ID: 1005350636

View in Genome Browser
Species Human (GRCh38)
Location 6:24931497-24931519
Sequence TCTCCCAGATGGAGATGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 177}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005350636_1005350638 -6 Left 1005350636 6:24931497-24931519 CCAGTTCATCTCCATCTGGGAGA 0: 1
1: 0
2: 0
3: 15
4: 177
Right 1005350638 6:24931514-24931536 GGGAGAGTTCCCCTCCTTTGTGG 0: 1
1: 0
2: 1
3: 7
4: 162
1005350636_1005350644 30 Left 1005350636 6:24931497-24931519 CCAGTTCATCTCCATCTGGGAGA 0: 1
1: 0
2: 0
3: 15
4: 177
Right 1005350644 6:24931550-24931572 TTTCTCAGACACAGTTATCCAGG No data
1005350636_1005350639 -3 Left 1005350636 6:24931497-24931519 CCAGTTCATCTCCATCTGGGAGA 0: 1
1: 0
2: 0
3: 15
4: 177
Right 1005350639 6:24931517-24931539 AGAGTTCCCCTCCTTTGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005350636 Original CRISPR TCTCCCAGATGGAGATGAAC TGG (reversed) Intronic
901470954 1:9456152-9456174 TATCCCAGCTGGAGATGCACAGG + Intergenic
902526027 1:17058116-17058138 ACGCCCAGATGGAGATGCTCAGG - Intergenic
904295598 1:29517874-29517896 TCTCCAGGAAGGAGAGGAACTGG + Intergenic
904456679 1:30651951-30651973 TGTCACAGCTGGAGATGAGCAGG - Intergenic
905323444 1:37133564-37133586 TCTCTCTGCTGGAGATGAAAGGG - Intergenic
912465139 1:109867319-109867341 TCTCCTTGAGTGAGATGAACAGG + Intergenic
916002045 1:160626433-160626455 TCTCTCAGATCTAGATGGACTGG - Intronic
916208065 1:162334551-162334573 TCTCCCTGATGGTCATGAATTGG + Intronic
918903781 1:190462499-190462521 TTTTCCAAATGGAGAGGAACAGG - Intronic
920710441 1:208289465-208289487 CTTCCCTGATCGAGATGAACAGG - Intergenic
923659276 1:235944593-235944615 ACACGCAGCTGGAGATGAACAGG + Intergenic
1063516318 10:6699558-6699580 TATCCCAGATGGAGATGCTGGGG + Intergenic
1065698862 10:28405289-28405311 TGTCCAAGAGGAAGATGAACTGG - Intergenic
1067066852 10:43109044-43109066 TCTCCGAGATGGAGAGGTTCCGG - Exonic
1067424109 10:46189825-46189847 TCTCCGAGATGAAGATAAAGTGG + Intergenic
1067548587 10:47215972-47215994 CCACCCAGAAGGAGATGAAAGGG + Intergenic
1068476114 10:57528385-57528407 TCTCACAGATTGACATGAAAAGG + Intergenic
1069765256 10:70852028-70852050 TATCCCAGATGAAGATAAACAGG + Intronic
1069858831 10:71457613-71457635 TCTCCCAGATTGAGCTGGGCTGG - Intronic
1070860511 10:79655073-79655095 TCTCCGAGATGAAGATAAAGTGG + Intergenic
1070876754 10:79820476-79820498 TCTCCGAGATGAAGATAAAGTGG - Intergenic
1071758578 10:88574327-88574349 TTTCCCAGGTAAAGATGAACAGG - Intronic
1073244367 10:102079044-102079066 GCTCCCAGATGTAAAAGAACAGG - Intergenic
1074968789 10:118518440-118518462 TCTTCCAGATGCAGAGGAAAAGG - Intergenic
1075210422 10:120486216-120486238 TCTCACAGATGGAGGTTGACGGG - Intronic
1076361952 10:129895661-129895683 TGTCCCAGGTGGAGAAGCACAGG - Intronic
1077091255 11:779340-779362 TGTCCCTGATGGAGCTGAGCTGG + Intronic
1077194821 11:1274087-1274109 ACTCCCAGATGGAAATGGCCTGG + Intergenic
1078193578 11:9114928-9114950 GCTCTCTGATGGAGATGTACGGG - Intronic
1082873420 11:57964567-57964589 TCTCCAAGGTGGAGATGGAAGGG + Intergenic
1083159619 11:60847039-60847061 TCCCCCAGTTGGAGATGAAGTGG - Intronic
1084734999 11:71099139-71099161 TCTCCCTGTTGGTGATGACCTGG - Intronic
1085482966 11:76837948-76837970 TCCCCCATATGGATATGAATGGG + Intergenic
1086082979 11:82924478-82924500 TAGCCCAGATGTAGAAGAACTGG - Intronic
1088888040 11:114022976-114022998 TCTCTCACCTGGAGATGCACTGG + Intergenic
1089340156 11:117751814-117751836 TCTCCCAAGTGGAGTTGAGCAGG + Intronic
1092961406 12:13599799-13599821 TCTCCCAGGTGGGGAGGAGCAGG - Intronic
1093102164 12:15040346-15040368 TCTCCAAGAGGAAGATGCACAGG - Intergenic
1095107093 12:38247531-38247553 TCTCCCAGGTGGAGAAGTTCAGG + Intergenic
1096760463 12:53837268-53837290 TGTGCTAGAAGGAGATGAACTGG - Intergenic
1098306677 12:69109399-69109421 TCTCCAAGTAGAAGATGAACGGG - Intergenic
1099909137 12:88808357-88808379 TCTCCGATATGGAGATGGAAGGG - Intergenic
1102172589 12:110853397-110853419 TCCCCCAGTTGAAGAAGAACAGG + Exonic
1102612816 12:114127593-114127615 TCTGCCAGGTGGAGACGATCAGG + Intergenic
1102991132 12:117317216-117317238 GCTCACAGAAGGAGATGGACAGG + Intronic
1104084145 12:125458937-125458959 TCTCCCTGATGGACTTGGACAGG - Intronic
1105319466 13:19304657-19304679 TTTTCCTGATGGAGATGAAGAGG - Intergenic
1107576926 13:41734458-41734480 TGTCCAAGATGGAGTTGAATTGG + Intronic
1112930271 13:104726696-104726718 TATCCCAGATGAAGATCAATTGG + Intergenic
1119492713 14:75050880-75050902 TCTCACTGATGGAGAAGAAGGGG - Intronic
1121333650 14:93063553-93063575 TCTACCAGATGGTGATGAGATGG - Intronic
1122514440 14:102297416-102297438 GCTCACAGAAGGAGATGAAAAGG + Intronic
1123470425 15:20547447-20547469 TCTCCCAGAGAGTGAAGAACAGG - Intergenic
1123647632 15:22453253-22453275 TCTCCCAGAGAGTGAAGAACAGG + Intergenic
1123730726 15:23142424-23142446 TCTCCCAGAGAGTGAAGAACAGG - Intergenic
1123748865 15:23339850-23339872 TCTCCCAGAGAGTGAAGAACAGG - Intergenic
1124053300 15:26219200-26219222 TCTCGCATATGGATATGGACTGG + Intergenic
1124169533 15:27360380-27360402 ACTCCCAGATGGAGAGCAGCTGG - Intronic
1124281237 15:28363733-28363755 TCTCCCAGAGAGTGAAGAACAGG - Intergenic
1124301466 15:28547888-28547910 TCTCCCAGAGAGTGAAGAACAGG + Intergenic
1124583654 15:30985576-30985598 TCTGTCAAATGGAGATAAACTGG + Intronic
1125852679 15:42920261-42920283 TCTCCGAGATGGAGAGTGACGGG + Intronic
1126840346 15:52711519-52711541 TCTCCCAGAGGGAAATGACCTGG - Intergenic
1127174722 15:56341318-56341340 TCTACTAGAAGGAGATGCACTGG - Intronic
1129656738 15:77529631-77529653 TCTCCCCTCTGGAGATGACCGGG + Intergenic
1129921460 15:79322603-79322625 TATCCCATATGGAGAAGAAAGGG + Exonic
1130780751 15:87037521-87037543 AATCCCAGAAGGAGATGAAAGGG + Intergenic
1131798952 15:96049681-96049703 TCTTCCAGAAGGAGAGGAAAAGG - Intergenic
1131873401 15:96782124-96782146 GCTCCCAGGTGGAGAAGATCGGG - Intergenic
1132119824 15:99167144-99167166 TGTCCCAGGTGGAGATAGACTGG - Intronic
1132477621 16:149172-149194 TCTTTCAGACCGAGATGAACTGG - Intergenic
1134237081 16:12475008-12475030 CCCCACAGATGGAGAGGAACTGG - Intronic
1135006611 16:18829415-18829437 TCTCTCAGCTGGTTATGAACAGG - Exonic
1136063838 16:27745686-27745708 ACTCCTAGATTGAGATGAATAGG - Intronic
1136463130 16:30424368-30424390 TCTCCAAAATGGACATCAACCGG - Exonic
1138010092 16:53371073-53371095 TCTCCCAGAGAGTGAAGAACAGG - Intergenic
1140908588 16:79430745-79430767 TCACCCTGATGGAGAAGGACTGG - Intergenic
1141450990 16:84101982-84102004 TTTCCAAGATGGAGAAGAAGCGG - Exonic
1143609449 17:8009325-8009347 TCTCCCAGATGGCTGTGAAGTGG + Intronic
1147027352 17:37598905-37598927 TGTCCCAGATTGAGATCAAATGG - Intronic
1150569946 17:66376749-66376771 TCTCCCAGATGCCGATGCCCAGG - Intronic
1151439386 17:74118445-74118467 TTCCCCTGATGGAGATGAGCTGG - Intergenic
1152869189 17:82742911-82742933 TCTCCCAGCTGGAGGTCACCTGG + Intronic
1153521578 18:5959233-5959255 GCTCTCAGATGGATATGAGCTGG + Intronic
1153694740 18:7628939-7628961 TCACGTAGATGGAGATGAGCTGG - Intronic
1154498113 18:14977349-14977371 TCTCCTGGATGGAGAAGAATAGG + Intergenic
1155607389 18:27622610-27622632 TTTTCCAGATGGAGCTGACCTGG + Intergenic
1157741034 18:50093510-50093532 TCTTCCAGATGGAGTTGCTCTGG - Intronic
1158202039 18:54951854-54951876 CCTCCCAGCTGGTGATGAAGTGG - Intronic
1158796316 18:60850172-60850194 TGTACCAGATGGAGTTAAACAGG - Intergenic
1160034226 18:75286282-75286304 GCTCCCTGATGGAGATGGAGGGG + Exonic
1160518209 18:79489990-79490012 CCTCACAGGTGGAGATGAAACGG - Intronic
1161441923 19:4296733-4296755 CCTACCAGCTGGAGAGGAACAGG + Intronic
1161693132 19:5749093-5749115 TTTCCCAGCTGAAAATGAACTGG + Exonic
1163804843 19:19389411-19389433 AGACCCAGATGGAAATGAACAGG - Intronic
1164388254 19:27794817-27794839 TCTCCCAAAAGCGGATGAACTGG - Intergenic
1165934209 19:39379428-39379450 CCTCCCTGAGGGAGAAGAACAGG - Intronic
1166860205 19:45805800-45805822 TGTCCCTGATGGAGAAGAAAAGG + Intronic
1166931581 19:46304424-46304446 TCTCCCAGATGGATAGGCCCTGG + Intronic
1167367805 19:49064129-49064151 TCTCCCAGATGGGGCGGAACTGG + Intronic
1167410945 19:49343384-49343406 TCTCCCAGGCGGACCTGAACTGG - Exonic
925438698 2:3865315-3865337 TAAGCCAGATGGAGATGAAAAGG - Intergenic
929995990 2:46826537-46826559 TCTCTCAGATGAGGAAGAACTGG + Intronic
932119222 2:69082789-69082811 TCTCCTAGATGGAGATGGCTTGG - Intronic
932363842 2:71133126-71133148 TCTCCCAGAGAGTGAAGAACAGG + Exonic
932775847 2:74527974-74527996 TCCCCTAGTTGGCGATGAACAGG + Exonic
937139238 2:119584752-119584774 TCAACCTGATGGAGATGAAATGG - Intronic
941590027 2:167408438-167408460 TCTCCTCAAAGGAGATGAACAGG + Intergenic
944929116 2:204498282-204498304 TCTCACAGGTGCAGATCAACAGG - Intergenic
945819896 2:214651150-214651172 TCTCCCAGGTGGATTTCAACGGG - Intergenic
947983019 2:234426044-234426066 TGTCCCAGAGGGTGAGGAACTGG - Intergenic
948659668 2:239499217-239499239 TCACCCAGCTGGAGATGTAAGGG - Intergenic
948669035 2:239554886-239554908 CCTCTGAGAGGGAGATGAACAGG + Intergenic
949054744 2:241921753-241921775 TCCCAGAGATGGAGATGCACTGG - Intergenic
949054838 2:241922074-241922096 TCCCAGAGATGGAGATGCACTGG - Intergenic
1173075380 20:39813610-39813632 TCTCCCAGCTGGGGTAGAACTGG + Intergenic
1173222022 20:41138397-41138419 TCCCCCAGAGGGAGATGAGTAGG - Intronic
1173310167 20:41890202-41890224 TCTCCCAGAGGGCAATGAATTGG - Intergenic
1173412499 20:42826285-42826307 TTTACCAGATGGAGAGGAAAAGG + Intronic
1174400076 20:50271203-50271225 TTTCCCAGATGGAGACCAAAGGG - Intergenic
1174725841 20:52860926-52860948 TCTTCCAAATGGAGATGTGCAGG - Intergenic
1175313753 20:58031019-58031041 TCTCCCAGAAGGGGAAGCACAGG + Intergenic
1175832629 20:61974560-61974582 TGTCACAGGTGGAGATGAGCTGG - Intronic
1176786971 21:13268961-13268983 TCTTCCAAATGGAAATGCACTGG + Intergenic
1178797286 21:35756604-35756626 TCTCCCAGATAGAGAGAAAATGG + Intronic
1179286119 21:39978654-39978676 TCTCCCAGATTGAGAAGAAAAGG - Intergenic
1183870000 22:40734279-40734301 TCCCTCAGATGGAAATAAACAGG + Intergenic
950495462 3:13331482-13331504 TGTCCCAGATGGAGATGCTCGGG - Intronic
953850856 3:46464638-46464660 TTTCCCACATGGGGAGGAACAGG - Intronic
954584640 3:51722517-51722539 TCCCCCAGGTGGCGATGAAGCGG + Intergenic
955637956 3:61050830-61050852 TCTCCCAGCTGGAAGTGAAAGGG - Intronic
956778705 3:72587666-72587688 TCTCTAAGATGGAGATGATCAGG + Intergenic
959167189 3:102795128-102795150 TCTCAGAGACGGAGATGAACAGG + Intergenic
962017969 3:131462791-131462813 TTTTCCTGATGGAGATGAAGAGG - Exonic
968675115 4:1873045-1873067 ACTGCCAAATGGAGATGAAGAGG + Intronic
969391543 4:6894706-6894728 TCTCCCAGAGGCAGATGGACCGG + Intergenic
979059398 4:116037869-116037891 TCTGCCTGATGGATATGAAGTGG - Intergenic
987624647 5:20382607-20382629 TCTCTCACATAAAGATGAACAGG + Intronic
989346016 5:40430384-40430406 TGTCCCAGCTGGAGATGCTCTGG - Intergenic
992131039 5:73693038-73693060 TCTCCAAGAGGGAGATTGACTGG + Intronic
992954113 5:81890329-81890351 GGTCTCAGATGGAGATGAAGAGG + Intergenic
998286327 5:140864383-140864405 TCTCACAAATGGTGATGAGCAGG + Intronic
999846050 5:155481346-155481368 TCTTCAAGAGGGACATGAACTGG + Intergenic
1001832289 5:174798999-174799021 TCTCTAAAATGGAGATGAAATGG + Intergenic
1002293934 5:178218300-178218322 TGTCCCAGAAGGAGAGGAAAGGG + Intronic
1002876740 6:1217414-1217436 TGTCCCAGTGGGAGCTGAACCGG + Intergenic
1003348100 6:5289779-5289801 TCTGCCACATGGAGAAGAGCAGG + Intronic
1004063630 6:12222044-12222066 TCTCCCAGATGGAGAGCAGCCGG + Intergenic
1005350636 6:24931497-24931519 TCTCCCAGATGGAGATGAACTGG - Intronic
1007877086 6:45116503-45116525 TCTCCAAGATGCAGAGGGACAGG - Intronic
1009624839 6:66126362-66126384 GCTCCCAGATGGAGGTCAACTGG - Intergenic
1011607174 6:89117385-89117407 CCTCCTAGATGGAGAGGAATTGG - Intronic
1012081997 6:94770921-94770943 TCTCCCAGTTGGACTTGAAGGGG + Intergenic
1014737746 6:125113628-125113650 TCTCCCACACAGAGATCAACTGG - Intergenic
1016563422 6:145423806-145423828 TCTCCCAAGTGGAGATTAAGAGG + Intergenic
1017773031 6:157657832-157657854 TCTTCCAGATGGGGATAAAAAGG - Intronic
1017872654 6:158500296-158500318 TCTCCAAGAGGGATCTGAACAGG + Intronic
1018036434 6:159886636-159886658 TAACCCAGATGGTGCTGAACTGG + Intergenic
1018790751 6:167145724-167145746 TCTGCCGGCTGGATATGAACGGG + Intergenic
1021138418 7:16993624-16993646 CCTCCCAGATGGAAATGAGAAGG - Intergenic
1025210968 7:57019431-57019453 TCTCCCAGGTGGGGATAGACAGG - Intergenic
1025660987 7:63557416-63557438 TCTCCCAGGTGGGGATAGACAGG + Intergenic
1025723415 7:64036802-64036824 TCTCCCAAATGCTGCTGAACTGG + Intronic
1025752559 7:64306442-64306464 TCTCCCAAATGCTGCTGAACTGG + Intergenic
1026495902 7:70902931-70902953 TATCCCAGAAGGAGATGAGAAGG - Intergenic
1026558957 7:71432243-71432265 TCTCCCAAATGGAGTTGTATGGG + Intronic
1026970275 7:74463532-74463554 TCTCCCACTTAAAGATGAACAGG - Intronic
1026983050 7:74537847-74537869 GCTCCCAGATGGTGAAGAAGGGG + Intronic
1027164323 7:75823708-75823730 CCTCCCATCTGGAGATGAAAGGG - Intergenic
1027501421 7:78956643-78956665 TGTCACACATGGAGATGAAGAGG + Intronic
1029289464 7:99491068-99491090 TCTCCCTGATGTAGGTGAGCTGG - Intronic
1029613095 7:101637945-101637967 TCAACCAGATGGAGATAAAAAGG - Intergenic
1030090298 7:105852239-105852261 TCTCACAGATGGAGATCACCAGG + Intronic
1030141625 7:106310224-106310246 GCTCCAAGCTGGGGATGAACAGG - Intergenic
1033435263 7:141328112-141328134 TTTCCCAGATGGAGAAGATAGGG + Intronic
1035166054 7:156990535-156990557 TCTTCCTGATGGAGAGGCACGGG + Intergenic
1035315533 7:157995474-157995496 TCTCCCAGATGTGGCTGGACTGG - Intronic
1036567630 8:9951157-9951179 CCTCACAGGTGGAGGTGAACCGG - Intergenic
1039250256 8:35656077-35656099 TCTCCCAAATAAAGAAGAACAGG - Intronic
1040495512 8:47961531-47961553 TCTCTGAGAGGGAGATGACCTGG - Exonic
1045560388 8:103256115-103256137 TCTAACAGATGGAAATGAATAGG + Intergenic
1046028450 8:108753671-108753693 GCTCCTAAATGGAGATGAAAAGG - Intronic
1047324633 8:123824621-123824643 GGTTCCAGATGGACATGAACTGG - Intergenic
1047702815 8:127466658-127466680 TCTCCCAGCAAAAGATGAACTGG - Intergenic
1048132272 8:131710869-131710891 TCTGCCAGATGGAGCAGAACTGG + Intergenic
1049270243 8:141691742-141691764 GCTCTCAGATGAAGATGAAAAGG + Intergenic
1057387733 9:94619355-94619377 TTTCCCAGTTTGAGAGGAACTGG - Intronic
1060562107 9:124554332-124554354 GCCTCCAGATGGGGATGAACCGG - Exonic
1061464333 9:130766031-130766053 TTTGGCAGATGGAGATGAAGTGG + Intronic
1188262538 X:28037266-28037288 CATCCCAGATGGAGATGCACTGG + Intergenic
1189304725 X:39978383-39978405 TCACCCAAAAGGAGAGGAACAGG - Intergenic
1193757963 X:85431887-85431909 TCTCCCAACTGGATATGAAAGGG - Intergenic
1199944182 X:152652481-152652503 TCGCCTAGATGGATATGCACTGG - Intronic