858246-11858268 CTCACTCATCACCAAGGGGATGG + Intergenic
926350657 2:11991195-11991217 CTCACTTGTCACCAAGAGGATGG - Intergenic
926563491 2:14444228-14444250 CACACTCATCACCAAGAGGATGG + Intergenic
926563769 2:14446423-14446445 CTCACTCATCACCAAGGGGACGG + Intergenic
926629315 2:15122455-15122477 CTCGCTCATCAGCAAGGGGTTGG + Intergenic
926629480 2:15123572-15123594 CTCACTTATCACCAAGGAGATGG - Intergenic
926629812 2:15126104-15126126 CTCACTCGTCACCAAGGGAATGG - Intergenic
926660314 2:15458442-15458464 CTCACTTATCACCAAGGGGATGG - Intronic
927171250 2:20371999-20372021 CTCACTCATTACCATGGGGAAGG + Intergenic
927308280 2:21598794-21598816 GTCAGTCCTCAGCAAGAAGAGGG - Intergenic
927397114 2:22665280-22665302 CTCACTTATCACCAAGGGGATGG - Intergenic
927480794 2:23452356-23452378 CTCACTCATCACCAAGGGGATGG + Intronic
927558084 2:24049895-24049917 CTCCCTCCGGAGCCAGGGGAGGG + Intronic
927740164 2:25561617-25561639 CTCACTCATCACCAAGGGAATGG - Intronic
928848460 2:35709983-35710005 CTCACTCATTACTAAGGGGATGG + Intergenic
929547946 2:42868250-42868272 CTCACTTATCACCAAGAGGATGG + Intergenic
929833801 2:45375431-45375453 CTCACTTATCACCAAGAGGATGG + Intergenic
930305446 2:49669391-49669413 CCCACTTATCACCAAGGGGATGG + Intergenic
930479066 2:51924330-51924352 CTCACTTATCACCAAGGGGATGG - Intergenic
930867213 2:56133681-56133703 CTCACTCATCACCAAGGGGATGG - Intergenic
930894559 2:56430137-56430159 CTCATCCTCCAGCAAGGGGATGG - Intergenic
930902623 2:56526372-56526394 CTCACTTACCACCAAGGGGATGG + Intergenic
930906495 2:56574674-56574696 CTCACTCATCACCAAGGGGGTGG - Intergenic
931111171 2:59113209-59113231 CTCACTCATCACCCAGAGGATGG - Intergenic
931200317 2:60091449-60091471 GAGACTCCTCTGCAAGGGGAAGG - Intergenic
931852489 2:66265796-66265818 CTCACTCATCACCAAGGGGATGG + Intergenic
931952897 2:67385079-67385101 CTCACTCATCACCAAGGAGATGG - Intergenic
932308886 2:70724247-70724269 CTCGCTCCACAGCACGGGGTGGG - Intronic
932360673 2:71103083-71103105 CTCACTCATCACCAAGGGGATGG - Intergenic
932606046 2:73166363-73166385 CCCACTCCTCAGCTGGGGAAAGG + Intergenic
932982522 2:76687018-76687040 CTCACTTATCACTAAGGGGATGG - Intergenic
933198060 2:79415166-79415188 CTCACTCATAACCAAAGGGATGG - Intronic
933282405 2:80346427-80346449 CTCACTTATCACCATGGGGATGG + Intronic
933402140 2:81811881-81811903 CTCACTTATCACCAAGGGGATGG - Intergenic
933490365 2:82978403-82978425 CTCACTCATCACCAATGGGATGG - Intergenic
933926381 2:87094088-87094110 CCCACTCCTCAGCTGGGGAAAGG - Intergenic
934033267 2:88066641-88066663 CTCACTCCTGAGTAAGAAGAAGG + Intergenic
934551517 2:95265631-95265653 CTCACTCATTACCAAGGGGACGG - Intergenic
934702097 2:96450772-96450794 CCCACTCATCACCAAGAGGATGG + Intergenic
934784495 2:96995184-96995206 GTCTCTTCCCAGCAAGGGGAAGG + Intronic
934916216 2:98303048-98303070 CCCACACATCAGGAAGGGGAAGG - Intronic
934944310 2:98526924-98526946 CTCACTCATCACCAAGGGGATGG + Intronic
935065745 2:99645963-99645985 CCCACTCCTTAGGAAGGGAAAGG + Intronic
935228148 2:101072464-101072486 CTCACTCATCACCAAGGGGATGG + Intronic
935349247 2:102139621-102139643 CTCGCTTATCACCAAGGGGATGG - Intronic
935523463 2:104138095-104138117 CTCACTTATCACCAAGGGGATGG - Intergenic
935965092 2:108465025-108465047 CTCACTTTTCACCAAGGGAATGG + Intronic
936884188 2:117289569-117289591 CTCACTCATCAACAAGAGGATGG + Intergenic
937462927 2:122104860-122104882 CTCACTTATCACCAAGGAGATGG + Intergenic
937534579 2:122870203-122870225 CTCATTCATCACCAAGCGGAAGG - Intergenic
937955592 2:127420251-127420273 CTCCCTCCTCCACACGGGGATGG + Intronic
937996409 2:127697942-127697964 CTCCCACCTCCCCAAGGGGAAGG - Intergenic
938057357 2:128226168-128226190 CTCACTCATCACCAAGGGGATGG - Intergenic
938078518 2:128355229-128355251 CTCACTCATCACCATGGGGATGG - Intergenic
938141884 2:128801085-128801107 CCCACTCCTCACCAAGGCCATGG + Intergenic
938222547 2:129582644-129582666 CTCACTCATCATCAACGGGATGG + Intergenic
938436579 2:131286808-131286830 CTAACCCCTGAGCTAGGGGATGG - Intronic
938590916 2:132735327-132735349 CTCACTTGTCACTAAGGGGATGG - Intronic
938911668 2:135890926-135890948 CTCACTCATCAGCAAGGCGATGG - Intergenic
939215758 2:139236320-139236342 CTCACTTGTCACCAAAGGGATGG - Intergenic
939447887 2:142333836-142333858 CTCACTCATCATCAAGGCGATGG + Intergenic
940081840 2:149811951-149811973 CTCACTTATCACCGAGGGGATGG - Intergenic
940451711 2:153845481-153845503 CTCACTTATCACCAAGGGGATGG + Intergenic
941069339 2:160938718-160938740 CTCACTCATCACCAAGGGGATGG + Intergenic
941466862 2:165838340-165838362 CTCACTTATCACCAAGGGGATGG - Intergenic
941648468 2:168067318-168067340 CTCACTTATCACCAAGGGAATGG - Intronic
941984476 2:171496796-171496818 CTCACTTATCACCAAGGGGATGG + Intergenic
942347304 2:175016905-175016927 CTCACTTATCACTAAGGGGATGG - Intergenic
942507998 2:176664089-176664111 CTCTCTCCTTAGCAGGGGGTTGG + Intergenic
942539741 2:177003143-177003165 CTCACTCATCACCAAGAGGGTGG + Intergenic
942592414 2:177560213-177560235 CTCACTCATCAGCAAGGGGATGG + Intergenic
943171114 2:184401618-184401640 CTCACTCATTACCAAGGGGTTGG - Intergenic
943230535 2:185244987-185245009 TTCACTTATCACCAAGGGGATGG - Intergenic
943402696 2:187435371-187435393 CTCACTTATCACCAAGGGGATGG + Intronic
943553447 2:189371018-189371040 CTCACTTATCACCAAGGGGATGG - Intergenic
943597143 2:189872007-189872029 CTCACTCATTACCATGGGGATGG + Intronic
943801337 2:192061754-192061776 CTCCCTCATCACCAAGGGTATGG - Intronic
943844474 2:192626261-192626283 CTCACTTCTCACCAAGGCAATGG + Intergenic
944152568 2:196575890-196575912 CTCACTCATCACCAACGGGAGGG + Intronic
944160210 2:196652008-196652030 CTCACTCATTACCATGGGGAGGG + Intronic
944508163 2:200436913-200436935 CTCGCTTATCACCAAGGGGATGG - Intronic
945084781 2:206119978-206120000 CTCACTCATCACCAAGGTGATGG - Intronic
945218735 2:207463201-207463223 CTCACTTATCATCAAGGGGATGG - Intergenic
945315977 2:208371048-208371070 CTCACTCATCACCATGGGGATGG + Intronic
945521461 2:210832866-210832888 CTCACTTATCACCAAGAGGATGG + Intergenic
945639941 2:212412369-212412391 CTCACTCATTACCAAAGGGAGGG - Intronic
946141070 2:217691156-217691178 CTCACTTATCACCAAGGGGATGG - Intronic
946358491 2:219204489-219204511 TTCACTCATCACCAAGAGGATGG - Intronic
946468157 2:219931145-219931167 CTCACTCATTACCACGGGGAGGG + Intergenic
946619741 2:221548131-221548153 CTCAGTCATCACCAAGAGGATGG - Intronic
947091920 2:226521507-226521529 TTCACTTATCACCAAGGGGATGG + Intergenic
947147926 2:227085716-227085738 CTCATTCATCACCAAAGGGATGG + Intronic
947249951 2:228090686-228090708 CTCACTCATCATCAAGGAGTTGG - Intronic
947385979 2:229590901-229590923 CTCACTTATCACCAAGGGGACGG - Intronic
947403300 2:229749962-229749984 CTCACTCGTCACCAAGGGGCTGG - Intergenic
947874527 2:233459514-233459536 CTGACTGCTCAGTGAGGGGATGG + Intronic
948030688 2:234814994-234815016 CTCACTCATCACCAAGGAGATGG - Intergenic
948129737 2:235591711-235591733 TTCACTCATCGCCAAGGGGATGG - Intronic
948134308 2:235624819-235624841 CTCGCTCATCACCAAGGGGATGG - Intronic
948210014 2:236185920-236185942 CTCACTCATCACCAAGGGGATGG - Intergenic
948244407 2:236466691-236466713 TTCACTCATCACCAAGGGGATGG + Intronic
948322556 2:237082408-237082430 CTCACTCATCACCAAGTGGATGG + Intergenic
948527119 2:238577955-238577977 CTTACCCATCACCAAGGGGAAGG + Intergenic
948676101 2:239597612-239597634 CCCACTCATCACCAAGGGGATGG - Intergenic
948710836 2:239824568-239824590 CTCACTCATCACCAAGAGGACGG - Intergenic
948783419 2:240338739-240338761 CTCCCTCATCACCATGGGGATGG - Intergenic
948813632 2:240498769-240498791 CTCACTCGTCCCCAAGGGGATGG - Intronic
1168809353 20:694096-694118 CTCACTTATTACCAAGGGGATGG + Intergenic
1168842337 20:917337-917359 GTGAGTCCTCAGCATGGGGATGG + Intergenic
1168976213 20:1968052-1968074 CTCGCTCACCACCAAGGGGATGG - Intergenic
1169412237 20:5381602-5381624 CTCACTCATCACCAAGGTGATGG + Intergenic
1169511591 20:6269645-6269667 CTCACTCATCACCAAGGTGATGG - Intergenic
1169703672 20:8477767-8477789 CTCACTCATCACCAGGGCGATGG + Intronic
1169741006 20:8894077-8894099 CTCACTTATCACCAAAGGGATGG - Intronic
1169860838 20:10150705-10150727 CTCACTTATCACCAAGGGGATGG + Intergenic
1171445048 20:25196838-25196860 CTCTCTCCAAGGCAAGGGGAGGG - Intronic
1171819106 20:29817174-29817196 CTCAAGCCTCAGCAATGGCAGGG - Intergenic
1171898720 20:30836009-30836031 CTCAAGCCTCAGCAATGGCAGGG + Intergenic
1172314835 20:33945570-33945592 CTCACTCATTACCATGGGGATGG + Intergenic
1172911414 20:38411997-38412019 CTCACTCATTACCATGGGGAGGG + Intergenic
1172953168 20:38735309-38735331 CTCACTTATCACCAAGGAGATGG - Intergenic
1173446385 20:43122570-43122592 CTCACTCGTTAACAAGTGGATGG - Intronic
1174123269 20:48283423-48283445 CTCGCTCATTACCAAGGGGATGG + Intergenic
1174289724 20:49499480-49499502 CTCACTTCTTACCATGGGGAGGG + Intergenic
1174679633 20:52393758-52393780 CTCACTTATCACCAAGGGGATGG - Intergenic
1175070896 20:56332878-56332900 CTCACTCATCACCAAGGGTATGG - Intergenic
1175761435 20:61564431-61564453 CTCACTCAGCACCGAGGGGAAGG - Intronic
1175869507 20:62201610-62201632 CTCACTGCTGCGCAAGGGGTGGG + Exonic
1175904281 20:62371988-62372010 CTCACACCCCAGCAAGGTGCTGG - Intergenic
1175985445 20:62762101-62762123 CCCACTCCTGAGCAGGGGTAGGG - Exonic
1176251337 20:64121887-64121909 CTCACTCATCACCATGAGGAGGG + Intergenic
1176796769 21:13376151-13376173 CTCGCTCATCACCAAGGGGATGG + Intergenic
1176898027 21:14406059-14406081 CACACTTGTCACCAAGGGGATGG - Intergenic
1177658885 21:24056615-24056637 CTCACTCATCACAAAGGGAATGG - Intergenic
1177696997 21:24585786-24585808 CTCACTTATCACCAAGGCGATGG + Intergenic
1177762256 21:25415089-25415111 CTCACTTATCATGAAGGGGATGG + Intergenic
1177773822 21:25546062-25546084 CTCACTCATCACCAAGGGGATGG + Intergenic
1177959883 21:27650365-27650387 CTCACTACTCACCAAAGAGATGG + Intergenic
1178052491 21:28763445-28763467 CTCACTCATCACCAAGGGGATGG + Intergenic
1178303839 21:31474129-31474151 CTCACTCATCACCATGGGGATGG + Intronic
1178369791 21:32017906-32017928 CTCACTCCTTAGCAAGAATATGG + Intronic
1178474619 21:32926626-32926648 CTCACTCATCACCAAGGGGATGG + Intergenic
1178505731 21:33161514-33161536 CTCACTTATCACCAAGGGTATGG - Intergenic
1178765798 21:35450087-35450109 CTCACTCATCACCGAGGGGATGG + Intronic
1178815445 21:35925102-35925124 GTCACATCTCAGCAAGGGGCTGG - Intronic
1179178437 21:39025566-39025588 CTCGCTCATCACCAAGGGAATGG + Intergenic
1179330599 21:40397311-40397333 CACACTCGTCACCAAGGAGATGG - Intronic
1179356456 21:40664897-40664919 CTCACTTATCACCAAGGGGATGG - Intronic
1179601582 21:42481142-42481164 CTCACTCATCACCACAGGGAAGG - Intronic
1179935815 21:44602743-44602765 CTCACTCCTCTGCAAGCAGCTGG - Intronic
1180003332 21:45005054-45005076 CTCACTCTTCACCACGGGGATGG - Intergenic
1180093811 21:45545299-45545321 CTCACTCATCACCAAGGTGATGG - Intergenic
1180109319 21:45640717-45640739 CTCCCTCCCCAGCAGGGGGATGG + Intergenic
1180438266 22:15335584-15335606 CTCATTGATCACCAAGGGGATGG + Intergenic
1180521127 22:16205946-16205968 CTCATTGGTCACCAAGGGGATGG + Intergenic
1181897527 22:26123711-26123733 CTCACTCATCACCAAGGGGATGG + Intergenic
1181986004 22:26800207-26800229 CTCACTCATCACCAAGGGGATGG - Intergenic
1182132944 22:27871863-27871885 CTCACTTATCACCAAGGGGATGG - Intronic
1182861090 22:33560030-33560052 CTTACTCCTCTTCAAGGGAAAGG + Intronic
1182950339 22:34369032-34369054 AACACTCCTCAGCAAGTGCAAGG - Intergenic
1183049422 22:35248756-35248778 CTCACTTATCATCAAGAGGATGG + Intergenic
1183275889 22:36897474-36897496 CTCACTCATCACCATGGGGATGG - Intergenic
1183285021 22:36956591-36956613 CTCACTCATCCCCAAGGGGATGG - Intergenic
1183285134 22:36957583-36957605 CTCACTCATCACCAAGGGGATGG + Intergenic
1183676515 22:39301809-39301831 CTCACACCTGAGGAAGGGGGCGG - Intergenic
1183879145 22:40811751-40811773 CTCACTCATCACCAAGGGGATGG + Intronic
1184063043 22:42096564-42096586 CTCACTCATCACCAAGGGGATGG - Intergenic
1184464547 22:44661105-44661127 CTCACTCGTCACCAAGGAGGTGG + Intergenic
1184859374 22:47164533-47164555 CAGTCTCCTCAGCAAGGGCAGGG - Intronic
1184899599 22:47436672-47436694 CTCACTAATCACCCAGGGGAGGG - Intergenic
1184982893 22:48106856-48106878 CTCACTCATCACTAAGGGGGTGG + Intergenic
1185018079 22:48357354-48357376 CTCAATCATCACCAAGGGGATGG + Intergenic
1185187918 22:49413939-49413961 CTCTCTCCTCAGCTGGTGGACGG + Intergenic
1185209705 22:49563816-49563838 CTCACTCAGCAGCAAGGGGATGG + Intronic
1185245811 22:49772092-49772114 CTCACTCCTCTGTAAGAGCAAGG + Intergenic
949126078 3:446528-446550 CTCACTCCTCAGCCTGCAGATGG - Intergenic
949473872 3:4423789-4423811 CTCACTCATCACCAAGGGGACGG - Intronic
949734896 3:7160606-7160628 CTCAGTCTTAAGCAAGGTGAAGG - Intronic
949936770 3:9121770-9121792 CTGATTCCTAATCAAGGGGAAGG + Intronic
949944115 3:9176777-9176799 CTCACTCATCACCAAGGAGATGG + Intronic
950160196 3:10754736-10754758 CTCACTCATCACCAGGAGGATGG - Intergenic
950281275 3:11710118-11710140 CTCACGCATCACCAAGGGGATGG + Intronic
950312801 3:11973966-11973988 CTCAGTCCTCAGCTGGGGGCAGG + Intergenic
950469758 3:13177347-13177369 CTCTCTACCCAGCATGGGGATGG - Intergenic
950630962 3:14281672-14281694 CTCACTTATCACCAAGCGGATGG - Intergenic
950786460 3:15440551-15440573 CTCCCTCCCCAGCTAGTGGAGGG + Exonic
950976324 3:17249535-17249557 CTCACTTATCACCAAGGGGATGG - Intronic
950996643 3:17505252-17505274 CTCACTTGTCACCAAGGGGATGG - Intronic
951184511 3:19697066-19697088 CTCACTCATTACTAAGGGGATGG - Intergenic
951226217 3:20124494-20124516 CTCATTCATCAACAAGGGGATGG + Intronic
951237108 3:20249546-20249568 CTCACTTATAACCAAGGGGATGG + Intergenic
951237420 3:20251859-20251881 CTCACTCACCACCAAGAGGATGG + Intergenic
952110910 3:30123034-30123056 CTCACTTATCACCAAGGGGATGG - Intergenic
952739286 3:36720120-36720142 CTCACTTGTCACCAAGGGGATGG - Intronic
952777581 3:37061036-37061058 CTCACTCATCACCAAGGGAATGG - Intronic
953091162 3:39727256-39727278 CTCACTCATCACCAAGGGAATGG + Intergenic
953205061 3:40819148-40819170 CACACTTCTCATGAAGGGGACGG - Intergenic
953321856 3:41979736-41979758 CTCACTCATCACCAAGGGAATGG + Intergenic
953701513 3:45199528-45199550 CCCACCCCACATCAAGGGGAGGG + Intergenic
953914149 3:46907092-46907114 CTCGCTCCTCAACAAGGATAGGG + Intergenic
953973138 3:47362521-47362543 CTCACTTATCATGAAGGGGATGG - Intergenic
954467034 3:50661557-50661579 CTCACTTATCACCAAGGGGATGG + Intergenic
954504089 3:51051916-51051938 CTCACTCATCACCAAGGGGATGG + Intronic
954590165 3:51776265-51776287 CTCAATCCTCAGCAATAGTAAGG + Intergenic
954683605 3:52358907-52358929 CTCACTCCTAATCATCGGGATGG + Intronic
954804835 3:53211920-53211942 CTCACTCATCAACAAGGGGATGG + Intergenic
955130462 3:56161068-56161090 TTCACTTAGCAGCAAGGGGATGG - Intronic
955669445 3:61387999-61388021 CTTACTCATCACCAAGGGGATGG - Intergenic
956218210 3:66872252-66872274 CTTACTCATCACCAAGGGCATGG + Intergenic
956311993 3:67891487-67891509 CTCACTTATCACCAAGGAGATGG - Intergenic
956743710 3:72294871-72294893 CTCAAGGCTGAGCAAGGGGAGGG - Intergenic
957285304 3:78210009-78210031 TTCACTTTTCACCAAGGGGATGG - Intergenic
957314579 3:78560863-78560885 CTCACTCATCACCAAGGGGATGG + Intergenic
957318746 3:78602207-78602229 CTCACCTATCATCAAGGGGATGG - Intronic
957576652 3:82016039-82016061 CTCACTTATCACCAAGGGGATGG - Intergenic
957877419 3:86165886-86165908 CTCACTCTTCAGCATGTGGTGGG + Intergenic
957969325 3:87362954-87362976 CTCACTCATCAACAGGGAGATGG - Intergenic
959691813 3:109205926-109205948 CTCAGTACCCAACAAGGGGAAGG - Intergenic
959809314 3:110596099-110596121 TTCACTCATCAACAAGTGGATGG + Intergenic
959889069 3:111533902-111533924 CTGCCTCCTCAGCAAGGGAAGGG - Intronic
959935159 3:112021588-112021610 GTCACTCATCACAAAGGGGATGG - Intergenic
960134031 3:114087810-114087832 GTCACTTATCACCAAGGGGATGG + Exonic
960260503 3:115562846-115562868 CTCTCTACTCAGAAAGAGGATGG + Intergenic
960397128 3:117151405-117151427 CTCACTCATCACCAGGGGGAAGG + Intergenic
960516045 3:118603963-118603985 CTCACTCATTACCATGGGGATGG - Intergenic
960535998 3:118815222-118815244 CTCACTTATTACCAAGGGGATGG + Intergenic
960655650 3:120001178-120001200 CTCACTCATCAACAAGGGGATGG - Intronic
960787074 3:121385405-121385427 CTCACTAATCACCAAGGAGATGG + Intronic
960802696 3:121555387-121555409 CTCACTTATCACCAAGAGGATGG + Intergenic
960927019 3:122804287-122804309 CTCAGTCATCACCAAGGGGATGG + Intronic
960963582 3:123089543-123089565 CTCACTCCTCAAGAGGGAGAGGG + Intronic
961051171 3:123748251-123748273 TTCACACATCACCAAGGGGATGG + Intronic
961097359 3:124169200-124169222 CTGACCCCTCAGAAAGGGAAAGG - Intronic
961433599 3:126900943-126900965 CTCACTCATCACCAAGGGGATGG + Intronic
961833468 3:129637623-129637645 CTCACTCATTACCAAGGGGATGG + Intergenic
962388261 3:134950660-134950682 CTCACTCATCACCAAAGGGATGG + Intronic
962684102 3:137829966-137829988 CTCACTCATTACCAAGGGCATGG + Intergenic
962925441 3:139988985-139989007 CTCCCTCCTCAGCAAGGGCAGGG + Intronic
962942715 3:140140475-140140497 CTCACTTGTTAACAAGGGGAAGG + Intronic
963064443 3:141252550-141252572 CTCACTCACCAGCAAGAGGACGG + Intronic
963443563 3:145373400-145373422 CTCACTTATCACCAACGGGATGG + Intergenic
963849357 3:150194784-150194806 CTCACTTATCACCAATGGGATGG + Intergenic
964022120 3:152025113-152025135 CTCACTTATCACCAAGGGGAAGG - Intergenic
964127597 3:153252059-153252081 CTCACTGATCACCAAGGGGATGG + Intergenic
964246410 3:154659271-154659293 CTCACTTATCACTAAGGGGATGG - Intergenic
964468862 3:157030210-157030232 CTCATTCATCACCAAGGGGATGG + Intronic
964564476 3:158034588-158034610 CTCAAGCCTCAGCAATGGCAGGG - Intergenic
964664736 3:159159769-159159791 CTCACTCATAACCAAGGGGATGG - Intronic
964903178 3:161685934-161685956 CTCACTCATTACCATGGGGAGGG - Intergenic
965077162 3:163993708-163993730 CTCACTTATCACCAAGGGGACGG - Intergenic
965134017 3:164739257-164739279 CTCACTCATCACTAAGGGGATGG + Intergenic
965282399 3:166770821-166770843 CTCACTTATCACCAAGGGGATGG + Intergenic
965562035 3:170071270-170071292 CTCACTTACCACCAAGGGGACGG - Intronic
965767291 3:172144238-172144260 CTCACTCATCACCATGGGGATGG + Intronic
965807133 3:172553258-172553280 CTCACTCATCGCTAAGGGGAAGG + Intergenic
965938254 3:174143070-174143092 CTCACTCATCACCACAGGGATGG + Intronic
965968483 3:174525488-174525510 CTCACTTATTACCAAGGGGATGG + Intronic
966294226 3:178400193-178400215 CTCACTCTTTACCAAGGGAAGGG - Intergenic
966296698 3:178432331-178432353 CTCACTTGTCACCAAGGGGATGG - Intronic
966989706 3:185217197-185217219 CTCTCTTATCACCAAGGGGATGG - Intronic
967047820 3:185753850-185753872 CTCACTTATCACCAAGGGGATGG - Intronic
967048132 3:185756116-185756138 CTCACTCTTCAGTAAGGGTATGG - Intronic
967351169 3:188515209-188515231 CTCACTCATTACCAAGGGGATGG - Intronic
967386838 3:188920347-188920369 CTCACTCATCACTAAGGGGATGG - Intergenic
967763576 3:193252238-193252260 CTCAGTCATCACCAAGGGGTTGG + Intronic
967829300 3:193905033-193905055 CTGACTCTTCAGAAAAGGGATGG + Intergenic
968393605 4:213037-213059 CTCACCCCACAGCCCGGGGAAGG - Intergenic
968405811 4:338210-338232 CTCACCCCACAGCCTGGGGAAGG - Intronic
968419703 4:473731-473753 CTCACCCCACAGCCCGGGGAAGG + Intronic
968535734 4:1127533-1127555 CTCACTTATCACCAAGGAGATGG + Intergenic
968828781 4:2920220-2920242 AACACTCCTCAGCAAGAGAATGG - Intronic
969094164 4:4719593-4719615 TTCACTCATCACCAAGGGAATGG + Intergenic
969283881 4:6190531-6190553 CTCACTCCCCAGCAATGAGGTGG + Intronic
969966592 4:11003097-11003119 CTCACTTATCACCAAGAGGATGG + Intergenic
970113266 4:12662858-12662880 CTCACTCATCACCAAGGGGCTGG + Intergenic
970190182 4:13508600-13508622 CTCACATATCACCAAGGGGATGG - Intergenic
970281092 4:14456506-14456528 CTCACTTATTATCAAGGGGATGG + Intergenic
970344595 4:15141332-15141354 CTCACTTATCACCAAGGGGATGG + Intergenic
970628525 4:17916409-17916431 CTCACTTATCAGCAAGGGGATGG - Intronic
970801170 4:19975363-19975385 CACATTCATCACCAAGGGGATGG - Intergenic
970828995 4:20313395-20313417 TCCACTCATCACCAAGGGGATGG + Intronic
971118675 4:23679549-23679571 TTCACTCTTCACCAAGGGGATGG - Intergenic
971263863 4:25081176-25081198 CTCACTCATTACCAAGAGGAGGG - Intergenic
971455939 4:26843942-26843964 CTCACACATCACCAAGGGGATGG + Intergenic
971570880 4:28209524-28209546 CTCACTTGTCATCAAGGGAATGG - Intergenic
971784665 4:31084864-31084886 CTCACTCATCACCAAGGGGATGG + Intronic
971970219 4:33609827-33609849 AACACTCCTCAGCAAAGGCAAGG + Intergenic
972007664 4:34131391-34131413 CTCACTTATCACAAAGGGGATGG - Intergenic
972211916 4:36848707-36848729 CTCACTTATCACCAAGGGTATGG - Intergenic
972254823 4:37342184-37342206 CTCACTCATTACCATGGGGAGGG - Intronic
973012339 4:45092719-45092741 CTCACTGATCACCAAGGGGATGG + Intergenic
973012638 4:45095142-45095164 CTCACTTATCACCAAGGGGATGG + Intergenic
973057599 4:45679887-45679909 ATCACTCATCACCATGGGGATGG - Intergenic
974013691 4:56629823-56629845 CTCACTTATCACCAAGGGGATGG - Intergenic
974575917 4:63721401-63721423 CTCACTTATCACCAAGGGGATGG + Intergenic
974587821 4:63902330-63902352 CTCACTCATCATAAAGAGGATGG + Intergenic
974606681 4:64160667-64160689 CTCACTTATCACCAAGGGGATGG - Intergenic
975169508 4:71216674-71216696 CTCCCTCCTCAGCATGGAGCAGG - Intronic
975184154 4:71381645-71381667 CTCACTACTCAGCTAGGTGCTGG + Intronic
976262550 4:83159467-83159489 CTCACTCATCACCAAGGAGATGG + Intergenic
976468720 4:85401962-85401984 CTCACTTATCACTAAGGGGATGG - Intergenic
976589490 4:86834961-86834983 CTCACTTATCACCAAGGAGATGG + Intronic
976771356 4:88656520-88656542 CTCACTTATCACCAAGGGGATGG + Intronic
976796238 4:88936489-88936511 CTCACTCATCACCAAGGGGATGG + Intronic
976798377 4:88959394-88959416 TTCACTCATCACCAAGGGGATGG - Intronic
977079852 4:92511310-92511332 CACACTTATCACCAAGGGGATGG + Intronic
977154981 4:93560487-93560509 CTCACTCATCACCAAGAGGATGG + Intronic
977366524 4:96075798-96075820 CTCACAGATCAGCACGGGGAAGG - Intergenic
977547039 4:98396111-98396133 CTCACTTATCACCAAGGGGATGG + Intronic
977707512 4:100087860-100087882 CTCACTCATCACCAAGGGGATGG + Intergenic
977874007 4:102128201-102128223 CTCGCTTATCACCAAGGGGATGG - Intergenic
978421799 4:108541405-108541427 CTCACTCATCACCAAGGGGATGG - Intergenic
978540630 4:109813135-109813157 CTCACTTATCACCAAGGGGATGG + Intergenic
978667331 4:111199966-111199988 TTCACTCATCACCAAGGAGATGG - Intergenic
979348052 4:119612315-119612337 CTCACTCATCATGAAGGGGATGG - Intronic
979602107 4:122597246-122597268 CTCATTTATCACCAAGGGGATGG + Intergenic
979677957 4:123430229-123430251 CTCACTCATCACCAAGGGGATGG + Intergenic
979930796 4:126627853-126627875 CTCAGTCATCATGAAGGGGAGGG + Intergenic
980476855 4:133329283-133329305 CTCACTCATCACCAAGCAGACGG + Intergenic
980653758 4:135755809-135755831 CTCACACATCACCAAGGAGATGG + Intergenic
980775344 4:137429801-137429823 CTCACTTATCACCAAGGGTATGG - Intergenic
980811125 4:137881971-137881993 CTTACTTATCAACAAGGGGATGG + Intergenic
981294829 4:143119711-143119733 CTAACTCTTGAGAAAGGGGAGGG + Intergenic
981459012 4:144990652-144990674 CTCACTTATCACCAACGGGATGG + Intronic
981478664 4:145213387-145213409 CTCACTCATCACCAAGGAGATGG - Intergenic
982178063 4:152725282-152725304 CTCACTCATCACTAAGGGGATGG + Intronic
982417918 4:155158236-155158258 CTCACTCAACACCAAGGGGATGG - Intergenic
982777740 4:159459224-159459246 CTCACTCATCACCAAGGGGGTGG - Intergenic
982856688 4:160391768-160391790 CTCACTCATCACCAAGGAGATGG + Intergenic
982911235 4:161145024-161145046 GTCACTCATCATCAAGGGGATGG - Intergenic
982926176 4:161339550-161339572 CACCCTCATCACCAAGGGGATGG - Intergenic
983102184 4:163638350-163638372 CTCACTCATCACCAAGACGATGG - Intronic
983162749 4:164437410-164437432 CTCACTCATCACCGAGGGGATGG - Intergenic
983165190 4:164467556-164467578 CTCACTCATCACCAAGGGGATGG + Intergenic
983436355 4:167720572-167720594 CTCATTCATCATCAAGGGGATGG - Intergenic
983460195 4:168017353-168017375 CTCACTCATTACCATGGGGATGG + Intergenic
983540128 4:168900150-168900172 CTCACTTACCACCAAGGGGATGG + Intronic
983755231 4:171327060-171327082 CTCACTCATCAGTAAGGGGATGG + Intergenic
983876569 4:172883547-172883569 CTCACTCACCAGCAAGGGGATGG + Intronic
984574534 4:181432459-181432481 CACAATGCTCAGCAAGGAGAGGG - Intergenic
984809681 4:183783988-183784010 CTAGCTGCTTAGCAAGGGGAGGG - Intergenic
985347335 4:189019912-189019934 CCCACTCATCACCAAGGCGATGG - Intergenic
985583054 5:710051-710073 CTCACTCATCACCAAGGGGATGG - Intergenic
985596734 5:795302-795324 CTCACTCATCACCAAGGGGATGG - Intergenic
985713273 5:1442141-1442163 CTCTCTCCTGGGGAAGGGGAGGG + Intronic
985751513 5:1681327-1681349 CTCACTTATCACCAAGGAGATGG + Intergenic
985832663 5:2246010-2246032 CTCACTCCTCAGCTTGCAGATGG + Intergenic
986407064 5:7436917-7436939 CACACCACTCAGCATGGGGAAGG - Intronic
987450429 5:18077250-18077272 CTCACTTATCACCAAGGGGATGG - Intergenic
987552104 5:19396433-19396455 CTCACTTATCACCAAGGGGATGG - Intergenic
987689099 5:21244216-21244238 CTCACTTATCACCAAGGGGATGG - Intergenic
987870646 5:23613066-23613088 CTCACTTATCATCAAGGAGATGG - Intergenic
988146751 5:27319057-27319079 CTCAGTCATCACCAAGGGAATGG + Intergenic
988417115 5:30959412-30959434 CTCACTCATCACCAAGGGTATGG - Intergenic
988494929 5:31736811-31736833 CTCACTTATCACCAAGGAGATGG - Intronic
988635230 5:32976670-32976692 CTCACTTATCACCAAGGGGATGG - Intergenic
989108452 5:37885368-37885390 CTCACTTATCACCAAGGGGATGG - Intergenic
989150984 5:38299543-38299565 CTCACTCATCACCAAGGCAATGG - Intronic
989307968 5:39979622-39979644 CTCATTCATCACCAAAGGGATGG - Intergenic
989448063 5:41554284-41554306 CTCACTCATCACCAAGGGGATGG - Intergenic
989726352 5:44591086-44591108 CTCACTCATCACCCCGGGGATGG - Intergenic
989757920 5:44978564-44978586 CTCACTCATCACCAACGGGATGG + Intergenic
990131818 5:52595487-52595509 CTCACTTATCACCAAGGGGATGG - Intergenic
990402427 5:55452257-55452279 CTCACTCATCACCAAGGGGATGG - Intronic
990995717 5:61730448-61730470 CTCACTCATCACCAAGGGGATGG + Intronic
991024967 5:62019393-62019415 CTCACTCATCACCAAGAAGATGG - Intergenic
991042925 5:62194143-62194165 CTCACTTATTACCAAGGGGATGG - Intergenic
991057860 5:62339270-62339292 AGCACTCATCACCAAGGGGATGG + Intronic
991057865 5:62339293-62339315 TGCACTCATCACCAAGGGGATGG + Intronic
991136468 5:63187445-63187467 CTCACTGATCACCAAGGGGATGG + Intergenic
991249217 5:64541279-64541301 CTCACTCATTACCAAGGGGATGG + Intronic
991259490 5:64651313-64651335 CTCACTCATTATCAAGGGGATGG - Intergenic
991259718 5:64653597-64653619 CTCATTCATCACCAAGGGGATGG - Intergenic
991404743 5:66290814-66290836 CTCACTCATCACCAGGGGGATGG + Intergenic
991460679 5:66855186-66855208 CTCACTCATCACCAAGGGGATGG - Intronic
991770796 5:70039191-70039213 CCCATCCCTCAGCAAGAGGAGGG + Intronic
991850090 5:70914608-70914630 CCCATCCCTCAGCAAGAGGAGGG + Intronic
992114216 5:73523822-73523844 CTCACTCATCACCAAGGGGATGG + Intergenic
992264426 5:75004392-75004414 CTCACTCATCACCAAAGGGATGG + Intergenic
992353220 5:75952556-75952578 CCCACTCATCACCAAGGGGATGG - Intergenic
992409991 5:76495822-76495844 CTCACTTATCACCAAGGGGATGG + Intronic
992531984 5:77660722-77660744 CTCACTCATCACCAAGGAGATGG - Intergenic
993446615 5:88020492-88020514 CTCACTCATCACCATGGGAAGGG + Intergenic
993539792 5:89134810-89134832 CTCACTTATCACCAAGGGGATGG + Intergenic
993781016 5:92065409-92065431 CTCATTCATCACCAAGGGGATGG - Intergenic
993956077 5:94234727-94234749 CTCACTTATCACCAATGGGATGG + Intronic
994312991 5:98298280-98298302 CTCACTTATCACTAAGGGGATGG - Intergenic
994400510 5:99274077-99274099 CTCACTTATCACCAAGGGAATGG - Intergenic
994766155 5:103920822-103920844 CTCATTTATCACCAAGGGGATGG - Intergenic
994871817 5:105361605-105361627 CTCATTTATCACCAAGGGGATGG - Intergenic
994926368 5:106121737-106121759 CTCACTCATCACCAAGGGTATGG + Intergenic
995250317 5:109985602-109985624 CTCACTTATCACCAAGGTGATGG + Intergenic
995561661 5:113388499-113388521 CTCACTCATCACCAAGGGGATGG - Intronic
995595816 5:113746630-113746652 CTCACTTATCACCAAGGGGATGG + Intergenic
995641610 5:114263707-114263729 ATCACTCTTCAGAAAAGGGAAGG - Intergenic
996045628 5:118869923-118869945 ATCACACATCATCAAGGGGATGG - Intronic
996090289 5:119344345-119344367 CTCACTCGTTACCATGGGGAGGG + Intronic
996416013 5:123211160-123211182 TTCAATCCTCAGGAAGGGGTAGG - Intergenic
996701202 5:126451830-126451852 TTCACTTATCACCAAGGGGATGG - Intronic
996722280 5:126641567-126641589 CTCACATATCACCAAGGGGATGG - Intergenic
996761403 5:126989612-126989634 CTCACTCCCCAGCTGAGGGAAGG - Intronic
996823703 5:127657752-127657774 ATCCCTCCTAAGCAAGGGCATGG - Exonic
997111162 5:131076145-131076167 CTCACTCATTACCATGGGGAGGG + Intergenic
997124259 5:131209963-131209985 CACACTCATCACCAAGGTGATGG - Intergenic
997620276 5:135284710-135284732 CTCACTCATCACCAAGGGGATGG - Intronic
997768602 5:136530658-136530680 CTCACTCATTACCATGGGGAGGG + Intergenic
997841061 5:137240460-137240482 CTCACTTATCATCAAGGGGATGG + Intronic
997850875 5:137331711-137331733 CTCACTCATCACCGAGGGGATGG + Intronic
998042833 5:138963921-138963943 CTGACTCCTCAGCTAGGCGCGGG + Intronic
998447580 5:142210709-142210731 CTAACTTCTGAGAAAGGGGAAGG - Intergenic
998609295 5:143670674-143670696 CTCACTCATCGCCAAGGGGATGG + Intergenic
998673578 5:144381660-144381682 CTCACTTATCACCAATGGGATGG + Intronic
998781179 5:145658514-145658536 CTCACTCATCACCAAGGGGATGG - Intronic
998875415 5:146594067-146594089 CTTTCTCCTGAGCAAGTGGAAGG + Intronic
998984318 5:147739072-147739094 CTTAAGCCTCACCAAGGGGAAGG + Intronic
999709105 5:154300713-154300735 CCCACTCTTCTGCAAGGGGTGGG + Intronic
999841463 5:155432266-155432288 CTCACTTATCACCAAAGGGATGG - Intergenic
1000016493 5:157282360-157282382 CTCACTCATCACCAAGGGGATGG + Intronic
1000106709 5:158066820-158066842 CTCGCCCATCACCAAGGGGATGG + Intergenic
1000229658 5:159303606-159303628 CTCACTCATCACCAAGAGGATGG + Intergenic
1000361216 5:160449290-160449312 CTCATTCATCACCAAGGTGATGG - Intergenic
1000668859 5:164034687-164034709 CTTACCCATCACCAAGGGGAAGG + Intergenic
1000830425 5:166094906-166094928 CTCACTTATCACCAAGGGGATGG + Intergenic
1001927475 5:175649083-175649105 CTCACTCATCACCAAAAGGATGG + Intergenic
1001999134 5:176187412-176187434 CTGAATCCACAGCAAGGGGTTGG + Intergenic
1002394680 5:178943399-178943421 TTCACTCATCACCAAGAGGATGG + Intronic
1002723272 5:181278769-181278791 CTCGCTCATCGCCAAGGGGATGG - Intergenic
1003082794 6:3035502-3035524 CTCACTCATCACCAAGGGAACGG - Intergenic
1003440467 6:6136689-6136711 CACAGCCCTCAGGAAGGGGAAGG - Intergenic
1003513056 6:6797429-6797451 CTCACTCATCACCAAGGGGATGG - Intergenic
1004236040 6:13875167-13875189 CTCATTGATCACCAAGGGGATGG + Intergenic
1004315948 6:14587843-14587865 CTCACTCATCACCAAGGGGATGG + Intergenic
1004695190 6:18026740-18026762 GTCACTCATCACCAAGGGGATGG + Intergenic
1004777455 6:18863747-18863769 CTCACTTATCACCAAGGGGATGG - Intergenic
1005121367 6:22392873-22392895 CTCACTCATCGCCAAGGGGATGG + Intergenic
1005345413 6:24884585-24884607 CTCACTCCTCAGCAAGGGGATGG + Intronic
1006031705 6:31180890-31180912 GTCTCTCCTCAGCAGTGGGAGGG + Intergenic
1006314377 6:33281364-33281386 CACACAGCCCAGCAAGGGGAAGG + Intronic
1006845167 6:37056585-37056607 CTCAGTCCTCAGGAATGGGTGGG + Intergenic
1007148906 6:39667938-39667960 CTCACTCATCATCAAGGGGATGG - Intronic
1007219570 6:40267893-40267915 CTCACTTATCACCAAAGGGATGG - Intergenic
1007761299 6:44135146-44135168 CACACTCCTCAGGAATAGGAAGG + Intronic
1007961924 6:45967859-45967881 CTCACTCATTACCATGGGGAGGG + Intronic
1008562280 6:52734928-52734950 CTCACTTATCACCAGGGGGATGG + Intergenic
1009038267 6:58144739-58144761 CTCACTTATCACCAAGAGGATGG - Intergenic
1009214058 6:60898369-60898391 CTCACTTATCACCAAGAGGATGG - Intergenic
1009696373 6:67109253-67109275 CTCACTTATCACCAAGGGGATGG - Intergenic
1010046449 6:71449525-71449547 CTCAGTTATCACCAAGGGGATGG + Intergenic
1010222969 6:73463509-73463531 CTCGCTCCTAAGCAAAAGGAAGG - Intronic
1010449286 6:75984767-75984789 CTCAATCCTAGCCAAGGGGATGG - Intronic
1010498805 6:76568595-76568617 CTCACTCATAATAAAGGGGATGG + Intergenic
1010553516 6:77251965-77251987 CTCACGCCTCAGCAATGGCAGGG - Intergenic
1010785514 6:79995029-79995051 CTCACTCATCACCAAGGATACGG - Intergenic
1010990744 6:82477456-82477478 CTCACTCATCACCAAGGGGATGG + Intergenic
1011448668 6:87470559-87470581 CTCACTTATCACCAAGGCGATGG + Intronic
1011459026 6:87584085-87584107 CTCACTCCAGAGCAAAGGGCAGG + Intronic
1011749019 6:90436641-90436663 CTCAGTCATCACCAAAGGGATGG - Intergenic
1011851915 6:91639526-91639548 CTCACTTATCACCAAGGGGATGG - Intergenic
1012252482 6:96994016-96994038 CTCCCTCCAGAGCAAGGGGTAGG - Intronic
1012499156 6:99869531-99869553 CTCACTTATCACCAAGGGGATGG - Intergenic
1012677581 6:102136933-102136955 CTCACTTGTCACCAAGGAGATGG + Intergenic
1012918169 6:105193295-105193317 CTTGCTCATCACCAAGGGGAGGG - Intergenic
1013126388 6:107188688-107188710 CTCACTCGTCACCAAGGGCATGG - Intronic
1013432149 6:110064692-110064714 CTGGCTCCTCAGCACTGGGAGGG - Intergenic
1013486738 6:110603981-110604003 CTCACTTATCACCATGGGGATGG - Intergenic
1013549956 6:111197845-111197867 CTCACTTATCACCAAGGGAATGG + Intronic
1013658132 6:112266532-112266554 CTGGCTCCTCCGCCAGGGGAAGG + Intergenic
1013710197 6:112888080-112888102 CTCACTTATCACCAAGGGGATGG + Intergenic
1013904622 6:115200196-115200218 CTCACTCATCACCAAGAGGAGGG + Intergenic
1013927443 6:115490134-115490156 CTCACCAATCAGCAAGGAGATGG - Intergenic
1014099027 6:117489301-117489323 CTCACTTATCACCAAGGGGATGG + Intronic
1014509761 6:122306804-122306826 CTCACTCATCACCAAGAAGATGG - Intergenic
1014510004 6:122308797-122308819 CTCACTCATCACCAAGGGAATGG - Intergenic
1014524870 6:122490520-122490542 CTCACTCATCACCGAGAGGATGG - Intronic
1014740873 6:125146588-125146610 CTCACTTATCAGAAAGGGGATGG - Intronic
1015059729 6:128948697-128948719 CTCACTTATCACCAAGGGGATGG - Intronic
1015336175 6:132041452-132041474 CTCTCTTATCACCAAGGGGATGG - Intergenic
1015983468 6:138862433-138862455 CTCACTCATCACTAAGGGGATGG + Intronic
1016700362 6:147047629-147047651 CTCACTCATCACCAAGGGGATGG - Intergenic
1017047116 6:150357038-150357060 CTCACTCATCACCAAGGTGATGG - Intergenic
1017339544 6:153305068-153305090 CTCACTCATCACCAAGGGGATGG - Intergenic
1017521894 6:155209785-155209807 CTCACTTCTAAGATAGGGGAAGG - Intronic
1017629741 6:156384775-156384797 CTCACTTGTCATCAAGGGGAGGG - Intergenic
1018014059 6:159696261-159696283 CTCCCTTCTAGGCAAGGGGAAGG + Intronic
1018028926 6:159826813-159826835 CTCACTCATCACCCAAGGGATGG + Intergenic
1020279014 7:6640782-6640804 CTCCCTTATCACCAAGGGGACGG - Intronic
1020346700 7:7173172-7173194 CTCACTTATTACCAAGGGGATGG - Intronic
1020556624 7:9678563-9678585 CTCACTTATCACCAAGGGGATGG - Intergenic
1020917424 7:14213524-14213546 CTCCCTCTGGAGCAAGGGGAAGG + Intronic
1020943031 7:14564129-14564151 CTCTGTGCTGAGCAAGGGGAAGG + Intronic
1020969663 7:14919773-14919795 CTCACTCATCATGAAGGGGATGG - Intronic
1020973351 7:14975934-14975956 CTCCCTTATCACCAAGGGGATGG + Intergenic
1021779149 7:24084868-24084890 CTCACTTATCACCAAGAGGATGG + Intergenic
1021817300 7:24460181-24460203 CTTACTTATCACCAAGGGGATGG + Intergenic
1021894624 7:25222267-25222289 CTCAGGCCTCAGCATGGGAAGGG + Intergenic
1022513682 7:30961709-30961731 CTCACTCATTACCATGGGGAGGG - Intronic
1022670252 7:32448896-32448918 CTCACTCATTACCATGGGGATGG - Intergenic
1022717897 7:32915259-32915281 CTGACTCATCACCAAGGGGATGG + Intergenic
1022724317 7:32966862-32966884 CTCATTCATCACCGAGGGGATGG + Intronic
1022981854 7:35611609-35611631 CTCACTCAGCACCAAGGGGATGG - Intergenic
1023209181 7:37784709-37784731 CTCACTCCTCCCCCAGAGGAAGG - Intronic
1023239950 7:38133516-38133538 CTCATTCATCACCAAGGGGAAGG + Intergenic
1023244333 7:38184570-38184592 CTCACTCATCACCAAGGGGATGG + Intronic
1023300571 7:38766495-38766517 CTCCCTCCTGAGGAAAGGGAAGG + Intronic
1023515208 7:40994777-40994799 CTCACTTGTCACCAAAGGGATGG - Intergenic
1023543021 7:41287168-41287190 CTCACTTATCATCAAGGCGATGG - Intergenic
1023543304 7:41289397-41289419 CTCACTTGTCACCAAGGGGATGG - Intergenic
1023854395 7:44173271-44173293 CTCACTGCTCAGCAATGGCAAGG + Intronic
1023854684 7:44175533-44175555 CTCACTCATCACCAAGGGGATGG + Intronic
1023857599 7:44194190-44194212 CTGACTCATCACCAAGGGGATGG - Intronic
1023930039 7:44699940-44699962 CTCACTCATCACCAAGGGGATGG + Intronic
1024035006 7:45500531-45500553 CTCACTCGTCATCAAGGGGAGGG + Intergenic
1024326801 7:48115184-48115206 CTCACTCATCACCAAGGGGAGGG + Intergenic
1024618093 7:51132885-51132907 CTCACTCATCCCCATGGGGATGG + Intronic
1024860677 7:53836090-53836112 CTCATTCATCACCAAGGGGATGG - Intergenic
1025049291 7:55720971-55720993 CTCATTCATCACCGAGGGGATGG - Intergenic
1025790005 7:64680366-64680388 CTCACTCCTGAAGAATGGGAGGG + Intronic
1026200934 7:68214035-68214057 CTCTCTCATCACCATGGGGAGGG + Intergenic
1026279984 7:68913691-68913713 CTCACTCATTAGCATGGGGAGGG - Intergenic
1026451255 7:70531648-70531670 CTGACTCATCACCAAGAGGATGG + Intronic
1026500366 7:70938439-70938461 CTCACTTATCACCAAGGGGATGG - Intergenic
1026548123 7:71342344-71342366 CTCACTCATCATCCAGAGGATGG + Intronic
1026587023 7:71664122-71664144 CTCATCCCTCTGCATGGGGATGG - Intronic
1026591872 7:71703456-71703478 CTCATTTATCACCAAGGGGATGG + Intronic
1026619073 7:71934606-71934628 CTCACTCATTACCATGGGGAGGG + Intronic
1027195495 7:76027278-76027300 TCCACTCCTCAGGATGGGGAAGG + Intronic
1027221499 7:76217041-76217063 CACCCTCCTCAGCAGGTGGAAGG + Intronic
1027526682 7:79278127-79278149 CTCACTCATCACCAAGGAGATGG - Intronic
1027586550 7:80065752-80065774 CTCACTTTTCATCAAGGGGATGG + Intergenic
1028014148 7:85685994-85686016 CTCACTCATCACCAAGGGGATGG - Intergenic
1028373279 7:90118939-90118961 CTCAGTCGTCAGCAAGGTTATGG + Intergenic
1028870648 7:95768077-95768099 CTCACTCATTACCATGGGGAGGG - Intergenic
1029065451 7:97843682-97843704 CTCACTCATCAACAAGGGGATGG + Intergenic
1029509915 7:100987622-100987644 CTCACTCATCACCAAGGGGATGG - Intronic
1029582429 7:101446137-101446159 CCCACTTATCACCAAGGGGATGG + Intronic
1029615927 7:101657150-101657172 CTGAGCCATCAGCAAGGGGAGGG + Intergenic
1029682988 7:102125186-102125208 CCCACTCATCATCATGGGGAAGG - Intronic
1029938445 7:104453734-104453756 CTTACTTATCACCAAGGGGATGG - Intronic
1030086587 7:105820796-105820818 CTCACTTATCACCAAGGCGATGG - Intronic
1031056474 7:116997994-116998016 CTCGCTCCTCAGCACTTGGACGG + Intronic
1031284338 7:119844799-119844821 CTCACTTATCACCAAGGGGATGG + Intergenic
1031330074 7:120453265-120453287 CTCACACATCAGCTGGGGGAGGG - Intronic
1031362758 7:120866823-120866845 CTCCCTTATCACCAAGGGGATGG - Intergenic
1031443408 7:121821512-121821534 CTCACTCATCACCAAAGGGATGG - Intergenic
1031627705 7:124009425-124009447 CTCACTTATCACCAAGGAGATGG - Intergenic
1031905787 7:127458436-127458458 CTCACTTACCACCAAGGGGATGG - Intergenic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1032274504 7:130442262-130442284 CTCACTCCTCTGCTAAGGAAGGG + Intronic
1032573751 7:133029768-133029790 CTCACCCCACAGCAAGTGGCAGG - Intronic
1032810272 7:135407037-135407059 CTTACTCATCACCAAGGGGATGG - Intronic
1033027743 7:137792701-137792723 GTAACTCATCACCAAGGGGATGG - Intronic
1033053611 7:138029463-138029485 CTCACTTATCACCAAGGGAATGG + Intronic
1033256627 7:139807024-139807046 ATGACTCCCCAGCAAGTGGAAGG - Intronic
1033569612 7:142615012-142615034 CCCACACCTCAGCTAAGGGATGG - Intergenic
1033588259 7:142790165-142790187 CTTCCTCCCCAGCATGGGGAAGG - Intergenic
1033828310 7:145219627-145219649 CTCACTCATCACCAAAGGGATGG - Intergenic
1034080605 7:148274511-148274533 CTCACTTATCACCAAGGAGATGG - Intronic
1034353056 7:150429677-150429699 CTCACTCATCACCAGGAGGATGG - Intergenic
1034973393 7:155433412-155433434 CTCACTTAACACCAAGGGGATGG - Intergenic
1035050551 7:155996391-155996413 CTCACTCATCACCAAGGAGATGG - Intergenic
1035149011 7:156850916-156850938 CTTACTCATCACCAAGGGGAGGG - Intronic
1035409359 7:158626644-158626666 GTCACTCTTCAGCCAGGAGAGGG - Intergenic
1035433017 7:158836532-158836554 CTCACTCATCACCGAGGGGATGG - Intergenic
1035942143 8:3913305-3913327 CTCACTCCTGAGCAGGTCGATGG - Intronic
1035977546 8:4329765-4329787 CTCACTCATCACCAAGGGGATGG - Intronic
1036141962 8:6216971-6216993 CTCACTCATCACCAAGGGGATGG - Intergenic
1036497909 8:9286178-9286200 CACCCTCCCCAGGAAGGGGAGGG + Intergenic
1036510088 8:9392092-9392114 CTCACTCATTACCAAGGGGAGGG - Intergenic
1036617424 8:10399419-10399441 CTCACTCATCACCAAGGAGATGG - Intronic
1036640510 8:10580538-10580560 CTGACTTATCACCAAGGGGATGG - Intergenic
1036717783 8:11142526-11142548 CTCACTCATCACCAAGGAGATGG - Intronic
1036794616 8:11746562-11746584 CCCACTCCACAGCAAGAGGCGGG - Intronic
1037251919 8:16905485-16905507 CTGACTCCAGAGCAAGGGGCTGG + Intergenic
1037339778 8:17832097-17832119 CTCATTCATCACCAAGGAGATGG + Intergenic
1037386111 8:18343890-18343912 CTCGCTCATCACCGAGGGGATGG - Intergenic
1037603816 8:20421028-20421050 CACACTCCACAGCAAGGTTATGG + Intergenic
1037647656 8:20808058-20808080 CTCACTTATCACCAAGGGCATGG - Intergenic
1037746479 8:21649559-21649581 CTCACTTATCACTAAGGGGATGG + Intergenic
1038509123 8:28114563-28114585 CTCACTTATCACCAAGGAGATGG + Intronic
1038605927 8:29004411-29004433 TTCACTCCTCAGGAAGTGGAAGG + Intronic
1038891632 8:31732147-31732169 CTCACTCCTCTTCAGGGTGAAGG + Intronic
1039000279 8:32972467-32972489 CTCACTCATCACCAAAGGGATGG - Intergenic
1039081728 8:33740233-33740255 ATCACTCATCACCAAGGAGATGG + Intergenic
1039313976 8:36351663-36351685 CTCACTTACCACCAAGGGGATGG + Intergenic
1039729749 8:40261703-40261725 CTCATTTCTCAGCAAGGACAAGG - Intergenic
1039948384 8:42149431-42149453 CTCACTCATTACCATGGGGAGGG - Intergenic
1039976714 8:42372680-42372702 CTCACTCATCACCAAGGGGATGG + Intergenic
1040480624 8:47823061-47823083 ATCACTCATCACCAAGGGAATGG - Intronic
1041203219 8:55471732-55471754 CTTACTCATCACCAAGGGGATGG - Intronic
1041253954 8:55962984-55963006 CTCACTCTTTACCACGGGGATGG + Intronic
1041308471 8:56489041-56489063 CTCACTCATCACCAAGGGCATGG - Intergenic
1041510176 8:58647567-58647589 CTCATTTATCACCAAGGGGATGG - Intronic
1041510468 8:58649624-58649646 CTCACTTATTACCAAGGGGATGG - Intronic
1041919241 8:63164462-63164484 CTCAATCATCACCAAGGGGATGG - Intergenic
1042030592 8:64471712-64471734 CTCACTCATCACCATGAGGATGG + Intergenic
1042033689 8:64506780-64506802 CTCATTTATCATCAAGGGGATGG - Intergenic
1042129584 8:65574238-65574260 CTCACTCATCACCAAGGGGATGG - Intergenic
1042152456 8:65802875-65802897 CTCACTTATCAACAAGGGGATGG - Intronic
1042170173 8:65983656-65983678 CTCACTCGTCACCATGGGGATGG + Intergenic
1042313407 8:67400584-67400606 CTCACTTATCATTAAGGGGATGG - Intergenic
1042654624 8:71082582-71082604 CTCACTTATCACCAAGGAGATGG + Intergenic
1042721957 8:71835455-71835477 CTCACTCGTTACCAAGGAGATGG + Intronic
1043101871 8:76057812-76057834 CTCACTTTTCACCAAGGGGACGG - Intergenic
1043159326 8:76826240-76826262 CTCACTTGTCACCAAGGGAATGG + Intronic
1044109561 8:88255170-88255192 CTCACTCATTACCATGGGGAGGG - Intronic
1044529541 8:93291635-93291657 CTCACTCATCACCAAGGGGAGGG + Intergenic
1044555706 8:93559624-93559646 CTCACTTATCATCAAGGGGATGG - Intergenic
1044673805 8:94709934-94709956 CTCACTTATCACCAAGGGGATGG + Intergenic
1044700919 8:94964694-94964716 CTCACTCATCACCAAGGGGATGG + Intronic
1044708388 8:95031000-95031022 CTCACTTATCCCCAAGGGGATGG + Intronic
1044941379 8:97347639-97347661 CTCACTCATCACCAAGGGAATGG + Intergenic
1045419010 8:101995614-101995636 CTCACTCATCACCAAGAGGATGG + Intronic
1045504396 8:102768397-102768419 GCCACTGCTCAGCATGGGGAGGG - Intergenic
1045554031 8:103197802-103197824 CTCATTCATCATCAAAGGGATGG + Intronic
1045648233 8:104319964-104319986 CTCACTCATCACCAAGGGGATGG + Intergenic
1045726752 8:105182885-105182907 CTCACTTTTCACCAAGGGGATGG - Intronic
1045803378 8:106127775-106127797 CTCACTCTTCACCAGTGGGACGG - Intergenic
1045878539 8:107011261-107011283 CTCACTCATTACCATGGGGAGGG - Intergenic
1045996895 8:108373549-108373571 CTCACTCATCACCCATGGGATGG - Intronic
1046068916 8:109226853-109226875 CTCACTCATTATCACGGGGATGG - Intergenic
1046671581 8:117062492-117062514 CTCACTCATCACCAAGGCAAGGG + Intronic
1046829699 8:118730831-118730853 CTCACTCATTACCATGGGGATGG - Intergenic
1046876356 8:119259092-119259114 CTCACTCACCACCGAGGGGATGG + Intergenic
1047013627 8:120699382-120699404 CTCACTCATTACCAAGGGGATGG - Intronic
1047041283 8:120998970-120998992 GTCACTCATCACCAAGGGGATGG - Intergenic
1047077028 8:121415716-121415738 CTCACTTATCACCAAGGGGATGG + Intergenic
1047087912 8:121539721-121539743 CTCACTCATCACCAAGGGAATGG + Intergenic
1047610316 8:126514678-126514700 TTCACTCTTCACCAAGGGGATGG + Intergenic
1047796196 8:128258112-128258134 CTCACTCTTCATTTAGGGGAAGG - Intergenic
1047851848 8:128865618-128865640 CTCACTTATCACCAAGGGGATGG - Intergenic
1047885833 8:129249138-129249160 CTCACTCATCATGAAGGAGATGG - Intergenic
1047938946 8:129808661-129808683 CTCACTCATCACCAAGGGGATGG - Intergenic
1048029101 8:130614109-130614131 CTCACTCATTACCATGGGGATGG + Intergenic
1048235906 8:132690438-132690460 CTCACTGTTCGGCAAGGGTAGGG - Intronic
1048355936 8:133654102-133654124 CTCACTTATCACCAAAGGGATGG - Intergenic
1049050547 8:140191466-140191488 CTCACTTGTCACCAAAGGGATGG - Intronic
1049124828 8:140777414-140777436 CTCACTCATCACCAAAGGAACGG + Intronic
1049431731 8:142568491-142568513 CTCCCAGCTCAGCAAGGGGCAGG - Intergenic
1049552239 8:143265796-143265818 CTCACTCATCACCAAGGAGAGGG + Intronic
1049554022 8:143273440-143273462 CTCACTCCTCAGCCTGGGTTCGG + Intronic
1049678264 8:143903141-143903163 CCCACTCCTGAGCAGGGGGAGGG + Intergenic
1049820638 8:144631138-144631160 CTCACTCATCGCCAAGGGGGTGG + Intergenic
1050128024 9:2379754-2379776 TTCACTCATCACCAAGGGGATGG - Intergenic
1050672809 9:8016861-8016883 CTCACTCATCACCAAGAGGATGG + Intergenic
1050678086 9:8079113-8079135 CTCACTTACCACCAAGGGGATGG + Intergenic
1050907672 9:11026509-11026531 CTCACTTATCACCAAGGTGATGG + Intergenic
1051784211 9:20724045-20724067 CTCACTTGTCACCAAGGGGATGG + Intronic
1052161916 9:25272919-25272941 CTCACTTATCACCAAGGGCATGG - Intergenic
1052311942 9:27076901-27076923 CTCACTTATCACCAAGGGGATGG - Intergenic
1052392128 9:27892657-27892679 ATGACCCCTCAGCAAGGGCATGG - Intergenic
1052501436 9:29296276-29296298 CTCACCTATCACCAAGGGGATGG - Intergenic
1052530991 9:29683565-29683587 CTCACTTATCACCAAGGGGATGG - Intergenic
1053177283 9:35936911-35936933 CTCACTCATTACCATGGGGATGG - Intergenic
1053231335 9:36412577-36412599 CTCGCTCTTCACCAAGTGGATGG - Intronic
1053553436 9:39108273-39108295 CTCACTCCCCAGAGAGGGGGGGG - Intronic
1054885006 9:70186903-70186925 CTCACTAATCATGAAGGGGATGG + Intronic
1055320680 9:75080737-75080759 CTCACTCATTACCATGGGGATGG - Intronic
1055800869 9:80034068-80034090 CTCACTTATTACCAAGGGGATGG + Intergenic
1055856725 9:80697162-80697184 CTCACTCATCACCAAGGAGATGG + Intergenic
1056733048 9:89182161-89182183 CTCACTTATCACCAAGGGAATGG - Intergenic
1056978101 9:91279641-91279663 CTCGCTCATCACCAAGGGGACGG + Intronic
1057300178 9:93873724-93873746 CTCACTTATCACCAAGGGGATGG - Intergenic
1057319333 9:93997860-93997882 CTCACTTATCACCAAGGGAATGG + Intergenic
1057345908 9:94250539-94250561 CTCACTTATCACCAAGGGGATGG + Intergenic
1057637966 9:96788338-96788360 CTCACTTATCACCAAGGGGAGGG - Intergenic
1057638585 9:96795557-96795579 CTCACTTATCACCAAGGGGATGG + Intergenic
1058104144 9:100950790-100950812 CACACTCTTGGGCAAGGGGAGGG + Intergenic
1058108521 9:101003501-101003523 CTCACTTATCATCAAAGGGATGG + Intergenic
1058321778 9:103641082-103641104 CTCACTCAACCCCAAGGGGACGG + Intergenic
1058344664 9:103946855-103946877 CTCACTTTTCACTAAGGGGATGG + Intergenic
1058531236 9:105906771-105906793 CTCACTTGTCACCAAGGGGAAGG + Intergenic
1058923061 9:109636307-109636329 CTCACTCATCACCAAGGAAATGG - Intergenic
1059160035 9:112025307-112025329 CTCACTTATCACCAAGGGGATGG - Intergenic
1059261008 9:112976582-112976604 CTCACTTCTCACCAAGGGGATGG - Intergenic
1059475227 9:114541134-114541156 CTCACTTATCACTAAGGGGACGG - Intergenic
1059600314 9:115770066-115770088 CTCACTCCTCCTCTATGGGAAGG + Intergenic
1059698337 9:116749757-116749779 CTCACTTGTCACCAACGGGATGG - Intronic
1059789069 9:117620151-117620173 CTCACTCATCACCAACAGGATGG + Intergenic
1059917425 9:119118790-119118812 CTCACTTATCACCAAGAGGATGG - Intergenic
1059950180 9:119454199-119454221 CTCACTCATCACCAAGGGGATGG + Intergenic
1060785436 9:126448751-126448773 CTCACTTATTACCAAGGGGATGG + Intronic
1060813145 9:126621214-126621236 GTCAAGCCTCAGCCAGGGGAGGG + Intronic
1060890163 9:127183101-127183123 CTCACTCATCACCAGGGGGATGG + Intronic
1061089538 9:128419307-128419329 CTATCTCCACTGCAAGGGGAGGG - Intronic
1062018934 9:134307154-134307176 CTGACTTCTCAGCATGGGGGAGG + Intergenic
1062267074 9:135691931-135691953 CTCACTCATCACCAAGGGGCTGG - Intergenic
1062299465 9:135856953-135856975 CACACTCCCCAGCACTGGGAAGG + Intronic
1062680817 9:137778992-137779014 CTCACTCATCACCAGGGGGAGGG + Intronic
1186186950 X:7030024-7030046 CAGCCTCCTCAGCATGGGGATGG - Intergenic
1186491921 X:9980421-9980443 CTCACTCATCACCAAGGGGACGG + Intergenic
1186527997 X:10267576-10267598 CTCACTCATAACCAAGGGGATGG + Intergenic
1186688001 X:11945740-11945762 CTCACTCATTACCAAGAGGATGG + Intergenic
1186847606 X:13545965-13545987 CTCAGTCATCAGCAAGGGCAAGG - Intergenic
1187082633 X:16007227-16007249 CTCACTCATCACCAAGAGGATGG + Intergenic
1187114422 X:16334540-16334562 CTCACTTATCACCAAGGGGATGG + Intergenic
1187395620 X:18916579-18916601 CTCACTTATCACCAAGGGGATGG - Intronic
1187413633 X:19073071-19073093 CTCACTTATCACCAAGGGGATGG - Intronic
1187836367 X:23435968-23435990 CTCACTTATCACCAAGGAGATGG - Intergenic
1188009454 X:25041002-25041024 CTCACTCATCACCAAGGGGATGG + Intergenic
1188016239 X:25111209-25111231 CTCATTCATCACCAAGGGGATGG + Intergenic
1188090929 X:25964506-25964528 CTCACTCATCACCAAGGGGATGG - Intergenic
1188185405 X:27108411-27108433 CTCACTTATCCCCAAGGGGATGG - Intergenic
1188238125 X:27753764-27753786 CTCACTCATCACCAAGGGGATGG + Intergenic
1188263226 X:28041406-28041428 CTCACTTAACATCAAGGGGATGG + Intergenic
1188618736 X:32193021-32193043 CTCACTCATCATCATGAGGATGG - Intronic
1188857810 X:35219111-35219133 CTCCCTCATCACCAAGGAGATGG - Intergenic
1189748971 X:44199163-44199185 CTCACTCATCACTGAGGGGATGG - Intronic
1189871862 X:45392982-45393004 CTCACTTATCATCAAGGGGATGG + Intergenic
1190225464 X:48541273-48541295 CTCACTCTTCAGCATGGTGATGG + Intronic
1190512748 X:51191207-51191229 CTCACTCATCACCAAGGGGATGG + Intergenic
1190958982 X:55226964-55226986 CTCACTTATCACCAAGGGGATGG - Intronic
1190989276 X:55528622-55528644 CTCAGTCCTCTGGAGGGGGAAGG - Intergenic
1191600741 X:63002449-63002471 CTCACTTTTCACCAAGGGGATGG - Intergenic
1192397091 X:70793451-70793473 TTCACTCATCACCAAGGGGATGG - Intronic
1192960124 X:76121234-76121256 CTCACTCCTTACCAAGGAGATGG - Intergenic
1193125610 X:77867217-77867239 CTCCCTCCACAGCAAAGGGGAGG + Intronic
1193449945 X:81653389-81653411 ATCACTCATTAGCAAGGGGATGG - Intergenic
1193626867 X:83833091-83833113 CTCACTTATCACCAAGGAGAAGG - Intergenic
1193638329 X:83980686-83980708 CTCACTTATCACCAAGGGGATGG - Intergenic
1193806446 X:86001650-86001672 CTAACTTATCATCAAGGGGATGG + Intronic
1193865956 X:86729694-86729716 CTCACTTATCACCAAGGGGATGG - Intronic
1193911626 X:87313686-87313708 CTCACTTGTCACCAAGGGGATGG + Intergenic
1194025050 X:88740741-88740763 CTCACTCATTACCAAGGGGTTGG + Intergenic
1194069298 X:89300120-89300142 CCCACTCATCACTAAGGGGATGG + Intergenic
1194093097 X:89602291-89602313 CTCATTCATCACCAAGGGGATGG - Intergenic
1194572657 X:95572906-95572928 CTCATTCATCACCAAGGGGATGG - Intergenic
1194846562 X:98816553-98816575 CTCACTCATTACCATGGGGAGGG + Intergenic
1194856108 X:98931667-98931689 CTCACTTATCATCAAGGGGATGG - Intergenic
1194856367 X:98933724-98933746 CTCACTTATCACCAAGGGGGTGG - Intergenic
1194919604 X:99749241-99749263 CTCACTTATCATCAAGAGGATGG - Intergenic
1195115957 X:101697855-101697877 CTCACTTATCACCAAGGGGATGG - Intergenic
1196023069 X:111010548-111010570 CTCACTCATCACCAAGGGGATGG - Intronic
1196066524 X:111470617-111470639 CTCACTCATCATCAAGGGGATGG + Intergenic
1196066801 X:111472658-111472680 ATCACTCATCAACAAGGGGATGG + Intergenic
1196315213 X:114214046-114214068 CTCACTTATCACCAAAGGGAGGG + Intergenic
1196948537 X:120852439-120852461 CTCACTCATCACCAAGAAGATGG + Intergenic
1196978341 X:121184691-121184713 CTCACTTATCACCAAGGGGATGG + Intergenic
1197006313 X:121504366-121504388 CTCACTTATCACCAAGGTGATGG + Intergenic
1197350916 X:125382269-125382291 CTCACTCATCACAAAAGGGATGG + Intergenic
1197460719 X:126737210-126737232 CTCACTTATCACCAAAGGGATGG + Intergenic
1197609004 X:128617377-128617399 CTCACTTATCATCAAGGGAATGG + Intergenic
1197674401 X:129314045-129314067 CTCACTTATCACCAAGTGGATGG + Intergenic
1197990100 X:132308602-132308624 CTCACTTATCACCAAGGAGAAGG - Intergenic
1198053970 X:132975726-132975748 TTCACTCATCACCAACGGGATGG - Intergenic
1198082908 X:133255751-133255773 CTCACTTATCACCAAGGGGATGG - Intergenic
1198111377 X:133505412-133505434 CTCACTTGTCACCAAGTGGATGG + Intergenic
1198276982 X:135104193-135104215 CTCACTCATCACCAAGAGGATGG - Intergenic
1198568677 X:137932684-137932706 TTCACTCATCACCAAGTGGATGG - Intergenic
1198681140 X:139183487-139183509 CTCACTCATTACCATGGGGATGG - Intronic
1198979102 X:142374509-142374531 CTCACTCATCACCAAGGAGATGG - Intergenic
1199084327 X:143611219-143611241 CTTGCTCCTCAGCTAGCGGACGG + Intergenic
1199257464 X:145733031-145733053 CTCACACATCACCCAGGGGAAGG - Intergenic
1199320934 X:146438230-146438252 CTCACTCATTACCACGGGGAGGG + Intergenic
1199720553 X:150540220-150540242 CTCATTCATCACCAAGGGGATGG - Intergenic
1199987735 X:152964544-152964566 CTCACTTTTCACTAAGGGGATGG + Intronic
1200257700 X:154593363-154593385 CTCGCTCATCACCAAGAGGATGG - Intergenic
1200445731 Y:3258394-3258416 CTCATTCATCACCAAGGGGATGG - Intergenic
1200723447 Y:6634262-6634284 CCCACTCATCACTAAGGGGATGG + Intergenic
1201067552 Y:10112628-10112650 CTCAAGCCTCAGCAATGGCAGGG + Intergenic
1201529348 Y:14975241-14975263 CTCACTCCTCAGCCTGGGGATGG - Intergenic