ID: 1005348513

View in Genome Browser
Species Human (GRCh38)
Location 6:24912228-24912250
Sequence GGAGTGCCTGCTCTGTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 508
Summary {0: 1, 1: 1, 2: 6, 3: 56, 4: 444}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005348513_1005348517 3 Left 1005348513 6:24912228-24912250 CCCCAGCACAGAGCAGGCACTCC 0: 1
1: 1
2: 6
3: 56
4: 444
Right 1005348517 6:24912254-24912276 GCTACATATTGAATGAAAGATGG 0: 1
1: 0
2: 1
3: 25
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005348513 Original CRISPR GGAGTGCCTGCTCTGTGCTG GGG (reversed) Intronic
900378742 1:2373349-2373371 GGAGCTCCTGCTGTGTTCTGGGG + Intronic
900509759 1:3053003-3053025 GGTGTCCCTTCTCTGTGCTGGGG + Intergenic
900891981 1:5456149-5456171 TGAGTGCCTGCTATGGTCTGTGG - Intergenic
901491074 1:9596623-9596645 GCAGGCCCTGCTCTGTGCTCAGG + Intronic
902712067 1:18247289-18247311 TGGGTGCCTGGACTGTGCTGGGG + Intronic
902790684 1:18765818-18765840 GGAGGACCTGCTATGTGCCGGGG - Intergenic
902882865 1:19384319-19384341 GAAGAGCCTGCTGGGTGCTGAGG - Intronic
903803264 1:25985689-25985711 TGAGTACCTGCTGTGTGCCGGGG - Intronic
904068843 1:27777006-27777028 GGAGCACCTGCTGTGTGCTGGGG + Intronic
904412079 1:30330579-30330601 TGAATGCCTGCTGTGTCCTGAGG + Intergenic
904482773 1:30804586-30804608 GGCATGGCTGATCTGTGCTGGGG + Intergenic
904565403 1:31425479-31425501 GGTGGGGCTGCTCTTTGCTGGGG + Intronic
905590398 1:39158369-39158391 GCAGTGCCTCCTCTGTTGTGTGG + Intronic
906746623 1:48226427-48226449 TGGGTGCCTGCTCTGTGTTTGGG - Intronic
907327797 1:53652249-53652271 TCTGTGCCAGCTCTGTGCTGAGG + Intronic
907687611 1:56628422-56628444 TGAGTGCCCACTCTGTGCTAAGG - Intronic
909036830 1:70602936-70602958 AGAGTGCCTTCTGTGGGCTGGGG + Intergenic
910513782 1:88036316-88036338 GAGGTGGCTGCACTGTGCTGGGG - Intergenic
911511533 1:98812824-98812846 TGATTGCCTCCTCTGTGCTTGGG - Intergenic
912415506 1:109505869-109505891 TGAGTGGCTGCTCTGAGCTTTGG - Exonic
914250513 1:145918285-145918307 GGAGTGCCTCCTCAGCTCTGGGG + Intronic
914430243 1:147613983-147614005 TGAGTGCCAGCACTATGCTGGGG + Intronic
915199864 1:154219652-154219674 GGCTTACCTGCTCAGTGCTGTGG - Intronic
915599944 1:156915802-156915824 TGAGTGCCTACTCTGTGCCAAGG - Exonic
915638591 1:157203839-157203861 TGAGTGCCTACCATGTGCTGGGG - Intergenic
916178231 1:162060829-162060851 TGAGTGCCTGCTATGTGCCATGG - Intergenic
916661162 1:166923346-166923368 GGACTTCCTGCTCTGTGGGGAGG - Intronic
916720813 1:167483711-167483733 GCAGTGCCTGCTCTGGGAGGTGG + Intronic
917259154 1:173148458-173148480 AGAGTGGCTGTGCTGTGCTGTGG + Intergenic
917585845 1:176425790-176425812 GAGGCGGCTGCTCTGTGCTGGGG + Intergenic
918071154 1:181134159-181134181 TGAGCGCCTGCTCTGTGCTGGGG - Intergenic
919774544 1:201185542-201185564 GGCATGGCTGCTCTGAGCTGTGG + Intergenic
920036104 1:203066805-203066827 AGAGTCCCTGCTCTGTGCTAGGG + Intronic
920203632 1:204275941-204275963 GCAGAGCCAGCTCTTTGCTGTGG - Intronic
922220145 1:223552236-223552258 GGACTGACCACTCTGTGCTGGGG - Intronic
922351801 1:224740162-224740184 GGAGTGGCTGCTCTGTACCGTGG + Exonic
923931369 1:238701741-238701763 GGGTTGCATGCTCTGTTCTGGGG - Intergenic
924412376 1:243819609-243819631 GGAGGGGATGCACTGTGCTGGGG - Intronic
924465541 1:244296130-244296152 GGAGCTCCTCTTCTGTGCTGGGG + Intergenic
924558509 1:245137832-245137854 GGTGTGCCAGCTCTGTACTGGGG - Intergenic
924686298 1:246294232-246294254 TGAGTGAGTGCTATGTGCTGGGG - Intronic
1063499250 10:6538162-6538184 GGAGTACCTGCTCTAAGGTGAGG + Intronic
1063601316 10:7483613-7483635 GGAGTGTCTGGTCTGGGATGTGG - Intergenic
1064707863 10:18091410-18091432 TGACTGCCTGCTCTGAGCTCAGG + Intergenic
1065334061 10:24636960-24636982 TGAATGCCTGCTCTATGCTATGG - Intronic
1065883876 10:30059641-30059663 GGGCTGCCTCCTCTGCGCTGAGG + Intronic
1065965585 10:30767890-30767912 GGGGTTCCTGCTATGGGCTGGGG - Intergenic
1067526253 10:47040458-47040480 GCAGTGACTGCTCTCCGCTGAGG + Intergenic
1067686927 10:48471278-48471300 AGAGTGACTGCTTGGTGCTGGGG - Intronic
1067739289 10:48882203-48882225 GGGGAGCCTGCTCTGGGGTGGGG + Intronic
1068596204 10:58905334-58905356 GAGGTGATTGCTCTGTGCTGTGG - Intergenic
1068879472 10:62033104-62033126 TGAGTTCCTGCAATGTGCTGAGG + Intronic
1069609184 10:69761281-69761303 TCAGTGCCTGCTGTGTGCAGAGG + Intergenic
1069822733 10:71237579-71237601 GGATTGCCAGCTTTGTGCTGAGG - Intronic
1070502664 10:77086411-77086433 GGAGTCCTGACTCTGTGCTGAGG - Intronic
1070702680 10:78614992-78615014 AGAGCACCTGCTGTGTGCTGGGG + Intergenic
1071571219 10:86698528-86698550 TGCTTGCCTGCTCTGTACTGTGG + Intronic
1071973178 10:90929235-90929257 TGAGTGCCTACTATGTGCTGGGG - Intergenic
1072430322 10:95365464-95365486 GGAGAGCTTGCTCGGAGCTGTGG + Intronic
1073440879 10:103552043-103552065 TGAGTGCCTGCTCCGGGCAGGGG + Intronic
1074626493 10:115194131-115194153 GGAGAGCATTCTATGTGCTGAGG + Intronic
1074926854 10:118082110-118082132 TGAGTGCCTGCTGTGTGCCAGGG + Intergenic
1076135041 10:128039897-128039919 GCAGTGACTGCTTGGTGCTGTGG - Intronic
1076728963 10:132428957-132428979 AGGGTGCCTGCTCTGAGCTAAGG - Intergenic
1077130706 11:971105-971127 GGAGTGCCTGTGGTGTGTTGGGG + Intronic
1077469142 11:2748637-2748659 GGAGTCCCTGCTGTGGGCTCTGG - Intronic
1078294705 11:10056689-10056711 GGAGGTCCTGCTCAGTGATGAGG - Intronic
1078425291 11:11244788-11244810 GGAGCTCCTGCTCTGTGCCAGGG - Intergenic
1078549257 11:12269141-12269163 GGATTGTTTGCTCAGTGCTGGGG + Intergenic
1078993136 11:16669710-16669732 GAGGTGGTTGCTCTGTGCTGGGG - Intronic
1079081796 11:17418659-17418681 GGAGAGCTTACTGTGTGCTGGGG - Intronic
1079622159 11:22567655-22567677 AAGGTGGCTGCTCTGTGCTGGGG + Intergenic
1079869521 11:25780588-25780610 GGGGTGGCTACACTGTGCTGGGG - Intergenic
1080298246 11:30754537-30754559 TGAGGGCCTGCTCTGTGCCAGGG - Intergenic
1080689469 11:34544443-34544465 GCAGTGCCTGTGCCGTGCTGGGG + Intergenic
1080839365 11:35970072-35970094 GGAGTGCTTACTGTGTGCTCCGG + Intronic
1082938716 11:58680826-58680848 GTAGTGACTGCATTGTGCTGGGG - Intronic
1083920415 11:65779217-65779239 ACTGTGCCTGCTCTGTGCCGAGG - Exonic
1084042446 11:66550078-66550100 GGAGTATCTGCTTTGTGGTGTGG + Intronic
1084605144 11:70167990-70168012 GAGACGCCTGCTCTGTGCTGGGG - Intronic
1084677942 11:70647492-70647514 TGAGTCCCCACTCTGTGCTGTGG + Intronic
1085031265 11:73272263-73272285 TGCTTGCCAGCTCTGTGCTGTGG + Intronic
1085188107 11:74593239-74593261 TGAGTGCCTGCTGTGTGCCAAGG + Intronic
1085253566 11:75159478-75159500 TGAGACCCTGCCCTGTGCTGTGG - Intronic
1085802504 11:79603394-79603416 GAAGTTCCTGCTCTGTGGAGGGG + Intergenic
1085880696 11:80463593-80463615 GAATTGGTTGCTCTGTGCTGGGG - Intergenic
1086150119 11:83599706-83599728 AGAGTGCCTGCCCTGTGGTTGGG - Intronic
1086922170 11:92599756-92599778 GGAGTACCTCCTCTCTGGTGAGG - Intronic
1087011085 11:93514656-93514678 TGAGTGCCTCCTCTGTGCAAGGG - Intronic
1088533200 11:110832726-110832748 GGAGTGGCTGCTTTGTCGTGGGG + Intergenic
1089908560 11:122071867-122071889 GGAGTGCATGCTCTGTGGCGAGG - Intergenic
1090796776 11:130142092-130142114 TGAGGGCCTGCTCTGCACTGTGG + Intronic
1091364509 11:135006606-135006628 GGAGCGCCTTACCTGTGCTGAGG + Intergenic
1092169366 12:6363652-6363674 AGAGCGTCTGCTCTGTGATGCGG + Exonic
1092579197 12:9820565-9820587 GAGGTGGGTGCTCTGTGCTGAGG - Intergenic
1092639872 12:10494018-10494040 TGAGTGCCTGCTCCTTCCTGTGG - Intergenic
1092915605 12:13186425-13186447 TGAGTGCTTGCCCTGTGCTGCGG - Intergenic
1092994513 12:13935991-13936013 ACAGTGGCTGCACTGTGCTGAGG + Intronic
1093388114 12:18583587-18583609 GTGGTGGGTGCTCTGTGCTGGGG - Intronic
1093528663 12:20135490-20135512 GAGGTGGGTGCTCTGTGCTGGGG + Intergenic
1093690332 12:22102333-22102355 GGGGTTGTTGCTCTGTGCTGGGG + Intronic
1095866961 12:46983058-46983080 GGAGTGCCTGCTCTGAAGTGGGG + Intergenic
1096187470 12:49591118-49591140 GGGTTCCCTGCCCTGTGCTGGGG - Intronic
1097905500 12:64915150-64915172 TGAGTGCCTGTTCCGTGCTAGGG + Intergenic
1100185144 12:92130454-92130476 GGAGTGCCTACTGTGTGCAGGGG - Intronic
1100197167 12:92260122-92260144 GTAGTACCTTCTCTGTGGTGTGG - Intergenic
1101754396 12:107609646-107609668 GGACTGCCTGCTCTAGGCTGGGG - Intronic
1101950057 12:109167719-109167741 TGAGCTCCTGCTCTGTGCTGGGG + Intronic
1102391221 12:112550286-112550308 GGAATGCCTGCTGTGTGCCACGG - Intergenic
1103009179 12:117444894-117444916 TGAACGCCTGCTCTGTGCTATGG - Intronic
1103421576 12:120789088-120789110 TCAGTGCCTGCTCTGAGCAGTGG - Intronic
1103822584 12:123710977-123710999 TGAGTGGCTACTATGTGCTGGGG + Intergenic
1103954956 12:124570936-124570958 TGAGTGCCCACTATGTGCTGAGG - Intergenic
1106674270 13:31941242-31941264 AGAATGACTGCTCTGTGCAGAGG - Intergenic
1106758496 13:32845389-32845411 TGTGTGCAGGCTCTGTGCTGAGG + Intergenic
1107608475 13:42087084-42087106 GTTGTGCCTACTCTGTTCTGAGG - Intronic
1112578981 13:100662284-100662306 GCGGTGCCTGCACTCTGCTGGGG - Intronic
1113294128 13:108939064-108939086 GGAGAGCCTGCTCTGGAGTGGGG - Intronic
1114675995 14:24440728-24440750 GGAATGTCTTCTCTGGGCTGGGG - Exonic
1114988768 14:28262634-28262656 GAGGTGGTTGCTCTGTGCTGAGG - Intergenic
1115399805 14:32943557-32943579 GGATCCCCTGCTCTGTGGTGAGG + Intronic
1116353502 14:43897252-43897274 GGAATGCCTACTATGTGCCGTGG + Intergenic
1116781423 14:49241433-49241455 GGAGTGGCTGCTCTGGAGTGGGG - Intergenic
1117203152 14:53413039-53413061 AGAGAGCCTGCCCTCTGCTGGGG - Intergenic
1118076389 14:62303710-62303732 GGAGTGCCTGCTATGTGCTAGGG - Intergenic
1118614987 14:67569137-67569159 GGAGAGCCGGATCTATGCTGTGG + Exonic
1119014257 14:71032912-71032934 TGAATGCCTGCTCAGTGCTGTGG + Intronic
1119656967 14:76424179-76424201 GGAGGGCTTGCTCTATGCTCGGG - Intronic
1120435492 14:84476247-84476269 GGTGTGCGTGCTATGTTCTGTGG + Intergenic
1121286559 14:92740612-92740634 TGAGGGCCTGCTCTGTGCTCGGG - Intronic
1121685221 14:95830757-95830779 GGCAAGCCTCCTCTGTGCTGAGG + Intergenic
1121731336 14:96189257-96189279 TGGGTGGCAGCTCTGTGCTGGGG + Intergenic
1121821378 14:96970642-96970664 GGAGTGCCTGCTATATGCCAAGG - Intergenic
1122069085 14:99194220-99194242 GCAGCACTTGCTCTGTGCTGGGG - Intronic
1122788949 14:104176390-104176412 GGAGTGGATGGTCTGGGCTGCGG - Exonic
1123016274 14:105377150-105377172 GGGGTGCAAGCTCTGGGCTGGGG + Intronic
1124235148 15:27983773-27983795 GGAGGGCCTGCCCTGCCCTGGGG - Intronic
1124351091 15:28956147-28956169 GGGCAGCCTGCTATGTGCTGTGG + Intronic
1124359636 15:29026252-29026274 TGAGTGTGTGCTCTGAGCTGGGG - Intronic
1124638054 15:31377355-31377377 GTAGTGCCTCCTTTCTGCTGAGG - Exonic
1124707461 15:31977706-31977728 GGAGTCCCTCCTCTCTACTGGGG + Intergenic
1124795576 15:32775035-32775057 GGTGTGCCTGCTCTGGGAGGAGG + Intronic
1125004407 15:34800918-34800940 TGAGTGCTTGATCTTTGCTGGGG - Intergenic
1125333596 15:38605997-38606019 GGAGTGGGTGGTCTGTGCTCCGG + Intergenic
1125698315 15:41657999-41658021 TGAGTGCCTACTATATGCTGAGG - Intronic
1125785526 15:42313655-42313677 GGGGTCCCTGCTCTGTGATATGG - Intronic
1126740177 15:51769402-51769424 TGAGTGCCTCCTCTGTGCAGAGG + Intronic
1127386881 15:58474196-58474218 GAAGTGCATCCTCTCTGCTGGGG + Intronic
1128053280 15:64681995-64682017 GCAGTGGCTTCTCTGGGCTGAGG - Exonic
1128638525 15:69318524-69318546 TGAGTGCGTGCTCAGTGCTGGGG - Intronic
1129192043 15:73942921-73942943 GTACTCCCTGCGCTGTGCTGCGG + Exonic
1129263256 15:74380818-74380840 GGATTGCCAGCTCTGTGCCTAGG - Intergenic
1129275273 15:74441314-74441336 GGAGTGCTTCCTGTATGCTGGGG - Intergenic
1130235530 15:82130025-82130047 GGAGTGGCCGCTCAGTGCAGAGG + Intergenic
1130969205 15:88718879-88718901 AGGTTCCCTGCTCTGTGCTGTGG + Intergenic
1132240282 15:100252555-100252577 GGAGTGGCTGCTCTTTCCTGGGG - Intronic
1132493880 16:250695-250717 GGAATGACTGCTATGGGCTGAGG - Intronic
1132611166 16:817004-817026 GGGGTGCCTGATGTGGGCTGAGG - Intergenic
1132637429 16:958964-958986 GGAGTGCCCTCGCTGTGCCGGGG + Intronic
1132667551 16:1089142-1089164 AGGCTGCCTGTTCTGTGCTGGGG - Intergenic
1133019809 16:2962478-2962500 GAAGTGGGTGCTCAGTGCTGAGG - Intergenic
1133131323 16:3677692-3677714 GGAGTGTCTGCTCTCTGGAGGGG - Intronic
1133269170 16:4602255-4602277 GGAGTGCCTTCTGTGTGGGGAGG + Intergenic
1135716915 16:24778921-24778943 GGAGTACCTGCTGTGAGCTAAGG + Intronic
1135864840 16:26091869-26091891 TGAGCGCCTGCTCTGTACTGAGG + Intronic
1135937161 16:26791307-26791329 GGTTTCCCTTCTCTGTGCTGTGG + Intergenic
1137559312 16:49492722-49492744 GGCATGCGTGCTCTGTGCCGTGG + Intronic
1137684020 16:50373494-50373516 TGTGTGCCTACTATGTGCTGGGG + Intergenic
1137804103 16:51287473-51287495 AGAGGGCGTGCGCTGTGCTGGGG - Intergenic
1138575864 16:57906958-57906980 GGAGTGCTTGCTGTGTGCCAGGG - Intronic
1141503749 16:84461717-84461739 GGAGTGCTTGCTCTGTCTTCAGG - Exonic
1141747683 16:85936888-85936910 CGAGTGCCTGCTCTGTGCCCCGG - Intergenic
1141900643 16:86988251-86988273 TGTGTCCCTGCTCTTTGCTGGGG - Intergenic
1142201292 16:88762265-88762287 TGAGTGCCTGCTGTGTGCAAAGG - Intronic
1142307843 16:89295501-89295523 GGGGTCTCAGCTCTGTGCTGAGG - Intronic
1142958366 17:3535905-3535927 GGAGCGCCTGCTCCGGGCTCCGG + Intronic
1142965801 17:3580269-3580291 TGAGGGCCTGCTCTGTGCCAGGG - Intronic
1143516076 17:7419862-7419884 GTTGTGCCTGCTCTGTTGTGGGG + Intergenic
1143684198 17:8500798-8500820 GGAGGCCCTGCCGTGTGCTGTGG - Intronic
1144094202 17:11884964-11884986 TGAGTACCTGCTGTGTGCCGAGG + Intronic
1144177087 17:12717899-12717921 AGGGTGCCACCTCTGTGCTGGGG + Intronic
1147051274 17:37796703-37796725 GGACTGCAAGCTCTGTGCTGGGG + Intergenic
1147307829 17:39575863-39575885 GGAGAGCCTGCTGTGTGCATTGG - Intergenic
1147336475 17:39729486-39729508 TGGGTTCCTGCTCTGTTCTGGGG - Exonic
1148352315 17:46949967-46949989 GAAGTGCCTACTGTGTGCAGAGG - Intronic
1148682198 17:49480889-49480911 GAAGTGCTTTCTTTGTGCTGGGG - Intergenic
1150833170 17:68541528-68541550 GGAGTACCTGCTATGTGCCAGGG + Intronic
1151439648 17:74119952-74119974 GGTGTGGCTGCTGTGTCCTGCGG - Intergenic
1151927180 17:77206853-77206875 GGAGTGCATGGTATGTCCTGAGG + Exonic
1152359103 17:79822096-79822118 GGAGTGCCTCCTTGGGGCTGGGG - Intergenic
1152624562 17:81382300-81382322 GGACTGCCTGGTGTGTGATGGGG - Intergenic
1152767611 17:82149606-82149628 TGAGGTCCTGCTCTGTGCAGTGG + Intronic
1152798115 17:82317790-82317812 GGAGTCCCTTCTCTGTCCTCTGG - Intergenic
1153874825 18:9360019-9360041 GGAGTGCATGCTGTGTCTTGGGG + Exonic
1153998210 18:10460662-10460684 TGAGTGCCTACTATGTGCTCAGG - Intronic
1154454826 18:14511042-14511064 AGGGTGGCTGTTCTGTGCTGAGG + Intronic
1155679882 18:28475836-28475858 GCAGTTCCTGCTTTTTGCTGTGG - Intergenic
1155870113 18:31016661-31016683 GCTGTGCCTGCTGTCTGCTGAGG - Intronic
1156896860 18:42256325-42256347 GGAGTGATTGCTCAGTGCAGGGG + Intergenic
1157444058 18:47731622-47731644 GGAGTGCTTGCTGTAGGCTGGGG - Intergenic
1158543821 18:58379146-58379168 GCAGAGCCTGCTCTGTGGGGTGG - Intronic
1160240535 18:77119396-77119418 CATGTGCCTGCTGTGTGCTGTGG - Intronic
1160586654 18:79916985-79917007 CGACTGCCTGCTCGGTGCTGGGG + Intronic
1160691286 19:461568-461590 GGAGTGCCGGCTCGGGGGTGGGG + Intergenic
1160725095 19:614346-614368 TGAGCACCTGCTGTGTGCTGGGG + Intronic
1161306989 19:3573804-3573826 AGAGTCCCTGCGCTGAGCTGGGG + Intronic
1161593149 19:5137713-5137735 GGGGAGCCTGCCCTGGGCTGAGG + Intronic
1161730685 19:5958881-5958903 TGAATGCCTGCTGTGGGCTGCGG + Intronic
1163366278 19:16877748-16877770 TAGGTGCCTGCTGTGTGCTGAGG + Intronic
1163578075 19:18122307-18122329 TGTGTGTATGCTCTGTGCTGCGG + Intronic
1164292820 19:23882525-23882547 GGAGTGCCTGGTCTGTCCCACGG + Intergenic
1164526819 19:29019009-29019031 GGAGTGCCTGCGGTTTCCTGGGG + Intergenic
1164548415 19:29187882-29187904 AGAGAGCCAGCTCTGAGCTGAGG - Intergenic
1164739724 19:30567041-30567063 GGAGTGGCTTCTCTGGGCAGTGG + Intronic
1165136893 19:33675213-33675235 TGAGGGGATGCTCTGTGCTGGGG - Intronic
1166224525 19:41386733-41386755 GGAGAGACTGGTCGGTGCTGGGG + Intronic
1166229058 19:41414997-41415019 TGAGCGCTTACTCTGTGCTGAGG - Intronic
1166283580 19:41810430-41810452 GGTGGGTCTGTTCTGTGCTGGGG - Intronic
1166774575 19:45304595-45304617 TGAGAGCATCCTCTGTGCTGGGG + Intronic
1167119503 19:47508085-47508107 GCAGAGGCTGCTCTCTGCTGGGG + Intronic
1167489075 19:49781541-49781563 AGGGTGTGTGCTCTGTGCTGTGG + Intronic
1168688752 19:58364128-58364150 GGATGGACTGCCCTGTGCTGTGG - Intergenic
925079977 2:1056238-1056260 GGAGAGGCCGCACTGTGCTGTGG + Intronic
925132618 2:1504225-1504247 GGGGCGTCTGCGCTGTGCTGGGG + Intronic
925331438 2:3061928-3061950 TGAGTGCCTACTCAGTGCAGAGG + Intergenic
925355736 2:3239731-3239753 TGAGTGTCTGCACCGTGCTGAGG - Intronic
925646800 2:6044472-6044494 GAGGTGACTGCTCTGTGCTGGGG - Intergenic
925768283 2:7258888-7258910 GCAGTGTCTGCTCTGGGATGGGG + Intergenic
926200102 2:10788924-10788946 GGAGCACCAGCTCTGTGTTGTGG - Exonic
927490226 2:23516485-23516507 GGAGGGTCTGCTGTGTGCAGGGG - Intronic
927854576 2:26519855-26519877 GGAGTGCTGGCTGTGTGCTGGGG - Intronic
928412643 2:31066667-31066689 GGGCTGCCTGCTCTGTGCTCCGG - Intronic
929568579 2:43005885-43005907 AGCCTGCCTGCTCTGTGCCGTGG - Intergenic
929881613 2:45841871-45841893 TGCTTGCCTGCTCTTTGCTGGGG + Intronic
929904840 2:46036681-46036703 GGAGTGTCCTCTCTGGGCTGGGG + Intronic
930260644 2:49142128-49142150 TGAGTGTTTACTCTGTGCTGGGG + Intronic
930455692 2:51605423-51605445 GGAGTGGGTGCACTGTGCTAGGG + Intergenic
931131371 2:59340026-59340048 GGGTTGTCTGCTCTATGCTGTGG - Intergenic
931640533 2:64377226-64377248 GGGGTGTCAGCTCTTTGCTGAGG - Intergenic
932278753 2:70471684-70471706 TGAGTGCTTGCTAAGTGCTGGGG + Intronic
934099731 2:88641331-88641353 GGAGTGGTTGCTCAGGGCTGGGG - Intergenic
934750144 2:96788833-96788855 GGAGTCCCTGGTCTGCTCTGGGG + Intronic
936349784 2:111703863-111703885 GGAGTGCCTGTGCTTTGCAGAGG - Intergenic
937226705 2:120374540-120374562 GGATGGGCTACTCTGTGCTGGGG - Intergenic
937303058 2:120854998-120855020 GGGGAGCCTGCTCTGTGTGGAGG - Intronic
940722507 2:157297749-157297771 GGAGAGCCTGCTTTGTGCTTAGG - Intronic
941770171 2:169336660-169336682 GGAGTGTTTGCTCTGTGCAGTGG - Intronic
942145497 2:173022596-173022618 GCAGGGTCTGCTCTGTGCTTGGG + Intronic
943912172 2:193583457-193583479 GGAGTGCTTGTTCTGTAGTGGGG + Intergenic
944512705 2:200480242-200480264 GGAGTGTTTGCTCTGTGCTCAGG - Exonic
944880101 2:204004186-204004208 GGAGCTCCTGCTTTGTGCAGAGG - Intergenic
945037238 2:205714876-205714898 GGAGTGGCTGGTGTGAGCTGGGG - Intronic
945286895 2:208091702-208091724 GGAGTGTCTGCTACATGCTGTGG + Intergenic
946427318 2:219606228-219606250 GCAGTGGCTGCTCGGTGCTCAGG - Exonic
947623512 2:231605190-231605212 TGAGCGCCTACTGTGTGCTGAGG - Intergenic
947646273 2:231743485-231743507 AGAGTGCCTGCAATGTGATGAGG + Intronic
948133946 2:235621701-235621723 GGAGTGCCTGCTCTCTGCCCTGG + Intronic
948183367 2:236000558-236000580 GGCGCACCTGCTCTGTGCAGAGG + Intronic
948671409 2:239571032-239571054 GCACTGCCTGCTCTGTGCCTGGG - Intergenic
948690629 2:239701230-239701252 GCAGTGACTGCTGTGTGGTGTGG + Intergenic
948779503 2:240310175-240310197 GAAGTCCCTACTCTGTGCTTGGG - Intergenic
1168954539 20:1825889-1825911 GGAGTCCCTGCCCTGTGCCTTGG - Intergenic
1170629467 20:18055666-18055688 GGAGAGCCTGGGCTTTGCTGTGG - Intronic
1171482666 20:25465643-25465665 GCCGTCCCTGCTCTGTGATGTGG - Intronic
1173358548 20:42318678-42318700 GGAGTCCCTGCTTTCTTCTGAGG + Intronic
1173457014 20:43211010-43211032 GGAGTGCTTGCTTTGTGCCAGGG + Intergenic
1173549494 20:43922838-43922860 TGAGTGCCTACTGGGTGCTGGGG + Intronic
1173866895 20:46317981-46318003 GCTGTGCCTGCCCTGGGCTGTGG + Intergenic
1174479595 20:50821455-50821477 GGTATGTCTGCTGTGTGCTGTGG + Intronic
1174519919 20:51121513-51121535 GGAGAGACTGTTCTGTGCTAGGG - Intergenic
1174552240 20:51370420-51370442 AGAGTGCCTGCTCTGTGTCATGG + Intergenic
1174796517 20:53527215-53527237 AGAGTGGCTGATGTGTGCTGGGG - Intergenic
1175186088 20:57180383-57180405 GGAGAGGATGCTCTGGGCTGTGG - Intronic
1175332488 20:58175094-58175116 GGCCTGCCTGCTGTTTGCTGTGG - Intergenic
1176307742 21:5133012-5133034 GGTGTGGCTGCCCTGAGCTGTGG - Intronic
1176819339 21:13642266-13642288 AGGGTGGCTGTTCTGTGCTGAGG - Intergenic
1178199925 21:30391665-30391687 GGAGTGCCTACTATATGCTAGGG + Intronic
1178796575 21:35750437-35750459 GGAGAGAGTGCTGTGTGCTGAGG - Intronic
1179210775 21:39322725-39322747 GGGGTGACTGCTGTGTTCTGCGG - Intergenic
1179258353 21:39737311-39737333 TGAGTGCTTGCTCGGTGGTGGGG - Intergenic
1179318579 21:40268969-40268991 GCAGTGCATGCTTTGGGCTGGGG - Intronic
1179588379 21:42388658-42388680 AGAGTCACTGCTCTGTGATGGGG - Intronic
1179849319 21:44129018-44129040 GGTGTGGCTGCCCTGAGCTGTGG + Intronic
1180173778 21:46077722-46077744 CGGGTGCCTGCTGTGTTCTGGGG - Intergenic
1181689904 22:24553453-24553475 TAAGTGCCTACTCTGGGCTGAGG - Intronic
1181696385 22:24594863-24594885 GGGCTGCCTGCTCTGGGCAGGGG - Intronic
1182875921 22:33690923-33690945 TGAGCGCCTGCTCTGTGTTGTGG - Intronic
1183090429 22:35518651-35518673 GGAGAGCCCGCACTGTCCTGGGG + Intergenic
1183344943 22:37302271-37302293 TGAGTACATACTCTGTGCTGTGG - Intronic
1184173228 22:42771723-42771745 GGAGAGCCTGCTCCAGGCTGGGG - Intergenic
1184189649 22:42886174-42886196 TGAGTACCTGGCCTGTGCTGGGG - Intronic
1184223399 22:43115050-43115072 TGGGTCCCTGCTCTGTTCTGGGG + Intronic
1184348163 22:43925548-43925570 GGAGTGACTGTTCAGTGGTGAGG + Intronic
1184721131 22:46314127-46314149 GGAGGGCGTGCTGTGTGCGGTGG + Intronic
1184859650 22:47165813-47165835 GGAGTGCCAGCTGTCTGCAGTGG - Intronic
1185031353 22:48444872-48444894 TGAGCACCTGCTCTGTGCTGGGG + Intergenic
1185171393 22:49296650-49296672 GGAGTCCCTGGCATGTGCTGGGG - Intergenic
1185272314 22:49935148-49935170 GGAGTCCCTGCTCGGAGCGGGGG + Intergenic
1203280462 22_KI270734v1_random:128094-128116 GGAGTGACTGGTGTGTGTTGGGG - Intergenic
949111996 3:272240-272262 GGGGTGCCTACTCTGTGCAGGGG + Intronic
949858063 3:8480283-8480305 TGTGGGCCTGCTGTGTGCTGTGG - Intergenic
950262402 3:11552725-11552747 GCAGTGCCTGAGCTGTGCAGGGG - Intronic
950293800 3:11810225-11810247 TGAGTACCTACTGTGTGCTGGGG - Intronic
950575001 3:13827113-13827135 GGGGTCCCAGCTCTGTGCTCTGG - Intronic
950995749 3:17494439-17494461 GGAGTGGGTGCACTGTGCTGGGG + Intronic
952342328 3:32456747-32456769 GGAGAGCCAGCTGTGTGCAGAGG - Intronic
953410323 3:42687218-42687240 GGAGTGCCAGGTCTGAGTTGGGG + Intronic
953607395 3:44420694-44420716 GGAGGGCCAGGTCTGTGATGGGG + Intergenic
954400154 3:50315253-50315275 GGAGAGCCAGCACTGTCCTGTGG - Intergenic
954426921 3:50448147-50448169 GGAATGCCTGCCCTGTGCCAGGG - Intronic
954457148 3:50605944-50605966 AGAGGGCTTGCTCTGTGCAGTGG - Intergenic
954652755 3:52175425-52175447 GGAATGCCAGCTGTGTGCCGGGG + Intergenic
954866590 3:53735149-53735171 GGTGTGTCACCTCTGTGCTGGGG - Intronic
954991986 3:54849407-54849429 TGAGTCCCTGCTCTGTGCTGAGG - Intronic
955056289 3:55458642-55458664 GGAGTGCCTACTCTGTGTCAGGG + Intergenic
955421441 3:58742428-58742450 GGAGTGCCTGCTCTCTGCCCCGG + Exonic
956027310 3:64996996-64997018 TGAGTGCCTCCTCTGTGCCAGGG - Intergenic
959205867 3:103305519-103305541 GCATTGCCTACTCTGTGCTAAGG - Intergenic
960218938 3:115079890-115079912 AGAGTGCCTACAATGTGCTGGGG + Intronic
961589666 3:127967953-127967975 AGCATGCCTGCTCTTTGCTGTGG - Intronic
961684501 3:128620361-128620383 AGGGTGCCTGCACTTTGCTGTGG - Exonic
964761186 3:160136301-160136323 GGAGTCCTTGCTCTTTGTTGGGG + Intergenic
965058340 3:163750003-163750025 GGGGTGGTTGCACTGTGCTGGGG - Intergenic
965531138 3:169771999-169772021 GGAGTGCCTGGTTTCTACTGCGG + Intergenic
966151944 3:176875244-176875266 AGAGTTGCTGCACTGTGCTGGGG + Intergenic
966280550 3:178221527-178221549 TGAGTGCAGGCTCTGTGCTGGGG - Intergenic
967220832 3:187246633-187246655 GTGGTCCCAGCTCTGTGCTGTGG - Intronic
968489296 4:881462-881484 GGAGAGCCTGCTGCGCGCTGAGG + Intronic
968588680 4:1446825-1446847 CCAGCACCTGCTCTGTGCTGGGG - Intergenic
968619689 4:1598256-1598278 GGACTGCCTGCTCTGATCCGAGG + Intergenic
968891594 4:3372235-3372257 GGGGTGGCCGCTCTGGGCTGGGG + Intronic
969306750 4:6330192-6330214 TGAGTGCCAGCCCTCTGCTGAGG + Intronic
969681794 4:8647157-8647179 GGCGGGCCTGCCCTGGGCTGTGG + Intergenic
970583484 4:17493972-17493994 TGAGTGCCTGTCCTGTGCTAAGG - Intronic
971529771 4:27672031-27672053 GGAGTGCCTGCATAGTGCTATGG + Intergenic
971611537 4:28731895-28731917 GGAGCGCCTGCTCTGGATTGGGG - Intergenic
973220374 4:47719348-47719370 GGAGAGCCTGCTATGTGCTGGGG - Intronic
974312826 4:60234330-60234352 GGATTGCCTGCTCTGGTTTGGGG - Intergenic
974503912 4:62742641-62742663 AGAGTGCTTGTGCTGTGCTGAGG - Intergenic
974609219 4:64193370-64193392 GGATTGCCTGTTCTGTGCTGTGG - Intergenic
976092364 4:81471706-81471728 GGAGTTCCCGCTCCGGGCTGTGG + Intronic
976748635 4:88431331-88431353 GGGGTGCCTTTTCTGTTCTGGGG - Intronic
977039844 4:92002278-92002300 GGAGTGGGTGCACTGCGCTGGGG - Intergenic
978782057 4:112566726-112566748 GGAGGGCCTGTTTTGTACTGGGG + Intronic
979742442 4:124168113-124168135 GGAGGGAGTGCGCTGTGCTGGGG - Intergenic
980517008 4:133877199-133877221 GAGGTGGGTGCTCTGTGCTGGGG + Intergenic
980689847 4:136281279-136281301 GGGGTTCCCGCTCTGTGCTTTGG - Intergenic
981327317 4:143464706-143464728 GGTGAGACAGCTCTGTGCTGTGG - Intronic
982079919 4:151779096-151779118 GGGCTGCCAGCTCTATGCTGTGG + Intergenic
983249348 4:165327324-165327346 TGAGAGCCTGCGCTGTGCGGGGG - Intergenic
983835739 4:172381401-172381423 GGAGTGACTGCTCTTGGGTGTGG - Intronic
984096540 4:175442085-175442107 GGGGCACCTGCTCTGTACTGAGG + Intergenic
985377213 4:189354453-189354475 GAAGTGCCTCCTCTGTGTAGGGG + Intergenic
985647005 5:1089705-1089727 AGGCTGCCTGCTCCGTGCTGGGG - Intronic
986006211 5:3671337-3671359 TGTGTGCCAGCACTGTGCTGAGG + Intergenic
986440740 5:7779544-7779566 GGAGTGCTGGCCCTTTGCTGTGG - Intronic
990760007 5:59118421-59118443 GGAGTACCTTCTATATGCTGGGG - Intronic
991028851 5:62061452-62061474 GCAGTGACTGAGCTGTGCTGTGG - Intergenic
992419898 5:76592685-76592707 GGAGTGCCTGCTCTGTGCAGGGG - Intronic
992571737 5:78065781-78065803 GGAGGGGTTGCTCTGTGCGGGGG - Intronic
992895310 5:81240228-81240250 GGAGTGACACCTGTGTGCTGTGG + Intronic
992896900 5:81253488-81253510 GGAGAGGCTGCTCTGTGGAGGGG - Intronic
993123666 5:83805786-83805808 TGAGAGCTTGCTCAGTGCTGTGG - Intergenic
993443321 5:87981351-87981373 GGAGTGCTTGCTCTGGAGTGAGG - Intergenic
993679330 5:90856073-90856095 GGAGGGCCATCTCTGTACTGAGG + Intronic
994366818 5:98927431-98927453 GGAGTGAATTCTCTTTGCTGAGG - Intronic
997660830 5:135588435-135588457 TGAGTGCCTGCTCTGTGCCGGGG + Intergenic
997830434 5:137145032-137145054 TGGGCGCCTGCTCTGTGCTAGGG - Intronic
998186212 5:139981829-139981851 TGGGAGCTTGCTCTGTGCTGGGG - Intronic
998856887 5:146402288-146402310 GCAGTGCTTACTCTGTGCTATGG - Intergenic
999198022 5:149796009-149796031 AGAGTGCCTACTGTGTGCCGAGG + Intronic
999217061 5:149944193-149944215 AGAGTACCTCCTCTGTGTTGGGG + Exonic
999343011 5:150789651-150789673 GGCATGCCTGCTCAGTGCAGCGG - Intronic
999474448 5:151885584-151885606 GGAGTGGGTGCTCTGGGCAGTGG + Intronic
1000027960 5:157376468-157376490 TGAGTGCTTGCTCTGTGATCTGG - Intronic
1001453189 5:171841808-171841830 TGAGCACCTTCTCTGTGCTGGGG - Intergenic
1001579874 5:172791306-172791328 TGAGTCCCTCCTCTGAGCTGAGG - Intergenic
1002171881 5:177379273-177379295 GCCTTGCCTGCTCTGTGCTGGGG + Intronic
1002900115 6:1404199-1404221 GGAGATGCTGCCCTGTGCTGTGG - Intergenic
1002951050 6:1811715-1811737 GGAGTGCCTACTGTGTGCAGTGG - Intronic
1005348513 6:24912228-24912250 GGAGTGCCTGCTCTGTGCTGGGG - Intronic
1006574200 6:35032009-35032031 GGAGAGCCTACTGTGTGCTTAGG + Intronic
1006910350 6:37559394-37559416 GCAGTCCCTGCCCTGTGCAGGGG - Intergenic
1007291663 6:40791858-40791880 GAACTGCCTACTCGGTGCTGAGG + Intergenic
1007426426 6:41748994-41749016 GGAGTGCCTTCCCTGGGTTGAGG + Intronic
1008439339 6:51514569-51514591 GGTGTCCCTCCTCAGTGCTGAGG - Intergenic
1008458390 6:51738833-51738855 GGAGTGCCTGCCCTGAGCAGAGG - Intronic
1010019094 6:71139166-71139188 GAGGTGGTTGCTCTGTGCTGGGG - Intergenic
1011370730 6:86634091-86634113 AGAGTACCTGTGCTGTGCTGGGG + Intergenic
1012869423 6:104656475-104656497 GGAGGACCTGCTCTGTGAGGAGG - Intergenic
1013420012 6:109959074-109959096 AGAGTGACTGTACTGTGCTGAGG + Intergenic
1015488550 6:133799794-133799816 GAAGTGAATGCTCTCTGCTGGGG + Intergenic
1015617071 6:135088563-135088585 TGAGTGCCTTCTAGGTGCTGTGG - Intronic
1016669227 6:146682029-146682051 TGAATGCCTACTCTGTGCTAAGG - Intronic
1017597945 6:156049644-156049666 TGAGTGCGTGGTGTGTGCTGGGG + Intergenic
1018061257 6:160091617-160091639 AGAGTGCTAGCTCCGTGCTGTGG - Intronic
1018557722 6:165065744-165065766 GGAGTCCCAGCTCCCTGCTGAGG - Intergenic
1018633242 6:165838576-165838598 GTAGTGGCTGCTCAGGGCTGGGG - Intronic
1018641039 6:165904257-165904279 GGAGGGGCTGGTCTGTGTTGGGG + Intronic
1019354243 7:570574-570596 AGGGTGACTGCCCTGTGCTGTGG + Intronic
1019569618 7:1704802-1704824 GGCCTGCCTGCTGTATGCTGGGG + Intronic
1019920988 7:4163223-4163245 GGAGTGCCTGCTGGGAGCTGGGG + Intronic
1022384792 7:29890790-29890812 CGAGGGCCTGCCCTGTGCTCAGG + Intronic
1022384821 7:29890886-29890908 TGAGGGCCTGCCCTGTGCTCAGG + Intronic
1022384853 7:29890982-29891004 CGAGGGCCTGCCCTGTGCTCAGG + Intronic
1022384864 7:29891014-29891036 CGAGGGCCTGCCCTGTGCTCAGG + Intronic
1022384923 7:29891206-29891228 CGAGGGCCTGCCCTGTGCTCAGG + Intronic
1022384934 7:29891238-29891260 CGAGGGCCTGCCCTGTGCTCAGG + Intronic
1022384945 7:29891270-29891292 CGAGGGCCTGCCCTGTGCTCAGG + Intronic
1022798680 7:33753976-33753998 TGAGTGCCTACTATGTGCTGAGG - Intergenic
1022807561 7:33837860-33837882 GGAGCACGTGCTCTGTGGTGGGG + Intergenic
1022877820 7:34553019-34553041 GCAGTGGCTGCTCAGGGCTGGGG - Intergenic
1023092977 7:36633513-36633535 GGAGTGCCCGAGCAGTGCTGTGG + Intronic
1023872799 7:44271894-44271916 GTAGTGACTTCTGTGTGCTGAGG + Intronic
1023880950 7:44321085-44321107 GGAGTGCCTGGTGTGCTCTGGGG + Intronic
1024034341 7:45494980-45495002 GGAGGGGGTGCGCTGTGCTGGGG + Intergenic
1024270572 7:47638495-47638517 GGAGTCCCTGATCTCTGCTCTGG + Intergenic
1025986306 7:66455565-66455587 GAAGAGCTTTCTCTGTGCTGTGG - Intergenic
1027124521 7:75546816-75546838 GGAGTGGCTGCTCTGTACTCAGG + Intronic
1028626991 7:92888882-92888904 GGAGTGGGTGTGCTGTGCTGGGG + Intergenic
1029650101 7:101885679-101885701 GCCATGCCTGCTCTGTGCTCGGG - Intronic
1031859478 7:126961602-126961624 AGAGCACCTGCTCTGTGGTGAGG - Intronic
1032541228 7:132704774-132704796 GGAGCACCTGCTATGTGCTAGGG - Intronic
1032599470 7:133278231-133278253 CGAGTGTCTGCTTTGTGCTGAGG + Intronic
1033276578 7:139976180-139976202 AGAGTGACTCCTCTGTGCAGAGG - Intronic
1033476387 7:141697224-141697246 TGAGTGCCTGCTGTGTGCCAAGG - Intronic
1034442018 7:151090498-151090520 AGATTGCCTGCCCTGGGCTGTGG + Intronic
1034634059 7:152553567-152553589 CCAGTGCCACCTCTGTGCTGGGG - Intergenic
1034728511 7:153363068-153363090 TCAGTGTCTGCTCTGAGCTGCGG - Intergenic
1037435857 8:18862346-18862368 GGAGTTCCTGCTCAGTGATGTGG - Intronic
1037827935 8:22170377-22170399 GTGTTGCATGCTCTGTGCTGGGG + Intronic
1038454953 8:27667051-27667073 CTAGTGGCTGCTCTGAGCTGAGG - Intronic
1039102600 8:33957347-33957369 GAAGTGAGTGCTCTGTGCTGGGG + Intergenic
1039904985 8:41780066-41780088 CAAGTGCCTACCCTGTGCTGAGG + Intronic
1041545035 8:59033298-59033320 TGAGTGCCTACTGTGTGCTAGGG - Intronic
1043299252 8:78705970-78705992 TGAGGTCCTGCTCTGTGATGAGG + Intronic
1043331770 8:79125435-79125457 GGAGTGCCTAATCTAAGCTGGGG - Intergenic
1043891200 8:85654389-85654411 GGAGTGGCGGCTCGGGGCTGCGG + Intergenic
1043892274 8:85661226-85661248 GGAGTGGCGGCTCGGGGCTGCGG + Intergenic
1043893287 8:85716114-85716136 GGAGTGGCGGCTCGGGGCTGCGG - Intergenic
1043895970 8:85737563-85737585 GGAGTGGCGGCTCGGGGCTGCGG - Intergenic
1043896709 8:85744245-85744267 GGAGTGGCGGCTCGGGGCTGCGG + Intergenic
1043899032 8:85762612-85762634 GGAGTGGCGGCTCGGGGCTGCGG + Intergenic
1043900643 8:85774806-85774828 GGAGTGGCGGCTCGGGGCTGCGG + Intergenic
1043902607 8:85790081-85790103 GGAGTGGCGGCTCGGGGCTGCGG + Intergenic
1043904217 8:85802274-85802296 GGAGTGGCGGCTCGGGGCTGCGG + Intergenic
1043905829 8:85814468-85814490 GGAGTGGCGGCTCGGGGCTGCGG + Intergenic
1043907437 8:85826655-85826677 GGAGTGGCGGCTCGGGGCTGCGG + Intergenic
1044527688 8:93270083-93270105 TGAGTGCCTAGTCTGTTCTGTGG - Intergenic
1044699744 8:94955023-94955045 GGAGTTCCTGCTCTGGAATGGGG + Intronic
1045263902 8:100602928-100602950 GGGGGGCCTACTCTGTTCTGTGG + Intronic
1045375025 8:101563507-101563529 TGAGTGCCTGCTGTATTCTGTGG + Intronic
1045544079 8:103112416-103112438 TCAGTGCCTGCTCTCTTCTGTGG - Intergenic
1045727129 8:105186664-105186686 GGAGTGCCTGCTCTGGGGCCGGG - Intronic
1046086646 8:109445057-109445079 GGAGTGCCTGCCCAGTGCCAGGG + Exonic
1046255773 8:111694539-111694561 AGGGTGGCTGTTCTGTGCTGGGG + Intergenic
1047034333 8:120918128-120918150 GGAGTGCCAGTGCTTTGCTGGGG - Intergenic
1047277893 8:123419598-123419620 GGAGTGCCTGCTTTGTGCCAGGG + Intronic
1047786964 8:128162699-128162721 TGAATGCCTGCTCTGTGATCAGG - Intergenic
1047846692 8:128813922-128813944 GGAGTGGCTTTTCTGTGCTGGGG + Intergenic
1048104871 8:131397057-131397079 GAAGTTGCTGCTCTTTGCTGGGG + Intergenic
1048161696 8:132027416-132027438 GCAGTCCATGCACTGTGCTGAGG + Intronic
1048431815 8:134377752-134377774 TGAGGACCTGCTCTGTGCTGAGG - Intergenic
1048989688 8:139753959-139753981 GGAATACCTGCTCTGTGCCAAGG - Intronic
1049107183 8:140621477-140621499 TGAGTGACAGCTATGTGCTGGGG - Intronic
1049269462 8:141686556-141686578 AGCTTGCCTTCTCTGTGCTGTGG + Intergenic
1049476672 8:142800097-142800119 GGACTCCCTGTTCTGTGCAGGGG - Intergenic
1049581210 8:143411891-143411913 GGAGGGAGTGCTCTGTCCTGAGG + Intergenic
1050495281 9:6234440-6234462 GGTGTACCTGCTCTGGACTGGGG - Intronic
1051139370 9:13962064-13962086 GGAGTGTGTGCTGTGTACTGTGG - Intergenic
1051180731 9:14409348-14409370 GGAGCACCAGCTCTGTGCTGAGG - Intergenic
1051394892 9:16609232-16609254 TGAATGCCTACTCTGTGCTGGGG + Intronic
1051459063 9:17293300-17293322 GGAGCGGGTGCGCTGTGCTGTGG + Intronic
1052387108 9:27835396-27835418 GGAGGGGCTGCGCTGTGCTGGGG + Intergenic
1052702952 9:31960058-31960080 AGAGTGACTGTGCTGTGCTGGGG - Intergenic
1053433433 9:38059083-38059105 TGAGAGCCTGCTGTGTGTTGGGG - Intronic
1055480258 9:76702575-76702597 TGAGAGCTTGCTCTGTGCCGTGG - Intronic
1056127954 9:83555142-83555164 AGAGTACCTGTGCTGTGCTGGGG + Intergenic
1057196685 9:93119528-93119550 GGAGTGCCTGCCCTGGACTTGGG + Intergenic
1057263921 9:93601714-93601736 GGATTGCTTGCTGTGTGCTGAGG + Intronic
1057310339 9:93939020-93939042 GAAGTGCCTGGTTTGTGCTGGGG - Intergenic
1057877964 9:98772003-98772025 TGAGTGCCTTCTTTGTGCCGAGG - Intronic
1058035089 9:100243392-100243414 TGAGTACCTGCTCTATGCTAAGG - Intronic
1059422158 9:114198932-114198954 CGTGTGCCAGCCCTGTGCTGAGG - Intronic
1060053159 9:120391394-120391416 TGAGTCCCAGCTCTGTGCTGGGG - Intronic
1060925689 9:127453793-127453815 TGAGTGCCTGCTGTGGGCTCAGG + Intronic
1061117153 9:128621106-128621128 TGAGAGCCTGCTATGTGTTGTGG - Intronic
1061766249 9:132883280-132883302 AGTCTGCCTGCTCTGGGCTGGGG - Intronic
1062326879 9:136016781-136016803 GGAGTGACAGCTCAGTGCTTGGG + Intronic
1062453077 9:136623591-136623613 GGAGTCACTGATCTGGGCTGTGG - Intergenic
1062615229 9:137393244-137393266 GGAGAGTCAGCTCTGTGCTGAGG + Intronic
1062707568 9:137953856-137953878 GAGGTGCCTGGGCTGTGCTGAGG + Intronic
1203528019 Un_GL000213v1:107304-107326 AGGGTGGCTGTTCTGTGCTGAGG + Intergenic
1186160334 X:6770659-6770681 GGATTGCCGGCTTTGGGCTGGGG + Intergenic
1187644201 X:21328713-21328735 GTAGTGGCTGCTCAGTTCTGTGG - Intergenic
1190115610 X:47624512-47624534 TGAGTGCCTGCTATATGCCGAGG + Intronic
1190501450 X:51082689-51082711 GGAGTTTCTCCTCTGTACTGGGG - Intergenic
1191019260 X:55842266-55842288 GTAGTGGCTGTGCTGTGCTGGGG + Intergenic
1191019305 X:55842532-55842554 AGGGTGGCTGCACTGTGCTGGGG + Intergenic
1192055508 X:67769296-67769318 GAGGTGGTTGCTCTGTGCTGGGG - Intergenic
1192923549 X:75733511-75733533 GAAGTGGATGCTCTGTACTGGGG + Intergenic
1193164286 X:78263879-78263901 GGAGGGGGTGCACTGTGCTGGGG + Intergenic
1193533593 X:82686353-82686375 GGAGGGGTTGCACTGTGCTGTGG + Intergenic
1195208266 X:102625501-102625523 GGAGTAGCTGCACTGTGCTGAGG + Intergenic
1196021808 X:110998742-110998764 TGAGTGCCTGCTATGTGCTAGGG - Intronic
1196234402 X:113261887-113261909 GGGATGGCTGCACTGTGCTGGGG + Intergenic
1197717419 X:129719549-129719571 CGAGTGCCTGCTATGTGCCAGGG - Intergenic
1197922984 X:131615281-131615303 CGTTTGCATGCTCTGTGCTGTGG + Intergenic