ID: 1005345637

View in Genome Browser
Species Human (GRCh38)
Location 6:24887236-24887258
Sequence CAAGCTACACCCACCGTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 58}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005345634_1005345637 0 Left 1005345634 6:24887213-24887235 CCCAAATGTCTTATCTCTTTAAC 0: 1
1: 0
2: 0
3: 37
4: 341
Right 1005345637 6:24887236-24887258 CAAGCTACACCCACCGTGAGAGG 0: 1
1: 0
2: 0
3: 3
4: 58
1005345635_1005345637 -1 Left 1005345635 6:24887214-24887236 CCAAATGTCTTATCTCTTTAACC 0: 1
1: 0
2: 1
3: 14
4: 258
Right 1005345637 6:24887236-24887258 CAAGCTACACCCACCGTGAGAGG 0: 1
1: 0
2: 0
3: 3
4: 58
1005345633_1005345637 24 Left 1005345633 6:24887189-24887211 CCTTGCTTGTATTTTAGTTATTT 0: 1
1: 1
2: 16
3: 102
4: 1047
Right 1005345637 6:24887236-24887258 CAAGCTACACCCACCGTGAGAGG 0: 1
1: 0
2: 0
3: 3
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005345637 Original CRISPR CAAGCTACACCCACCGTGAG AGG Intronic
916092029 1:161314860-161314882 CTAGCTGCTCCCACCGTGAGTGG + Intronic
920013640 1:202888545-202888567 CCAGCAACACCCGCGGTGAGCGG + Intronic
920051896 1:203169245-203169267 CGAGCTTCACCCAAGGTGAGGGG - Exonic
1067014200 10:42744251-42744273 AAAGCTACAGCCACAGTGTGTGG + Intergenic
1067487019 10:46660158-46660180 CAAGCTTGAGCCACCGTGCGTGG - Intergenic
1067607785 10:47681816-47681838 CAAGCTTGAGCCACCGTGCGTGG + Intergenic
1069555954 10:69398814-69398836 CAAGCTTCATCCACAGTGAGTGG + Exonic
1070825710 10:79389189-79389211 CCAGCTGCACCCACCCTGACTGG + Intronic
1079806361 11:24935206-24935228 CAAGCTGCCCTCACAGTGAGAGG + Intronic
1081793715 11:45805586-45805608 CAACCTACTCCCACCCCGAGGGG - Exonic
1085701234 11:78747644-78747666 CAAGCAAATCCCACAGTGAGGGG - Intronic
1090165627 11:124543803-124543825 GAAGATAGACCCACAGTGAGTGG - Intergenic
1108677232 13:52747676-52747698 CAAGATACAGTCGCCGTGAGGGG - Intergenic
1113469439 13:110533998-110534020 CAGCCTCCACCCACCGTGATGGG + Intronic
1128765553 15:70248964-70248986 CAAGTTACAGTCACAGTGAGAGG + Intergenic
1128881037 15:71242978-71243000 CAAGCAACAACCACGGTGTGGGG + Exonic
1132687189 16:1167258-1167280 CAAGCCCCACCCACCGGGACGGG - Intronic
1136375810 16:29864362-29864384 CAAGCTGCACCCTCCTTGAGAGG + Intergenic
1136568824 16:31084922-31084944 GAGCCTACACCCACCCTGAGGGG - Exonic
1138163767 16:54780608-54780630 AGAGCTACACCCACAGTGACAGG + Intergenic
1143461721 17:7108454-7108476 CAATCAGCACCCACGGTGAGGGG - Exonic
1144677112 17:17168655-17168677 CAGGCCACACCCACCATGTGTGG + Intronic
1158366984 18:56747471-56747493 CAAGCTACAACCAGCTGGAGAGG + Intronic
1160865306 19:1253507-1253529 CAACCCACACCCACCCTGAACGG + Intronic
1163015183 19:14450537-14450559 CCAGGAACACCCACGGTGAGGGG + Intronic
1163694481 19:18757052-18757074 CAAAATGCACACACCGTGAGGGG - Intronic
1164885690 19:31776728-31776750 GAAGCTACACACAGAGTGAGGGG + Intergenic
1167949250 19:53013189-53013211 CAAACTAAACCCACACTGAGGGG - Intergenic
929270800 2:39969919-39969941 CCAGCTCCACACACCTTGAGTGG - Intergenic
929430314 2:41880716-41880738 CAACCTTCCCCCACCCTGAGTGG - Intergenic
938289527 2:130141963-130141985 CAAGCTGAAGCCACCGGGAGGGG - Intronic
938467003 2:131530975-131530997 CAAGCTGAAGCCACCGGGAGGGG + Intronic
941676508 2:168348274-168348296 CAGGCAACTCCCACCCTGAGTGG + Intergenic
942980842 2:182079687-182079709 CTAGCTTCACCAACTGTGAGAGG - Intronic
948454854 2:238100236-238100258 CAAGCCACTCCCACAGTGTGAGG - Exonic
1170869553 20:20192570-20192592 CAAGCTACTCCCACTCTAAGAGG - Intronic
1172725388 20:37036541-37036563 CAAGCTTCAGCCACCGTGCCCGG + Intronic
1175709742 20:61209837-61209859 CACGCTACAGCCTCCCTGAGTGG + Intergenic
1179588136 21:42387085-42387107 AAGGCTACCCCCACCATGAGTGG + Intronic
1184786505 22:46674522-46674544 CACGTCACACCCACAGTGAGAGG - Intronic
949099803 3:130115-130137 CAAGCTTCAGCCACCGTGCCCGG + Intergenic
954899604 3:54007484-54007506 CATGCTGCAACCACCGTTAGTGG + Intergenic
975409676 4:74035755-74035777 CTAGCTACACGCACCTGGAGAGG + Intergenic
997325277 5:133015454-133015476 CAAGCCACACCCAAGGAGAGGGG - Intronic
1004788089 6:18991380-18991402 TAAGCTACATCCACAGTGTGTGG - Intergenic
1005345637 6:24887236-24887258 CAAGCTACACCCACCGTGAGAGG + Intronic
1007678663 6:43619097-43619119 CAAGCATCAGCCACCGTGACTGG - Intronic
1007965464 6:46000359-46000381 AAGGAGACACCCACCGTGAGGGG + Intronic
1016890927 6:149006042-149006064 CAAGAAACGCCCACTGTGAGTGG - Intronic
1019612191 7:1942188-1942210 CCAGCTGCTCCCACCATGAGTGG - Intronic
1021300463 7:18966354-18966376 CAAGCTACAGCAACCATGACTGG - Intronic
1024029631 7:45447911-45447933 CAAACTAAACCCACAGTTAGGGG + Intergenic
1025811595 7:64879172-64879194 CCAACTACATCCACGGTGAGAGG - Intronic
1029125468 7:98292241-98292263 CCAGCAACACACACGGTGAGCGG + Exonic
1034640045 7:152595190-152595212 CAAGCTCAACCCCCCTTGAGAGG - Intergenic
1037477345 8:19270553-19270575 GAAGCTACTGCCACCATGAGTGG - Intergenic
1039657685 8:39427841-39427863 CAAGCTAGATCCACTGTCAGGGG - Intergenic
1043921441 8:85988249-85988271 CAAGCTCCAGCACCCGTGAGGGG + Intronic
1057203990 9:93159839-93159861 CATGCTACCCCCACCCTGTGAGG - Intergenic
1060927556 9:127465622-127465644 CACTCAACACCCACCGTGTGAGG + Intronic
1061231047 9:129315966-129315988 CAGGCTACACACACTGGGAGAGG - Intergenic
1196624259 X:117860177-117860199 CAAGCAACACCCTCTCTGAGAGG - Intergenic