ID: 1005349914

View in Genome Browser
Species Human (GRCh38)
Location 6:24924061-24924083
Sequence CAGGCTGAGCAGACCCACGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 187}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005349911_1005349914 25 Left 1005349911 6:24924013-24924035 CCTGTCGTGTCTGTTTTGAAAAG 0: 1
1: 0
2: 0
3: 13
4: 139
Right 1005349914 6:24924061-24924083 CAGGCTGAGCAGACCCACGCTGG 0: 1
1: 0
2: 1
3: 17
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005349914 Original CRISPR CAGGCTGAGCAGACCCACGC TGG Intronic
900126790 1:1072305-1072327 CAGGCTGAGCAGCCGCCAGCCGG + Exonic
900766874 1:4511733-4511755 CAGGCTTTGCAGAACCAAGCAGG - Intergenic
901327503 1:8376879-8376901 GAGGTTCAGCAGACCCACCCTGG - Intronic
902883036 1:19385457-19385479 CAGGCACAGCAGGCACACGCGGG - Intronic
903743388 1:25571360-25571382 CAGGCTGAGCAGTGCCACTGGGG - Intergenic
904770183 1:32876788-32876810 CAGGCTGTGCAGAGCCACGAGGG - Intergenic
904999542 1:34657537-34657559 CAGCCTGAGTAGACTCAGGCAGG - Intergenic
906566003 1:46801540-46801562 CAGGTTGAGCAGACAAAGGCTGG + Intronic
907905744 1:58782858-58782880 CAGCTTGAGCAGCCCCACGTCGG + Exonic
912453030 1:109778963-109778985 CAGCCTGAACAGACTAACGCAGG - Intergenic
912693144 1:111819705-111819727 CAGCCTGAGGAGACACAAGCAGG - Intronic
916171052 1:162002050-162002072 CTGGCTGAACAGACCAACACAGG - Intronic
924177778 1:241410445-241410467 CAGGCTGAGAAGAGCCAAACAGG + Intergenic
924257521 1:242197145-242197167 CTGGCTGAGCTGCCCCAGGCTGG - Intronic
924584953 1:245354056-245354078 CAGGCTGAGGAGACCCTCAGAGG - Intronic
924608000 1:245551739-245551761 AAGGCTGTGCAGATCCACCCTGG - Intronic
1067284905 10:44900383-44900405 CAGGCTGAGCTGACCCAGGGAGG - Intergenic
1069865129 10:71497600-71497622 CAGGCAGAGAAGACCCAACCCGG - Intronic
1069867573 10:71513208-71513230 CACACTGAGCAGCCCCAAGCAGG - Intronic
1070120658 10:73573620-73573642 CAGGCTGTGCACCACCACGCTGG - Intronic
1070656808 10:78277276-78277298 CAGGCAGAGCAGAGGCACCCAGG - Intergenic
1070794708 10:79209922-79209944 CAAGCTGAGCAGCCCCAGGAGGG - Intronic
1075468446 10:122670097-122670119 CAGGCTGAGCAGACCTGCCATGG - Intergenic
1075642536 10:124075220-124075242 CAGGCTGTGCATCCCCACGGTGG + Intronic
1075734354 10:124654834-124654856 CAGGGCGAGCAGAGGCACGCCGG - Intronic
1075737170 10:124671062-124671084 GATGCTGAGCAGAGCCAGGCTGG + Intronic
1076747626 10:132522377-132522399 CACCCTCAGCAGACCCACGGGGG - Intergenic
1079116735 11:17644991-17645013 CAGGCAGAGGAAACCCACACTGG + Intronic
1079837362 11:25350969-25350991 CAGGCTCAGCAGACTCAGGAGGG - Intergenic
1080427357 11:32168449-32168471 CAGGCTGAGCAAAGCCAGGCTGG + Intergenic
1080699805 11:34635222-34635244 CCAGCTGAGCAGGCCCAAGCTGG + Intronic
1080874837 11:36265967-36265989 CAGGCAGCGCAGGCCCACCCAGG - Intergenic
1084742090 11:71146532-71146554 CAGGCTGCCCTGGCCCACGCTGG - Intronic
1085455075 11:76660996-76661018 CAGGCGGGGCAGACCCTCGAAGG + Exonic
1088821964 11:113464210-113464232 CAGGATGAGAAGACCTACACTGG + Intronic
1089626842 11:119756294-119756316 CAGGCAGATCAAACCCACTCAGG - Intergenic
1091074289 11:132600399-132600421 GAGGCTGGGAAGACCCATGCTGG - Intronic
1091948011 12:4566256-4566278 CAGGTTTAGCATAGCCACGCAGG + Intronic
1102646449 12:114406912-114406934 CAGTCTGAGCAGACCCAGATTGG + Intronic
1102997729 12:117362609-117362631 CAAGCGGAGCAAACCCACTCAGG + Intronic
1103853567 12:123948970-123948992 TAGGCTGAGGAGACCCAGCCGGG + Intronic
1104485590 12:129148956-129148978 AAAGCTGAGGAGACCCACGCTGG - Intronic
1104895572 12:132162105-132162127 CAGGCTGAGAAAACCGAGGCAGG - Intergenic
1105403963 13:20118803-20118825 CAGCCAGGGCAGACCCGCGCGGG + Intergenic
1106181604 13:27374165-27374187 CAGGCAGTGCAAACCCAGGCAGG - Intergenic
1106252969 13:27997070-27997092 AAGGCTGAGTAGACCGAGGCTGG - Intergenic
1108484539 13:50910403-50910425 CAGCCTGAGGGGAGCCACGCGGG + Intronic
1112287568 13:98117668-98117690 CTGACTGAGCAGACCCAGGCTGG - Intergenic
1112290689 13:98142666-98142688 CAGGCGAAGCAGCCCCAGGCAGG + Exonic
1113625865 13:111845925-111845947 CACCCTGTGCACACCCACGCAGG - Intergenic
1119483806 14:74975544-74975566 CAGGCTGACCTGACCCAGGGAGG - Intergenic
1119978656 14:79054613-79054635 CTGGCTGAGCAAACCCCAGCTGG + Intronic
1121612753 14:95292851-95292873 CTGGAGGAGCAGACCCACACCGG - Intronic
1121900461 14:97689086-97689108 AATGCTGAGCAGAACCACGAGGG + Intergenic
1122521646 14:102348351-102348373 AAGGCTGAGCAGCACCACGTGGG + Exonic
1122836837 14:104434680-104434702 GGGGCTGAGCAGTCCCACACAGG + Intergenic
1123710121 15:22980571-22980593 CAGGCTGCGGTGACCCAGGCCGG - Intronic
1124715838 15:32060928-32060950 CAGGATGAGCACACCCACCAAGG + Intronic
1130251654 15:82303957-82303979 CAGGCAGAGCAGACCCTCAGGGG + Intergenic
1131110436 15:89761421-89761443 CAGGCTGGGCACACCCAAGTTGG - Intronic
1132251210 15:100336901-100336923 CTGGCTGAGCTCACCCAGGCTGG + Intronic
1132555691 16:571209-571231 CAGGCTAACCAGACACACACAGG - Intronic
1132555722 16:571414-571436 CAGGCTAACCAGACACACACAGG - Intronic
1132555726 16:571468-571490 CAGGCTAACCAGACACACACAGG - Intronic
1132801816 16:1758373-1758395 CAGCCTGAGGAGTCCCCCGCGGG + Intronic
1134716986 16:16362234-16362256 CAGGCTGGAGAGTCCCACGCGGG - Intergenic
1134957765 16:18389925-18389947 CAGGCTGGAGAGTCCCACGCGGG + Intergenic
1135565504 16:23508590-23508612 AAGGCTGAGCAGAAACAGGCAGG - Intronic
1136186351 16:28590979-28591001 CAGGCTGATCAGACAGACGAGGG + Intronic
1137056762 16:35749781-35749803 CTCCCTGAGCAGACCCACACGGG - Intergenic
1137232069 16:46575710-46575732 AAGGCTGAGCAAACCCATGATGG + Intergenic
1137750502 16:50858046-50858068 AAGGCTGGGCAGCCCCACACTGG + Intergenic
1139644215 16:68316202-68316224 CTGGCTGAGCAGACCTGCTCAGG - Intronic
1140883550 16:79221311-79221333 GAGGCTGAGCAGATCCTCCCTGG + Intergenic
1141109725 16:81262345-81262367 CAGGCTGAGCAACCTCACCCCGG - Intronic
1142177507 16:88651802-88651824 CAGGCTGGGCAGAGCCACAGAGG - Intergenic
1142284009 16:89164317-89164339 CAGGCTGAGCAGCCACACCCCGG - Intergenic
1145004754 17:19331392-19331414 CAGGCTGTGCTGAGCCAGGCCGG - Intronic
1150340530 17:64363046-64363068 CGGTCTGAGCAGACTCAGGCAGG - Intronic
1150484427 17:65533814-65533836 CTGGCTGAGCAGACCTAGGTGGG - Intronic
1151511641 17:74564476-74564498 ATGGCTGAGCACACCCAGGCTGG - Intergenic
1151673328 17:75585034-75585056 CAGGCTCAGAGGACCCACGATGG - Intergenic
1151986052 17:77544538-77544560 CAGCCAGAGCAGCCCCACGCGGG + Intergenic
1152225782 17:79092054-79092076 CAGGCCGGGGAGACCCACACTGG + Intronic
1154303897 18:13217462-13217484 CAGGCTGCGCCGACCCCTGCGGG - Intergenic
1155064068 18:22253911-22253933 CAGGCCCGGCTGACCCACGCGGG - Intergenic
1156732284 18:40208540-40208562 CAGACTGAGCAGAACCATGCTGG + Intergenic
1158934209 18:62349565-62349587 CAGGCTCAGCGGACCCAGGTGGG + Intronic
1162037796 19:7951731-7951753 CAGGCCGAGCAAACCAATGCAGG + Intergenic
1163702130 19:18791231-18791253 CAGGGTGAGCAGAAGAACGCAGG + Exonic
1166991522 19:46695663-46695685 GAGGCTGAGGGGACCCAGGCGGG + Intronic
1168586809 19:57600340-57600362 GAGGCTGGGGAGACCCAGGCCGG + Intronic
925027385 2:620768-620790 CAGGCTGCCCGGATCCACGCGGG + Intergenic
925355686 2:3239519-3239541 CATGCAGAGCAGACGCACGATGG - Intronic
926044982 2:9703726-9703748 CAGGGTGAGCAGAGCCAAGTGGG - Intergenic
926225823 2:10966281-10966303 CAGGCTGAGCAGAGACACATGGG - Intergenic
926599355 2:14825208-14825230 TGGGCTGGGCAGACCCACGATGG + Intergenic
926654287 2:15383561-15383583 TAGCCTGAGCAGACACAGGCTGG + Intronic
926762003 2:16286278-16286300 GAGGCTGAGAAGAAACACGCAGG + Intergenic
928215339 2:29356677-29356699 GAGACTGAGCAGACCCACTGGGG + Intronic
940352806 2:152707638-152707660 CAGTCTGAGCAGAGCCAGGAAGG - Intronic
946301455 2:218826943-218826965 CAGGCAGTGCAGACACACGCCGG + Exonic
948504266 2:238417728-238417750 CAGGCTGGGGAGACACACGCAGG - Intergenic
948504276 2:238417770-238417792 CAGGCTGGGGAGACACACACAGG - Intergenic
948504287 2:238417812-238417834 CAGGCTGGGGAGACACACACAGG - Intergenic
948504298 2:238417854-238417876 CAGGCTGGGGAGACACACACAGG - Intergenic
948504309 2:238417896-238417918 CAGGCTGGGGAGACACACACAGG - Intergenic
948504320 2:238417938-238417960 CAGGCTGGGGAGACACACACAGG - Intergenic
948504331 2:238417980-238418002 CAGGCTGGGGAGACACACACAGG - Intergenic
948504342 2:238418022-238418044 CAGGCTGGGGAGACACACACAGG - Intergenic
948504353 2:238418064-238418086 CAGGCTGGGGAGACACACACAGG - Intergenic
948504364 2:238418106-238418128 CAGGCTGGGGAGACACACACAGG - Intergenic
948504375 2:238418148-238418170 CAGGCTGGGGAGACACACACAGG - Intergenic
948504385 2:238418190-238418212 CAGGCTGGGGAGACACACACAGG - Intergenic
948504395 2:238418232-238418254 CAGGCTGGGGAGACACACACAGG - Intergenic
948504405 2:238418274-238418296 CAGGCTGGGGAGACACACACAGG - Intergenic
1169006068 20:2207870-2207892 CAGGGCGAGCTGACCCAGGCTGG - Intergenic
1169204180 20:3730859-3730881 GAGGCTGAGCAGAGCCAGGAGGG - Intergenic
1174726704 20:52870340-52870362 CAGGCTGAACACTCCCAGGCAGG + Intergenic
1174751125 20:53112201-53112223 CAGGGAGAGCAGAACCACACAGG + Intronic
1175136441 20:56827815-56827837 CGGGCAAAGCAGCCCCACGCCGG - Intergenic
1175329822 20:58155869-58155891 AAGGCAGGGCAGACCCAGGCAGG + Intronic
1175494508 20:59404316-59404338 CAGGCTGAGCACACAGACGTGGG + Intergenic
1175809583 20:61850777-61850799 CAGGCTGGGCACACCCAGGGTGG - Intronic
1175931634 20:62496420-62496442 CTGTCTGAGCAGCCACACGCAGG + Intergenic
1175973761 20:62699946-62699968 CAGGCTGGCCAGGCCCATGCTGG + Intergenic
1176301085 21:5099440-5099462 CAGGCTGAGCAGAGCCCAGCGGG + Intergenic
1176304530 21:5116174-5116196 CAGCCTGAGAGGCCCCACGCTGG - Intergenic
1178671677 21:34596350-34596372 AAGGCTGAGGAGACCCACAGGGG + Intronic
1179479579 21:41668924-41668946 CTGGCTCAGCAGACCCACAGGGG - Intergenic
1179852526 21:44145856-44145878 CAGCCTGAGAGGCCCCACGCTGG + Intergenic
1179855944 21:44162458-44162480 CAGGCTGAGCAGAGCCCAGCGGG - Intergenic
1180646356 22:17342322-17342344 CAGGGTCAGCAGACACACGGAGG + Intergenic
1180958971 22:19754183-19754205 CTGGCTGTGCAGACCCTGGCCGG + Intergenic
1182485635 22:30636944-30636966 CAGGCAGAGCGGACCCATGGCGG - Exonic
1183032610 22:35117081-35117103 CAGGCTGACCAGACCCTGCCAGG + Intergenic
1183437875 22:37805653-37805675 CAGGCCGAGAAGAACCGCGCTGG + Exonic
1184359664 22:44007356-44007378 CAGGCTCTGCACTCCCACGCTGG + Intronic
1184527529 22:45034295-45034317 CAGACTGAGCAGATCCACCCTGG + Intergenic
1184716906 22:46287671-46287693 CAGGCTCAGCAGAGTCACCCTGG + Intronic
1185014542 22:48335354-48335376 CAGGCTGAGAGGAACCACACGGG + Intergenic
950063555 3:10092617-10092639 CAAGCTGAGCAAAACCACGATGG - Intronic
954414823 3:50388154-50388176 CAGGCGGGGCAGACGCAGGCGGG - Intronic
954513970 3:51154339-51154361 CAGGAAGAGCAGACCCATGATGG + Intronic
954871827 3:53773223-53773245 CAGACTGAAAAGACCCACGAGGG - Intronic
955246362 3:57228116-57228138 CCAGCCGAGCAGGCCCACGCGGG - Intronic
955374814 3:58386066-58386088 AAGGCTCAGCAGTCCCAGGCTGG - Intronic
959947139 3:112137117-112137139 CAGCCTGAGCAGACACAGCCTGG + Intergenic
961634609 3:128325162-128325184 CAGTCTGTGCAGACCCAGCCAGG + Intronic
967015454 3:185477725-185477747 AAGCCTGAGCAGACCAACACAGG - Intronic
969443929 4:7233496-7233518 CAGGGTGAGCAGACACTTGCTGG + Intronic
969687137 4:8681945-8681967 CAGGCTGAGCAGAGCCAGAGTGG - Intergenic
974800542 4:66812114-66812136 AAGGTTGAGCAGCCCCACACCGG + Intergenic
976068339 4:81215048-81215070 CTGGCTGAGCTGACCTGCGCTGG - Exonic
980991824 4:139744846-139744868 CAGGCTGACCAGACCCGGGATGG + Intronic
981015565 4:139970459-139970481 CAGGCAGTGCAGATCCACCCAGG + Intronic
986006940 5:3676535-3676557 GAGGCTGGGCAGGCACACGCCGG - Intergenic
988841301 5:35086449-35086471 CAGGCTGAGGAGACCTAGGGTGG + Intronic
989238862 5:39180509-39180531 AAGGCTGACCAGACCAACCCAGG + Intronic
992460377 5:76954260-76954282 TACGCTCAGCAGCCCCACGCTGG - Intronic
992515898 5:77492141-77492163 GACGCAGAGCAGACCCACCCGGG + Intronic
995534756 5:113123801-113123823 GAAGCTGAGCAGACCCAAGTGGG - Intronic
997210978 5:132076512-132076534 CTGGCTGAACAGGCCCACTCTGG + Intergenic
1001704211 5:173730136-173730158 GTGGCTGAGCAGAGCCACGCAGG + Intergenic
1005349914 6:24924061-24924083 CAGGCTGAGCAGACCCACGCTGG + Intronic
1007121777 6:39388194-39388216 CAGGTTGAGCACACCTACTCTGG - Intronic
1007252558 6:40505825-40505847 CAAGCTGAGGAGACCCATCCTGG - Intronic
1008439765 6:51519853-51519875 CAAGCTGAGCAACCCCAAGCAGG - Intergenic
1013269730 6:108534598-108534620 CAGGCTGAGGACACCCTCCCTGG - Intergenic
1017658104 6:156649136-156649158 CAGCCTGAGCAGACAGAAGCTGG + Intergenic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018841586 6:167521402-167521424 CAGGCTCAGAAGACACCCGCAGG + Intergenic
1020448161 7:8291992-8292014 CAGGGTAAGCAGGCCCAGGCTGG - Intergenic
1022506697 7:30912077-30912099 CGGGCTGAGCATCGCCACGCTGG + Exonic
1022517764 7:30986857-30986879 CCGGCTCAGCAGCCCCTCGCTGG - Intronic
1031967527 7:128037783-128037805 CAGGCTGACAAGACACACTCAGG + Intronic
1033253255 7:139777977-139777999 CATGCTGAGCTGAGCCCCGCCGG - Intronic
1034979485 7:155467068-155467090 CAGGCTGAGCCGCCGCGCGCTGG + Intergenic
1037262896 8:17027497-17027519 CAGGCCGACCAGCCCCCCGCCGG - Exonic
1040541558 8:48361756-48361778 CAGCCTGAGCAGACCAACACAGG - Intergenic
1040580782 8:48697068-48697090 CAGGCTGTGCTGGGCCACGCAGG - Intergenic
1043324609 8:79034342-79034364 CAGGCTGGGAGGACCCACCCTGG - Intergenic
1044554956 8:93553109-93553131 CAGGCTGACCTGACCCATTCAGG + Intergenic
1045956923 8:107919085-107919107 CTGTCTGAGCATACCCATGCAGG - Intronic
1047354402 8:124106675-124106697 CAGGCTGAGGATACCCAGGAAGG - Intronic
1047418260 8:124683718-124683740 ATGGCTGAGCAGACACACTCAGG + Intronic
1047694796 8:127392857-127392879 CAGGATGAGCAAACCCATGGAGG + Intergenic
1048342999 8:133555129-133555151 AAGGCTGAGCAGTCCCCCGCGGG - Intronic
1048888022 8:138924309-138924331 CAGGCTGGGCAGACCCAGGCTGG - Intergenic
1049389596 8:142360951-142360973 CAGGCAGAGGACACCCAGGCTGG + Intronic
1049438753 8:142599642-142599664 CAGGCTGAGGAGGCCCCAGCAGG + Intergenic
1049558230 8:143294290-143294312 CAGGCTGAGCAACCCCATCCAGG - Intronic
1051583900 9:18706698-18706720 CAGGATGAGAAGCCCCAGGCAGG - Intronic
1054848292 9:69820492-69820514 CAGCCCGAACAGACCCACTCGGG + Intergenic
1057303374 9:93899174-93899196 GGGGCTGAGCAGAGCCAGGCTGG + Intergenic
1060186700 9:121568093-121568115 AAGGCTGACCTGACCCAAGCTGG - Intronic
1061394292 9:130335098-130335120 CATGCTGTGCAGCCCCAGGCAGG - Intronic
1061422616 9:130480445-130480467 GAGGCTGAGCAGACTCACCTCGG - Exonic
1061720443 9:132547801-132547823 CAGGGTGGGCCGGCCCACGCAGG - Intronic
1062214301 9:135380795-135380817 CAGGGAGGGCAGACCCAAGCTGG - Intergenic
1062368243 9:136222368-136222390 CAGCCTGAGCAGAACCAGACAGG - Intronic
1062577137 9:137214094-137214116 CAGGCGCAGCAGACCCAACCTGG + Intronic
1188000833 X:24979782-24979804 TTGGCTGAGCAGACCCACATGGG + Intronic
1198107595 X:133476219-133476241 CTGGCAGAGCAGTCCCATGCAGG + Intergenic
1200247348 X:154533231-154533253 CAGGGTGAGCAGAGCCAAGCAGG - Intronic
1201283404 Y:12359978-12360000 CAGGCTGAGAGGAGCCATGCTGG + Intergenic