ID: 1005347630

View in Genome Browser
Species Human (GRCh38)
Location 6:24906034-24906056
Sequence CTGTTGTTTTTCAGTACATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 1, 2: 2, 3: 31, 4: 340}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005347629_1005347630 18 Left 1005347629 6:24905993-24906015 CCAAAAGTGAAGAGGCAAATACA 0: 1
1: 0
2: 1
3: 24
4: 343
Right 1005347630 6:24906034-24906056 CTGTTGTTTTTCAGTACATAAGG 0: 1
1: 1
2: 2
3: 31
4: 340
1005347628_1005347630 19 Left 1005347628 6:24905992-24906014 CCCAAAAGTGAAGAGGCAAATAC 0: 1
1: 0
2: 1
3: 25
4: 280
Right 1005347630 6:24906034-24906056 CTGTTGTTTTTCAGTACATAAGG 0: 1
1: 1
2: 2
3: 31
4: 340

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005347630 Original CRISPR CTGTTGTTTTTCAGTACATA AGG Intronic
900282478 1:1879936-1879958 TTGTTGTTTTTTAAGACATAGGG + Intronic
901488437 1:9582082-9582104 TTTTTGTTTTTCAGTAGAGACGG + Intronic
901552459 1:10005731-10005753 TTTTTGTTTTTCAGTAGAGATGG + Intronic
902766431 1:18619199-18619221 CTGGGGTTTTTCATTACGTAGGG - Intergenic
903836815 1:26209407-26209429 TTTTTTTTTTTCAGTAGATATGG + Intergenic
904643776 1:31950437-31950459 CTTTTGTATTTTAGTACAGATGG - Intergenic
905578393 1:39064345-39064367 TTTTTGTTTTTCAGTACAGATGG - Intergenic
905810548 1:40909549-40909571 TTTTTTTTTTTCAGTAGATATGG + Intergenic
906957192 1:50384161-50384183 CTGTTGTGATTGAGTACACATGG - Intergenic
908523000 1:64962895-64962917 GTGTTGTTTTTTAGTAGAGATGG - Intronic
908855810 1:68426493-68426515 TTGTTCTTTTTTAGTACTTAAGG + Intergenic
908893612 1:68873996-68874018 CTGTTGTTTCTCAGAGAATAAGG - Intergenic
910131199 1:83908667-83908689 TTATTGTTTTTCAGTTCCTATGG + Intronic
910430606 1:87156061-87156083 GTGTTGTTTTTAAGTATTTAAGG - Intronic
910825238 1:91399852-91399874 CGGTTGTTTTTCTGAAAATATGG - Intronic
910828973 1:91440847-91440869 GTGTTGTTTTTCAGTATTTGTGG + Intergenic
910922696 1:92366373-92366395 ATGTTGTTTTTCAGTAAATATGG - Intronic
910966600 1:92814431-92814453 CTTTTTTTTTTTAGTACAGACGG + Intergenic
912058761 1:105638152-105638174 CTGTTATGTTTTATTACATATGG - Intergenic
913153683 1:116072341-116072363 CTGTTTTATTTCATTTCATAAGG + Intergenic
914655943 1:149740742-149740764 CGGTTGTTTATTCGTACATAAGG - Intergenic
915234659 1:154471798-154471820 CTATTTTTTTTCAGGACATTGGG - Intronic
915664614 1:157433207-157433229 CTGTTGTTTTTCAATAACTAAGG - Intergenic
915716962 1:157953798-157953820 CTGTTTTTTTTCAATAGAGATGG - Intergenic
916299623 1:163259334-163259356 CTTTTTTTTTTCAGTAGAGACGG + Intronic
916404671 1:164486191-164486213 TGGTTGTTTTTCAAAACATAGGG - Intergenic
917192315 1:172431057-172431079 CTGTTGTGTCTCAGGAAATAGGG - Intronic
918934919 1:190910118-190910140 CTATTGATTTTCAGTTCAAAAGG - Intergenic
919102978 1:193116713-193116735 TTGTTATTTTTTAGTAAATACGG - Intergenic
920642637 1:207768605-207768627 CTATTTTATTTCAGTAAATAAGG - Intronic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
922012600 1:221606243-221606265 TTGTTGTGTTTCAGAAAATAGGG - Intergenic
922446753 1:225704403-225704425 TTGTGGTTTTTCAGTAGAGACGG + Intergenic
923918179 1:238532182-238532204 CTGTCGTCTTTCAGTCTATAAGG + Intergenic
1063264554 10:4433623-4433645 CTGTTGTGTCTCAGAAAATAGGG + Intergenic
1063813080 10:9736836-9736858 CTTTTTTTTTTCAGTAGAGAGGG + Intergenic
1064461805 10:15541805-15541827 TTTTTTTTTTTCATTACATATGG + Intronic
1066303626 10:34118193-34118215 TTGTTCTTTTTCAATCCATAAGG - Intronic
1066375240 10:34852051-34852073 TTGTTGTATTTCAGTAGAGATGG + Intergenic
1067988966 10:51187721-51187743 TTGTTGTTTCTCAGAACATAAGG + Intronic
1068965127 10:62904154-62904176 CTGTTGTTTTTCATTATGAAAGG + Intronic
1069854257 10:71430912-71430934 CTGTTCCATTTCAGTACATACGG - Intronic
1070405347 10:76089708-76089730 CTGTGGTTGTTCCGTGCATATGG - Intronic
1071479360 10:86053230-86053252 CTTTTGTTTTTTATTACACAAGG - Intronic
1071949299 10:90684612-90684634 CTGCTGTTATGCAGTACAAAGGG - Intergenic
1072326207 10:94301172-94301194 TTTTTGTATTTCAGTACAGATGG - Intronic
1073128782 10:101171412-101171434 GTTTTGTTTTTCAGTACAGATGG - Intergenic
1073613809 10:104972166-104972188 TTGTTGTTTTTTAGTAGAGATGG - Intronic
1073667451 10:105549783-105549805 TTGTTGTTTTTCAGTAAATTGGG - Intergenic
1073672887 10:105611983-105612005 CTGGTGTTTTTCTGTACCTAGGG + Intergenic
1073973949 10:109078096-109078118 ATGTTGTTATCCAGTCCATAAGG + Intergenic
1074301419 10:112236536-112236558 CTTTAGTTCTTCAGTAGATACGG - Intergenic
1075193342 10:120331586-120331608 CTGTTGTGTTTCAGGGAATAGGG - Intergenic
1075354521 10:121758966-121758988 TTGTTGTGTTTCAGGAAATAGGG - Intronic
1077268220 11:1662517-1662539 CTGTTATTCTTCACTACAAAAGG - Intergenic
1077272662 11:1689101-1689123 CTGTTATTCTTCACTACAAAAGG + Intergenic
1078643778 11:13119545-13119567 CTGTTGTTATTGAGAAAATAGGG - Intergenic
1080096111 11:28409011-28409033 ACGTTCTTTTTTAGTACATATGG + Intergenic
1081601650 11:44499591-44499613 GTATTTTTTTTCAGTACAGACGG + Intergenic
1084234009 11:67774637-67774659 TTTTTGTTTTTCAGTAGAGATGG + Intergenic
1086965246 11:93020575-93020597 ATGTTCTTTTTTAGTCCATAAGG + Intergenic
1087756165 11:102056794-102056816 TTGTATTTTTTCAGTACAGACGG + Intronic
1088586046 11:111360771-111360793 TTTTTGTATTTCAGTAAATATGG - Intronic
1091167008 11:133487524-133487546 CTGGTGTTTTTCTCTTCATAGGG + Intronic
1092038756 12:5364516-5364538 CTGTTGTTTTCCAGTCTATGTGG + Intergenic
1094038208 12:26093405-26093427 CTTTTGTATTTTAGTACAGACGG - Intergenic
1095670328 12:44851952-44851974 CTTTTATTTTTAAGTACATTTGG + Intronic
1096211705 12:49771232-49771254 TTTTTTTTTTTCAGTACAGAAGG - Intergenic
1096299765 12:50416493-50416515 TTTTTGTTTTTAAGTACAGACGG - Intronic
1097739849 12:63228507-63228529 TTGTTTTTTTTTAGTAGATATGG - Intergenic
1098317632 12:69208978-69209000 CTTTTGATTTTCTGTAGATATGG + Intergenic
1099553980 12:84086099-84086121 CTTTTGTTTTTCAGTAAAATAGG + Intergenic
1099747599 12:86725631-86725653 CTTTTGTATTTCAGTAGAGATGG + Intronic
1101190481 12:102327305-102327327 CTGTTGTTTTCTACTCCATATGG - Intergenic
1101414705 12:104499107-104499129 TTCTTGTTTTTCAGTTCACATGG + Intronic
1102320555 12:111929808-111929830 GTGTAGTTTTTCAGTAGAGACGG - Intergenic
1103048132 12:117755601-117755623 TTGTTGTGTTTCAGAAAATAGGG - Intronic
1104235715 12:126934491-126934513 CTTTTTTTTTTCAGTAGAGACGG - Intergenic
1104435929 12:128756612-128756634 CTGATGTTTTACAGCACACAGGG + Intergenic
1105730601 13:23211648-23211670 CTTTTGTTTTTCAGTGCAATAGG - Intronic
1107436457 13:40384702-40384724 TTGTTATTTTTTAGTACAGATGG + Intergenic
1108963801 13:56271319-56271341 TTGTTTTATTTCAGTATATAAGG - Intergenic
1109036333 13:57266162-57266184 CTCTTGTTTTTCAGTAGGTAAGG - Intergenic
1110118938 13:71857312-71857334 CTGTTGTATTTCAGTAAAATAGG + Intronic
1111392084 13:87609416-87609438 TTGTTTTTTTTCAGTAGAGACGG + Intergenic
1111486264 13:88904758-88904780 TTATTGTTTTTCACTACAGAGGG + Intergenic
1111856616 13:93645707-93645729 CATTTATTTTTCAGTTCATAGGG + Intronic
1112373799 13:98819973-98819995 CTGTTGTTTTACAGAACAGCAGG - Intronic
1112623075 13:101071940-101071962 TTGTTGTGTCTCAGGACATAGGG + Intronic
1114308393 14:21443680-21443702 CTGTTATTTTTTAGTAGAGATGG - Intronic
1114310992 14:21467077-21467099 TTGTATTTTTTCAGTACAGACGG + Intronic
1115074428 14:29369629-29369651 TTTTTGTTTTTCAGTAGAGACGG + Intergenic
1116134729 14:40907911-40907933 TTGTTGTATTTCAGTAGAGACGG + Intergenic
1116303020 14:43210315-43210337 CTTTTGTTTTTCCAAACATATGG - Intergenic
1117219945 14:53593405-53593427 TTGTGGTTTTTAAGTACAGAGGG + Intergenic
1119619185 14:76118790-76118812 CTGTTGTCTTTCAGGATATCTGG + Intergenic
1120297664 14:82664280-82664302 CTGTATTTTTTTAGTACAGACGG - Intergenic
1120310326 14:82818504-82818526 CTTTTTTTTTTTAGTACAGATGG - Intergenic
1120421217 14:84288457-84288479 CTATAGTTTTTCAATTCATATGG + Intergenic
1120862751 14:89269600-89269622 CAGTTGTTTTTCAGAAACTAGGG + Intronic
1120958654 14:90104958-90104980 TTTTTGTTTTTCAGTAGAGATGG + Intronic
1123161840 14:106286491-106286513 ATGCTTTTTTTCAGTTCATATGG + Intergenic
1123179823 14:106459431-106459453 GTGCTTTTTTTCAGTTCATATGG + Intergenic
1124232699 15:27959204-27959226 ATGTTTTCATTCAGTACATATGG + Intronic
1124456260 15:29845630-29845652 TTGTTTTTTTTCAGTAGAGATGG - Intronic
1124604850 15:31162356-31162378 TTTTTGTTTTTTAGTACAGACGG - Intergenic
1124847834 15:33309583-33309605 CTGATGTTCATCAGAACATATGG + Intergenic
1126209774 15:46088099-46088121 CTGTTATTTTTCTGTAAAAATGG + Intergenic
1127745567 15:61967829-61967851 CTGTTGTTTTTAAGTTAAAAAGG - Intronic
1128394189 15:67207009-67207031 GTGTTGTTTTTTAGTAGAGACGG - Intronic
1129181384 15:73879386-73879408 TTGTTTTTTTTTAGTAGATATGG + Intronic
1129733761 15:77947748-77947770 TTTTTTTTTTTGAGTACATATGG - Intergenic
1132597196 16:758439-758461 CTTTTTTTTTTCAGTAGAGACGG + Intronic
1133540205 16:6744395-6744417 ATATTGTTTTCAAGTACATAAGG + Intronic
1135646993 16:24171911-24171933 TTGTTTTTTTTCAGTAGAGATGG + Intronic
1136647845 16:31637582-31637604 CAGTTGTCTCTCAGTATATATGG + Intergenic
1137486232 16:48893838-48893860 TTTTTGTATTTCAGTAGATATGG - Intergenic
1139082077 16:63534557-63534579 CTGTTGTGTTTCAGGAATTAGGG + Intergenic
1139829514 16:69785795-69785817 TTGTTGTTTTTTAGTATAGATGG + Intronic
1140026099 16:71291624-71291646 TTTTTGTTTTTCAGTAGAGACGG - Intergenic
1142216707 16:88833620-88833642 TTTTTGTTTTTCAGTAGAGATGG + Intronic
1142800324 17:2340915-2340937 CTGTTGTTTTTCCTTGCAGAAGG - Intronic
1144355668 17:14443904-14443926 TTGTTTTTTTTTAGTACAGACGG - Intergenic
1144472932 17:15560724-15560746 TTGTTGTTTTTCAGTACAGACGG + Intronic
1144923547 17:18783972-18783994 TTGTTGTTTTTTAGTACAGACGG - Intronic
1146015334 17:29228592-29228614 TTCTTGTTTTTCAGTAGAGACGG + Intergenic
1146613192 17:34326576-34326598 TTGTAGTTTTTTAGTACAGATGG - Intergenic
1146810065 17:35896184-35896206 CTGTTGTGTTTCAGTTCCTTAGG + Intergenic
1147833417 17:43313216-43313238 GTATTGTTTTTGAGTACTTAGGG - Intergenic
1148510606 17:48165914-48165936 CTTTTGTTTTTCATTCCAAATGG - Intronic
1149187966 17:54023898-54023920 GTTTTGTTTTTCAGTAGAGACGG - Intergenic
1149209122 17:54283662-54283684 CTGTTGTTATTCTTTTCATATGG + Intergenic
1149225781 17:54468578-54468600 GATTTATTTTTCAGTACATACGG - Intergenic
1153594299 18:6708949-6708971 CTCTTGTTTTTCAATAAAAAAGG - Intergenic
1153973002 18:10243404-10243426 CTGAGGTTTTTCAGGGCATATGG + Intergenic
1154432341 18:14317853-14317875 CTGTTGCTTTTCCATACATGGGG + Intergenic
1156001232 18:32386791-32386813 TTGTTGTTTTTCATGACAGAGGG + Intronic
1156535598 18:37861813-37861835 CTGTTGTATTTGAATACAGATGG - Intergenic
1156553741 18:38044481-38044503 TTGTATTTTTTCAGTACAGACGG - Intergenic
1156711608 18:39953573-39953595 CTGTTGTGTTTCAAAAAATAGGG + Intergenic
1156777244 18:40806752-40806774 TTTTTGTTTTTGATTACATAAGG + Intergenic
1157313928 18:46572849-46572871 TTTTTGTTTTTCAGTAGAGACGG - Intronic
1157907013 18:51578181-51578203 GTCTGGTTTTTCAGTAGATAGGG + Intergenic
1158461186 18:57647625-57647647 ATGTTGTATTTCAGTTCAAATGG - Exonic
1158718082 18:59898785-59898807 CTTTTGTATTTCAGTAGAGACGG + Intergenic
1158957668 18:62555872-62555894 CAGTTGTTTTTCTGAACAGAAGG + Intronic
1159469181 18:68827425-68827447 ATGTTGATTTCCAGTAGATAAGG + Intronic
1160669389 19:350044-350066 TTGTTGTTTTTCGGTAGAGATGG - Intergenic
1161361204 19:3850709-3850731 TTGTTGTTTTTCTGTAGAGATGG - Intronic
1161472851 19:4469141-4469163 TTTTTGTTTTTCAGTAGACATGG + Intergenic
1161476849 19:4490978-4491000 ATTTTGTTTTTCAGTAGAGATGG + Intronic
1162435809 19:10657628-10657650 CTTTTTTTTTTTAGTAGATACGG - Intronic
1165125018 19:33588253-33588275 TTGTTGTGTCTCAGGACATAGGG - Intergenic
1166756577 19:45196031-45196053 CTATTGTTTGTGACTACATATGG + Intronic
1168134980 19:54344842-54344864 TTGTTTTTTTTCAGTAGAGATGG + Intergenic
1168575125 19:57502996-57503018 CTGTGTTTTTTAAGTAGATATGG + Intronic
926611301 2:14951036-14951058 GTGTTCTTTTTCAGCTCATATGG - Intergenic
926722270 2:15969848-15969870 CTGTTGTGTTTCAGGGAATAGGG + Intergenic
929433621 2:41909648-41909670 CTGTTGTTTTTCACTTCAAGTGG - Intergenic
930569839 2:53071666-53071688 ATGTTGTGTTTCTCTACATAGGG - Intergenic
931398435 2:61908737-61908759 TTTTTGTTTTTCAGTAGAGACGG + Intronic
932920033 2:75902271-75902293 GTTTTGTTTTTCAGTAGAGACGG - Intergenic
932971801 2:76552320-76552342 TTTTTGTATTTTAGTACATAGGG + Intergenic
933430780 2:82175450-82175472 TTGTTGTTTTTTAGTAGAGACGG + Intergenic
933551549 2:83783736-83783758 CTGTTGTTGTTGGGTACATTTGG - Intergenic
933932625 2:87169376-87169398 TTTTTGTTTTTCAGTAGATACGG + Intergenic
935754868 2:106269319-106269341 TTTTTGTTTTTCAGTAGAAACGG - Intergenic
936360485 2:111796066-111796088 TTTTTGTTTTTCAGTAGATACGG - Intronic
938586141 2:132692321-132692343 TTGTTGTTTTTTAGTAGAGATGG + Intronic
939859373 2:147399036-147399058 CTGTTGTTTTCCAAGAAATATGG - Intergenic
940646277 2:156395978-156396000 GTTTTGTTTTTCAGTAGAGACGG + Intergenic
940686479 2:156857246-156857268 TTGTTTGTTTTTAGTACATACGG - Intergenic
940745743 2:157565554-157565576 CTGTCCTTATTCAGTATATAAGG - Intronic
941217219 2:162727002-162727024 GACTTGTTTTTCAGTAGATAGGG + Intronic
941933135 2:170962515-170962537 CTGATTTGTTTCAGTAGATATGG - Intronic
942207910 2:173640710-173640732 CTGTTGTTCTGCATGACATATGG - Intergenic
942921563 2:181380378-181380400 CTGTTGTTTTTCATGACTGAAGG + Intergenic
944025840 2:195166366-195166388 CAGTTGTTTCTCAGGAAATAGGG - Intergenic
944366130 2:198921632-198921654 TTGTTGTTTTTCAATAAATTTGG - Intergenic
944449281 2:199824679-199824701 CTGTTGTGTCTCAGTAAATAGGG + Intronic
945109663 2:206350178-206350200 CTGTTCTTTTTTAATACATAAGG + Intergenic
946575235 2:221068353-221068375 TTGTTGTTTCTCAGAAAATAGGG - Intergenic
946731337 2:222712458-222712480 ATGTTATTTTTCAGTACACATGG + Intergenic
947340027 2:229128367-229128389 CTGTTGTATTCCAGTAATTAGGG + Intronic
947667474 2:231915711-231915733 TGGTTGTTATTCAGTACAGAAGG - Intergenic
948034211 2:234844787-234844809 TTTTTGTGTTTCAGTACAGATGG - Intergenic
948764385 2:240212057-240212079 CTCTTGTTTTCCAGAACCTAAGG - Intergenic
1170909116 20:20546064-20546086 TTGTTGTTTTTCAAGAGATAGGG - Intronic
1171010613 20:21507441-21507463 CTATTTTTGTTTAGTACATATGG + Intergenic
1171117794 20:22541341-22541363 CTGTTGGTTTTCATCACAAAAGG - Intergenic
1172226065 20:33306002-33306024 ATGATGTTTTTCAGAACATCAGG - Exonic
1172684519 20:36744072-36744094 CTGTTATTTTTTAGTACAGACGG + Intronic
1172864373 20:38084348-38084370 CTGTTGTGCTACAGGACATATGG - Intronic
1173093432 20:39999623-39999645 TTAGTGTTTTTCAGTATATAGGG - Intergenic
1173215172 20:41074849-41074871 CTATTATTTTTCAGTACACTGGG - Intronic
1176545873 21:8198466-8198488 CTTTTCTTTTTCAGTAGAGACGG + Intergenic
1176564824 21:8381511-8381533 CTTTTCTTTTTCAGTAGAGACGG + Intergenic
1176700341 21:10040332-10040354 CTGTTGTTGTTAAGAAAATAAGG - Intergenic
1176847437 21:13887462-13887484 CTGTAGCTTTTCCGTACATGGGG - Intergenic
1177299894 21:19229611-19229633 CTGTTGTGTTTCTGTAGTTAAGG - Intergenic
1177649011 21:23936821-23936843 TTTTTGTTTTTCAGTCCATGGGG + Intergenic
1178068173 21:28930502-28930524 CTTTTCTTTTTCAGTACAAATGG - Exonic
1180691361 22:17718986-17719008 CTGTTGTATTTTTGTAGATACGG - Intronic
1184980776 22:48094699-48094721 TTGTAGTTTTTCAGTAGAGATGG - Intergenic
1203250744 22_KI270733v1_random:114703-114725 CTTTTCTTTTTCAGTAGAGACGG + Intergenic
949865272 3:8542170-8542192 TTGTTGTTTTTAAGTAGAGATGG + Intronic
950327131 3:12121510-12121532 TTTTTGTTTTGCTGTACATAAGG + Intronic
950632424 3:14291620-14291642 CTGTTGTGTTTCAGGAAATAGGG - Intergenic
951723957 3:25734530-25734552 TTGTTTTTTTTCAGTAGAGACGG - Intronic
951947489 3:28156759-28156781 TTGTTATTTTTCAGTAAAGACGG + Intergenic
952385855 3:32841072-32841094 TTTTTGTTTTTTAGTACAGATGG - Intronic
952439925 3:33316445-33316467 CAGTTGTTTTTGAGTTCCTATGG + Intronic
956295504 3:67708754-67708776 TTTTTGTTCTTCAGTACATAGGG - Intergenic
956442886 3:69297474-69297496 TTGTTGTTTTTCATTTCATTTGG - Intronic
956980933 3:74636568-74636590 CTTTTGTTCTTCTGTACATCTGG + Intergenic
957649959 3:82987848-82987870 TTGTTTTTTTTCAGTACAAGTGG + Intergenic
957788945 3:84916116-84916138 TTGTTGTTTATCACTAGATATGG - Intergenic
958000670 3:87744871-87744893 CAATTTATTTTCAGTACATAAGG - Intergenic
960382717 3:116984272-116984294 CTGTTGTGTCTCAGAAAATAGGG - Intronic
961053284 3:123765717-123765739 CTGTGGTTTGGCATTACATAGGG + Intronic
961855841 3:129870422-129870444 CAATTGTTTTTCATTAGATATGG + Intronic
963397004 3:144747962-144747984 CTGTTGTTCTTTAGTGCAAAGGG + Intergenic
963547769 3:146683367-146683389 TTGTCCTTTTTCAGTAGATATGG + Intergenic
963584497 3:147167450-147167472 TTGTTGTTTCTCAGAGCATAGGG + Intergenic
964272489 3:154972640-154972662 AAGTTGTTTTTCAATACTTACGG - Intergenic
964451762 3:156819732-156819754 AAGTTGTTTTTAAGTGCATAAGG + Intergenic
964784493 3:160380204-160380226 TTTTTGTATTTCAGTACAGACGG + Intronic
965143863 3:164872608-164872630 CTGTTCTTTGTCACTACATGTGG + Intergenic
965905808 3:173704343-173704365 CTGTAGTCTTTCAGTATGTATGG + Intronic
966004417 3:174991573-174991595 TTTTTGTTGTTCTGTACATAGGG - Intronic
966185841 3:177226323-177226345 TTGGTGTTCTTGAGTACATATGG + Intergenic
966226526 3:177604090-177604112 TTGTTTTTTTTCAGTAGAGATGG + Intergenic
966617486 3:181927576-181927598 TTGTTATTTTTTAGTACAGATGG + Intergenic
966698293 3:182816097-182816119 CTTTTTTTTTTGAGTACCTATGG + Intronic
970945197 4:21682733-21682755 CTGTTGTATCTCAGGAAATAGGG + Intronic
971634512 4:29039798-29039820 CTGACGTTTTAGAGTACATAAGG + Intergenic
972819784 4:42687363-42687385 CTTTTGTATTTTAGTACAGACGG - Intergenic
972894580 4:43603857-43603879 CTTTTATTTTTCAGATCATATGG + Intergenic
973749613 4:54001093-54001115 TTTTTGTTTTTTAGTACAGACGG + Intronic
973972023 4:56222770-56222792 TTTTTGTTTTTCAGTAGAGATGG - Intronic
974640590 4:64624860-64624882 CTGTTGTTTTTCATAACTCATGG - Intergenic
975064587 4:70044845-70044867 TTCTTGTTTTACAGTACACATGG - Intergenic
975624815 4:76335551-76335573 CTGATGCTTTACAATACATAAGG + Intronic
975795101 4:77998593-77998615 TTGTTGTTTTTTAGTAGAAAGGG + Intergenic
975935137 4:79570435-79570457 CTGCTGACTTTCTGTACATAAGG + Intergenic
976058538 4:81098626-81098648 CTGTTGTGTCTCAGGAAATAGGG + Intronic
976121409 4:81786785-81786807 CTGTTGTTCTTCAGCACTTGAGG + Intronic
976469644 4:85413426-85413448 CTGTTGTTTTTTAATTGATAAGG + Intergenic
976911839 4:90316778-90316800 CTGTTGTTTTTGTGTACTTCTGG + Intronic
976938696 4:90672809-90672831 TTGTTGTGTTTCAGGAAATAGGG + Intronic
977000127 4:91488247-91488269 CTGTTCTTTTTCATTTTATATGG + Intronic
978695974 4:111579985-111580007 CTGTTATTTATCAATATATAAGG - Intergenic
979094059 4:116521358-116521380 TTGTTGTTTTTCAGTACATAGGG + Intergenic
979499979 4:121428531-121428553 CTATTCTTTTTCTGTAAATAAGG + Intergenic
980027879 4:127787837-127787859 CTTTTTTTTTTCAGTGCTTAAGG - Intronic
980152541 4:129064921-129064943 ATGTTATTTTACAGTGCATATGG - Intronic
980296124 4:130920160-130920182 CTGTTGTTTTGAAGTAAAAATGG - Intergenic
980372754 4:131899111-131899133 CTGTTGTTGTTAAGAAAATAAGG - Intergenic
980800535 4:137743523-137743545 CTCTTGTTTTTTATTACATCGGG - Intergenic
981321437 4:143396294-143396316 CTATTGTTTTTCACTCCAAAGGG - Intronic
982948578 4:161660183-161660205 CTTTTGTTTTTGATTACTTAGGG + Intronic
983040591 4:162921054-162921076 CTGCTGTTTTTCATCAGATAAGG + Intergenic
983311484 4:166067972-166067994 CTGTTGTTTTCCAGGTCATAAGG - Intronic
983611126 4:169646465-169646487 CTTTTTTTTTTCAGTAGAGATGG + Intronic
984113776 4:175652114-175652136 CTGTTGATTTGCAGCACAGAAGG + Intronic
984365290 4:178791724-178791746 TTTTTTTTTTTCAGTACAGATGG - Intergenic
984697998 4:182798808-182798830 CAGTTGTTTTTCTGTACTTGGGG - Intronic
985248606 4:188000809-188000831 GTGTTATTTTTTAGTAGATACGG - Intronic
985386992 4:189458477-189458499 CTGTTATTATTCAGTAGCTATGG + Intergenic
987142910 5:14963409-14963431 CTTTTTTTTTTCAGTAGAGACGG + Intergenic
990697481 5:58436852-58436874 CTGTTGTGTCTCAGGAAATAAGG + Intergenic
991272896 5:64806946-64806968 TTGTAGTTTTTCAGTACATTTGG - Intronic
991435514 5:66594474-66594496 GAGTTGCTTTTCAGTACATAGGG - Intergenic
993042781 5:82834823-82834845 CTGTTGTTTTTTAATACATTCGG - Intergenic
994441394 5:99809332-99809354 CTGATTTTTTTCTGTGCATATGG + Intergenic
994851422 5:105058525-105058547 TTGTTGTTTCTCAGAAAATAGGG - Intergenic
995415941 5:111913324-111913346 CAGGTGTTTTTCAGGAGATAAGG + Intronic
995595029 5:113738770-113738792 CTGTTTTCTGTCAGTACAGAAGG + Intergenic
997834201 5:137179221-137179243 TTGTTGTTTTTCACTGGATATGG - Intronic
998636487 5:143960553-143960575 ATGTTGTTTTTCTGTTCATTTGG - Intergenic
998779429 5:145640168-145640190 TTGTATTTTTTCAGTACAGACGG - Intronic
999959274 5:156736403-156736425 CTATTATTTTTCATTAAATAGGG + Intronic
1000752558 5:165114841-165114863 TTTTTGTTTTTTAGTAGATATGG + Intergenic
1005347630 6:24906034-24906056 CTGTTGTTTTTCAGTACATAAGG + Intronic
1007055514 6:38880070-38880092 TTGTTTTTTTTTAGTAGATACGG - Intronic
1007617848 6:43192498-43192520 GTATTGTTTTTCAGTAGAGACGG - Intronic
1007645524 6:43377523-43377545 TTGTTGTTGTTTAGTACAGATGG - Intergenic
1008916841 6:56797301-56797323 CTGTTGTGTTTCAGGGAATAAGG - Intronic
1009690268 6:67021669-67021691 CTCTTGTTTATCAGCACACATGG + Intergenic
1010186134 6:73145477-73145499 GTCTTCTTTTTCAGTAAATATGG + Intronic
1010241354 6:73618727-73618749 ATTTTGTTTTTCTGTACAGACGG + Intronic
1011353589 6:86450577-86450599 CTGGTGTTTGATAGTACATAGGG - Intergenic
1014019131 6:116567593-116567615 CTGTTGTATTTTGGCACATAAGG - Intergenic
1016229782 6:141788895-141788917 CTGCTGTTATTCAGTGCTTAAGG - Intergenic
1019389533 7:778286-778308 CTGTTTATTTTCACTACAAAAGG + Intronic
1019981957 7:4628267-4628289 ATGTTTTTTTTCAGTAGATATGG + Intergenic
1020617276 7:10475634-10475656 CTGTCGTTTTTCAGAAGAAATGG - Intergenic
1021405595 7:20263611-20263633 TTGTTGTTTTTTAGTAGAGATGG + Intergenic
1023266873 7:38415745-38415767 CTATTATTTTTCAGTCCATATGG + Intronic
1026225426 7:68436142-68436164 CTGTATTTTTTCAGTAGAGATGG + Intergenic
1026818209 7:73528883-73528905 CTTTTGTTTTTTAGTAGAGACGG + Intergenic
1027617281 7:80438884-80438906 TTTTTGTTTTTTAGTACAGAAGG - Intronic
1027916722 7:84333986-84334008 CTATTACTTTTCAGTACATTTGG - Intronic
1027950620 7:84810245-84810267 CTGGTGTTTTCAAGTACATCTGG - Intergenic
1028087376 7:86652747-86652769 TTGTTGTTGTTCAATACATGGGG - Intronic
1028280050 7:88913564-88913586 TTTTTGTTTTTTAGTAGATATGG + Intronic
1030136874 7:106260749-106260771 CTGTTGTGTCTCAGGGCATAGGG + Intronic
1031448475 7:121884081-121884103 CTATATTTTTTCATTACATAAGG - Intronic
1031794753 7:126157501-126157523 GTGCTGTTGTTCAGAACATATGG - Intergenic
1032257474 7:130308721-130308743 CTATTTTTTTTCAGTAGAGATGG + Intronic
1032571458 7:133004130-133004152 TTTTTGTTTTTCAGTAGAGACGG + Intronic
1034193383 7:149227548-149227570 TTTTTGTATTTCAGTACAGATGG - Intergenic
1035328425 7:158080472-158080494 CTGATGGTTTTCAGTGCATTAGG - Intronic
1037651224 8:20840469-20840491 TTGCCGTTTTTGAGTACATATGG + Intergenic
1038041237 8:23725986-23726008 TTTTTGTTTTTCAGTAGAGACGG + Intergenic
1038920915 8:32083112-32083134 CTGTTGTTTGTGAGTACGTTGGG - Intronic
1040433228 8:47364469-47364491 GTTTTGTTTTTCAGTATGTAAGG + Intronic
1041053561 8:53960284-53960306 TTGGGGTTTTTCAGCACATAGGG + Intergenic
1041148750 8:54909204-54909226 CTGTTTTTTTTCAGAATATAAGG + Intergenic
1042829606 8:73012125-73012147 TTGTTGTGTTTCAGGAGATAAGG + Intronic
1043672534 8:82905232-82905254 CAGCTGTTTTTCAGTTCATGTGG + Intergenic
1043798943 8:84581933-84581955 CTGATGTATTTTATTACATAAGG + Intronic
1044250903 8:90002649-90002671 GTGTTGTTTTTCAAAAAATATGG + Intronic
1046876924 8:119265256-119265278 CTATTGTTTTTCATTATTTATGG - Intergenic
1048027062 8:130596727-130596749 ATGTTGTTTTGCAGTATAAATGG - Intergenic
1048423830 8:134304238-134304260 CTGTTGGCTTTATGTACATACGG + Intergenic
1049117010 8:140697592-140697614 GTTTTGTATTTCAGTACAGATGG + Intronic
1050925669 9:11259837-11259859 CTGTTGTTTTTCATAACCCATGG - Intergenic
1051099736 9:13507157-13507179 TTTTTGTATTTCAGTACAGACGG - Intergenic
1051546510 9:18281593-18281615 CTATTGTTTTTCAGTAACTAAGG + Intergenic
1053591051 9:39515236-39515258 CTGATGTTTATCAATACAGAAGG + Intergenic
1053637542 9:40027154-40027176 CTGTTGTTGTTAAGAAAATAAGG - Intergenic
1053768539 9:41438085-41438107 CTGTTGTTGTTAAGAAAATAAGG + Intergenic
1053848898 9:42270608-42270630 CTGATGTTTATCAATACAGAAGG + Intergenic
1054318327 9:63623724-63623746 CTGTTGTTGTTAAGAATATAAGG - Intergenic
1054547207 9:66349566-66349588 CTGTTGTTGTTAAGAAAATAAGG + Intergenic
1054575255 9:66850054-66850076 CTGATGTTTATCAATACAGAAGG - Intergenic
1054776541 9:69128696-69128718 TTGTTATTTTTCAGTAGAGACGG + Intronic
1054964331 9:71005086-71005108 CTGTTGCCTTTCTGTAGATATGG - Intronic
1055335660 9:75230638-75230660 CTGTTTTTTTTCTGTGCATTTGG + Intergenic
1056946745 9:91004229-91004251 TTGTTGTATTTCAGTGCTTATGG + Intergenic
1057013438 9:91629233-91629255 TTATTGTTTTTCAGTAAATATGG + Intronic
1057730564 9:97604864-97604886 CTGTTGTTTTTCCACACCTAGGG - Exonic
1057854592 9:98592918-98592940 CCCTTATTTTTCAGTCCATAGGG + Intronic
1058864472 9:109148942-109148964 TTGCTGTTGTTCAGTACTTAAGG - Intronic
1059876631 9:118642374-118642396 CTGTTGTTCCTCAGCATATATGG + Intergenic
1202785351 9_KI270719v1_random:10397-10419 CTGTTGTTGTTAAGAAAATAAGG - Intergenic
1203467145 Un_GL000220v1:97971-97993 CTTTTCTTTTTCAGTAGAGACGG + Intergenic
1185712780 X:2317421-2317443 TTTTTATTTTTCAGTACAGACGG + Intronic
1186271000 X:7887988-7888010 CTGTTGTCTTTCAGAATAAAAGG - Intergenic
1188076760 X:25786383-25786405 CTGTTGGTCTTCAGTATCTATGG + Intergenic
1188163862 X:26837044-26837066 CTTTTGTTTTTCTGTACTTTTGG + Intergenic
1190851074 X:54242515-54242537 CTGTAGTTTTATAGTACATTTGG - Intronic
1192113046 X:68384547-68384569 TTGTAGTTTTTCAGTAGAGATGG - Intronic
1193091735 X:77501069-77501091 CTATTGTGTTTCAGGACCTATGG - Intergenic
1193653181 X:84164491-84164513 CTTTTGTTTTTCAGTAAGTGTGG - Intronic
1193889426 X:87026318-87026340 CTGTTGTTTTATTGTACAAAAGG + Intergenic
1194618182 X:96133622-96133644 TTGTTGTTCTTCAGTGAATAGGG - Intergenic
1194678678 X:96825124-96825146 TTTTTTTTTTTTAGTACATATGG + Intronic
1194709435 X:97217190-97217212 CTTGTGTTTATCAGTACAGAGGG + Intronic
1194964607 X:100273026-100273048 TTGTTTTTTTTCAGTACAAAAGG - Intergenic
1195818969 X:108921794-108921816 CTGTTGTGTCTCAGAAAATAGGG - Intergenic
1195879832 X:109580896-109580918 CAGTTATTTTTCAGTACTAAAGG + Intergenic
1197635748 X:128913085-128913107 CTGTAGTTTTTAGGTACATAGGG + Intergenic
1198092191 X:133342428-133342450 CTGTTGTTGTCCTTTACATAAGG - Intronic
1198142925 X:133823807-133823829 TTGTAGTTTTTTAGTACATATGG - Intronic
1198329014 X:135604314-135604336 CTGATGTTTTTCAGCAAATGAGG + Intergenic
1198337529 X:135681266-135681288 CTGATGTTTTTCAGCAAACAAGG - Intergenic
1198361656 X:135901545-135901567 CTGATGTTTTTCAGCAAATGAGG + Exonic
1199150825 X:144484553-144484575 CTGTTGTTTTCTATTACACATGG + Intergenic
1200784417 Y:7247313-7247335 CTGAAGTTTTTAAGTACATTGGG + Intergenic
1200830288 Y:7682009-7682031 CTGTTGTTTTTCATTAGCTCAGG - Intergenic
1201401404 Y:13608052-13608074 CTGTTGTTTTCCATAACCTATGG + Intergenic
1201698463 Y:16853934-16853956 TTTTTGTATTTCAGTAGATATGG + Intergenic
1201968397 Y:19763755-19763777 GTTATGTTTTTCAGTACATATGG + Intergenic