ID: 1005352083

View in Genome Browser
Species Human (GRCh38)
Location 6:24946694-24946716
Sequence CCTTGGGCCCCTATTTCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 155}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005352083_1005352092 1 Left 1005352083 6:24946694-24946716 CCAAAAGAAATAGGGGCCCAAGG 0: 1
1: 0
2: 1
3: 21
4: 155
Right 1005352092 6:24946718-24946740 GTCTGGACCCTGCAGGAGGTAGG 0: 1
1: 0
2: 2
3: 34
4: 292
1005352083_1005352090 -6 Left 1005352083 6:24946694-24946716 CCAAAAGAAATAGGGGCCCAAGG 0: 1
1: 0
2: 1
3: 21
4: 155
Right 1005352090 6:24946711-24946733 CCAAGGGGTCTGGACCCTGCAGG 0: 1
1: 0
2: 2
3: 19
4: 246
1005352083_1005352091 -3 Left 1005352083 6:24946694-24946716 CCAAAAGAAATAGGGGCCCAAGG 0: 1
1: 0
2: 1
3: 21
4: 155
Right 1005352091 6:24946714-24946736 AGGGGTCTGGACCCTGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005352083 Original CRISPR CCTTGGGCCCCTATTTCTTT TGG (reversed) Intronic
905216455 1:36411715-36411737 CCTTCGGCCCCTACTTCTCCAGG - Intergenic
905857424 1:41323168-41323190 GCTTCTGCCCCTATTTCTCTGGG + Intergenic
908005951 1:59729796-59729818 TCTTAGGCCCCTACTCCTTTAGG + Intronic
908820443 1:68080611-68080633 CCTTGGGCACCTATAGCTATAGG - Intergenic
909664546 1:78118665-78118687 CTTTTGGACCCTATTTCTGTTGG + Intronic
914445360 1:147745661-147745683 CTTTGGTCCCCTATTTCGGTTGG - Intergenic
916708825 1:167382242-167382264 CCATGGGCCCATTCTTCTTTAGG - Intronic
916719767 1:167475512-167475534 CCTAGAGCCTCTATTTCATTAGG - Intronic
917771971 1:178289372-178289394 CCATGGGACCTTATTTCCTTAGG + Intronic
919882460 1:201909543-201909565 CCTTGAGCCCATATTTCTGAAGG + Intronic
922510730 1:226164661-226164683 CCTTGGATCCCCATTTCTTGTGG - Intronic
923883094 1:238125081-238125103 CCTTGGACACTTATTTATTTTGG - Intergenic
1064925648 10:20565818-20565840 CTTTGGGCCCCACTTTTTTTAGG + Intergenic
1066265473 10:33772310-33772332 GCTGGGGCCCCTGTGTCTTTGGG - Intergenic
1069487775 10:68835565-68835587 CTCTGGGCCTCTAGTTCTTTAGG + Intronic
1069487919 10:68836700-68836722 CTCTGGGCCTCTAGTTCTTTAGG + Intronic
1069783375 10:70970839-70970861 CCTTGGGCCCCTCCTCCTTACGG - Intergenic
1071236977 10:83660554-83660576 TCTTGGGCCTCTCTTTCTCTGGG + Intergenic
1071877670 10:89859989-89860011 CCTTGTGCTCCCATTTATTTTGG - Intergenic
1072854640 10:98934597-98934619 CATTGGCCCCCAATTTCTTCTGG + Intronic
1074699971 10:116084095-116084117 CCGTGGGCCCCTCTTTGTGTGGG - Intronic
1076728117 10:132422679-132422701 CCTTGGGCCCCTGATCCGTTTGG + Intergenic
1078164694 11:8871656-8871678 CCTTGGAACCCTAGTGCTTTGGG - Intronic
1079710341 11:23675650-23675672 CCTTGGCCCACTTTTTATTTGGG - Intergenic
1082160735 11:48885374-48885396 CCTGGGGTCCCTGTTTCTGTGGG + Intergenic
1082161631 11:48895032-48895054 CCTGGGGTCCCTGTTTCTGTGGG - Intergenic
1082167213 11:48963461-48963483 CCTGGGGTCCCTTTTTCTGTGGG - Intergenic
1082236365 11:49823238-49823260 CCTGGGGTCCCTGTTTCTGTGGG + Intergenic
1082239815 11:49857746-49857768 CCTGGGGTCCCTGTTTCTGTAGG + Intergenic
1082242336 11:49886605-49886627 CCTGGGGTCCCTGTTTCTGTGGG - Intergenic
1086725779 11:90182003-90182025 CCTTTGGCCCTTGTCTCTTTGGG - Intronic
1087031809 11:93714153-93714175 CCTTGGTCCCTTATTTAGTTTGG + Intronic
1087588944 11:100159854-100159876 CCATGGGCCACTATTTCTTCAGG + Intronic
1088881858 11:113979126-113979148 CCTTGTGTCCCTATTGCTTTGGG - Intronic
1089084766 11:115807496-115807518 CCTTGTGCCTCTGTTTCTTTAGG + Intergenic
1089286805 11:117412611-117412633 CCCTGGGACCCGATTTCTCTGGG + Exonic
1089683308 11:120131522-120131544 ACTTGGCCTCCTATTTCTTTGGG + Intronic
1093573618 12:20698803-20698825 TCCTGTGCCCCTACTTCTTTAGG - Intronic
1093953194 12:25187721-25187743 CCTTGGGGACCTTTTTGTTTTGG - Intronic
1094624578 12:32111254-32111276 CATTGGGCAGCTTTTTCTTTTGG + Intronic
1095991175 12:48035642-48035664 GCCTGGGCCCCTATTGCCTTTGG + Intergenic
1096023753 12:48343557-48343579 CCTGGGGCCCCCTTTTCTTCAGG - Exonic
1096452134 12:51752285-51752307 CCTGGGCCCCCTAATTCCTTAGG + Intronic
1096543675 12:52322675-52322697 CTTTGGGCCCTTGTTCCTTTGGG + Intergenic
1097287272 12:57887992-57888014 CCCTGGGCCCCAACTTCTCTGGG - Intergenic
1100844429 12:98644662-98644684 CCTTGGGCCCCGACTTCTTCCGG + Exonic
1101610319 12:106285206-106285228 GCTTGGGGGCCTATTTTTTTAGG - Intronic
1103778667 12:123384583-123384605 CTTTGGGGCCCTCTCTCTTTGGG + Intronic
1106814172 13:33388515-33388537 GCTTGGGCCCCAACTTCTATAGG - Intergenic
1106869425 13:34002805-34002827 CATTGGGGTCTTATTTCTTTAGG - Intergenic
1107441541 13:40432084-40432106 CCTTGGGCATTTTTTTCTTTGGG - Intergenic
1107939737 13:45372969-45372991 CCTTGGGCTCGTGTTTCCTTTGG + Intergenic
1113227090 13:108170591-108170613 CATGGGCCCCCAATTTCTTTTGG - Intergenic
1116528925 14:45943029-45943051 TCTTTGGCCCATCTTTCTTTTGG + Intergenic
1119380213 14:74223766-74223788 CCCTGAGCCCCTATTACTTGGGG + Intergenic
1119441211 14:74630007-74630029 CCTTGGCCTCCTTTTTCTTCAGG - Intergenic
1122207141 14:100153449-100153471 CCTTGGGCCCCATCTTCTCTGGG + Intronic
1123015355 14:105371178-105371200 CATCGGGCCCCTGTGTCTTTTGG + Intronic
1123840217 15:24240450-24240472 CCTAGGGCCAGAATTTCTTTTGG + Intergenic
1127118837 15:55753771-55753793 CCCTGGGCCCCTATTTGTGTAGG + Intergenic
1132519434 16:380755-380777 CTTTGAGCTCCTGTTTCTTTCGG - Intronic
1133109851 16:3541558-3541580 CCTTTGGCCCCTAGTCCCTTGGG + Intronic
1137927723 16:52557124-52557146 CCTTGGGACCATATTTATCTAGG + Intergenic
1138412176 16:56849411-56849433 CCTTGAGCTTCTATTTCTTGGGG + Intronic
1141264488 16:82484034-82484056 CCTTGGGATTCTATTTCTTGGGG - Intergenic
1141711028 16:85699089-85699111 CCTTGGGCCCCAGTTCCTTTAGG + Intronic
1142719572 17:1767097-1767119 GCTTGGGCCTTTATTTCTCTAGG + Intronic
1143289497 17:5818227-5818249 CCCTTGGCCCCTGCTTCTTTGGG + Intronic
1144297221 17:13887608-13887630 CCTTAGGCCTTAATTTCTTTTGG + Intergenic
1144999117 17:19291112-19291134 CCTTTTGCCCCAATTTCTTCTGG - Intronic
1146043502 17:29481604-29481626 CCTTGGGAGCCTCTTTCTTTTGG + Intronic
1146225584 17:31063112-31063134 CCTTGGGCCCCTGTCTCTATTGG + Intergenic
1146587369 17:34093846-34093868 CCTAGGGCCCCTAGTCATTTGGG + Intronic
1148735548 17:49862821-49862843 CCTTGGGCCCCTCTGTAATTAGG + Intergenic
1149078405 17:52624775-52624797 CCATGGCACCCTAGTTCTTTTGG + Intergenic
1149442972 17:56690733-56690755 CCCTGGGCCCCTATTCCTTGTGG - Intergenic
1151261400 17:72918736-72918758 CCGGGGGCCCTTCTTTCTTTGGG - Intronic
1152635111 17:81427642-81427664 CCCTGGGCCCCCATGTCCTTGGG + Intronic
1152645240 17:81465663-81465685 CCTTGGCCCCCTATTTTTCTCGG + Exonic
1154101896 18:11483392-11483414 AATTGGGCCCCAATTTCTTTGGG - Intergenic
1154978581 18:21483256-21483278 CCCTTGGCCCCTGTTTCTTTGGG - Intronic
1156075719 18:33276578-33276600 CCTTGGAAACCTTTTTCTTTTGG - Intronic
1157885976 18:51366968-51366990 CCTTTGGGCCCTGTTTCCTTCGG + Intergenic
1158039076 18:53070542-53070564 ACTTGGGCCCTGATTTGTTTAGG + Intronic
1166498902 19:43326806-43326828 CCTTGGGCCCAGAGTTCCTTGGG + Intergenic
1167645524 19:50703243-50703265 GCTGGGGCCCATGTTTCTTTGGG + Intronic
930221389 2:48750046-48750068 CCTTGGGCCTTTGTTTCTTTAGG + Intronic
930347355 2:50200979-50201001 CCATGGGTCTCTATTTCATTAGG + Intronic
935317708 2:101853079-101853101 ACTTGGGGCCTTATTTCCTTTGG - Intronic
937452344 2:122012001-122012023 CCTTAGCTTCCTATTTCTTTTGG - Intergenic
942031582 2:171967614-171967636 CCTTGGGCCACTTTGTTTTTTGG - Intronic
942304143 2:174589431-174589453 CCTTGGGGCTCTACTTCTCTGGG - Intronic
942657812 2:178232365-178232387 CCTTGGTGCCCTATGTCTCTGGG - Intronic
942825373 2:180169278-180169300 CCTGTGGCCCCTTTTTTTTTTGG - Intergenic
945045410 2:205777201-205777223 CATGTGGCCTCTATTTCTTTAGG - Intronic
947858440 2:233340652-233340674 CTTTGGGACCAGATTTCTTTGGG + Intronic
1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG + Intronic
1172346989 20:34209690-34209712 CCTTGGGCCCCTCTGGATTTGGG + Intronic
1172774570 20:37399504-37399526 CCTTGGTCCCCTATCTGTCTAGG + Intronic
1175683076 20:61005602-61005624 CCTTGGGCTCCTGTGTCTTCTGG - Intergenic
1175871597 20:62211883-62211905 GCCTGGGCCCCTATTTCCTGAGG + Intergenic
1178883375 21:36465800-36465822 GCTTGGAACCCTATTTGTTTTGG - Intronic
1180024168 21:45149181-45149203 TCTTAGGCCCCTATTCCTCTCGG + Intronic
1180876215 22:19176422-19176444 CCTTGAGCCCCTCCTTCTTCAGG + Exonic
1182982819 22:34687581-34687603 GCTAGGGCCCCTAATTCTATAGG + Intergenic
1184819214 22:46896186-46896208 CCTTTTGCCCATTTTTCTTTTGG + Intronic
1185115173 22:48929967-48929989 CCTTGGTCTGCTTTTTCTTTGGG + Intergenic
950592891 3:13951653-13951675 CCTTGGGCCCCCATCACTCTTGG + Intronic
951113958 3:18838004-18838026 CTTCTGGCCCCTATTTATTTGGG + Intergenic
954632204 3:52053745-52053767 CCTTGGGCCCCTCTACCTGTTGG - Intronic
954657915 3:52208356-52208378 GCCTGGGCCACTCTTTCTTTTGG + Intronic
957642867 3:82881125-82881147 TCTTGGGTCTCTATTTTTTTAGG + Intergenic
959164551 3:102759707-102759729 GGTTGGGCCCCTATCGCTTTGGG - Intergenic
959737632 3:109678171-109678193 CCAAGGCCACCTATTTCTTTAGG + Intergenic
960287438 3:115845425-115845447 CCTTGGTCCCCTACCACTTTGGG + Intronic
962234019 3:133692740-133692762 CCTTTGGCCCTTATTCCTCTCGG + Intergenic
970625620 4:17875727-17875749 ACTTGGGGACCTATTTTTTTTGG + Intronic
974808093 4:66907758-66907780 CCTTTGGCCCATATTTTTATTGG + Intergenic
976334348 4:83868458-83868480 CCTATGGCCTCCATTTCTTTAGG + Intergenic
978094441 4:104758375-104758397 CCTCGGGCCCCTATTTGTTTGGG + Intergenic
978697764 4:111603246-111603268 CTTTGGGACCCAGTTTCTTTTGG - Intergenic
979734201 4:124062544-124062566 CCTTGGGCCCCAACTCCTTCGGG + Intergenic
983751752 4:171282477-171282499 CCCTGTTCCCCCATTTCTTTAGG - Intergenic
984258865 4:177420045-177420067 CCCTAGGCCCCTATTTCAATGGG + Intergenic
985840772 5:2303623-2303645 GCTTGGCCTCTTATTTCTTTGGG - Intergenic
989119654 5:37991540-37991562 CCTTGGGTCCCTCTTTTCTTCGG + Intergenic
989626905 5:43438393-43438415 CCCTTGGCTCCTGTTTCTTTTGG - Intergenic
990123661 5:52487159-52487181 CCCTTGCCCCCTATTTATTTTGG - Intergenic
991422144 5:66452628-66452650 TCTGGGGCCCCCATATCTTTAGG - Intergenic
992189775 5:74280421-74280443 CCTTGGGGACCCATTGCTTTTGG + Intergenic
994155644 5:96500978-96501000 CCTGGGGCCACCATTTCTCTGGG - Intergenic
1000519895 5:162282452-162282474 CCCTTGGCTCCAATTTCTTTGGG + Intergenic
1001879543 5:175231480-175231502 CTTTGAGCCCCTATCTCTTCTGG + Intergenic
1005296437 6:24431995-24432017 CCTTGGCCCCCCATTTTTTTTGG - Intronic
1005352083 6:24946694-24946716 CCTTGGGCCCCTATTTCTTTTGG - Intronic
1005857371 6:29872759-29872781 CAGTGGGGCACTATTTCTTTAGG + Intergenic
1005922695 6:30415948-30415970 CCCTGGGGCCCAATTCCTTTGGG - Intergenic
1006059545 6:31410267-31410289 CCCTTGGCCCCTATTCCCTTAGG + Intronic
1006072034 6:31505338-31505360 CCCTTGGCCCCTATTCCCTTAGG + Intronic
1016617954 6:146074692-146074714 TCTTTGGCCCCTTTTGCTTTTGG + Intronic
1017456775 6:154607723-154607745 CCTTGGGGCCTCCTTTCTTTAGG + Intergenic
1017571944 6:155754507-155754529 CCTTGGGCCCTTCTTTTTCTTGG - Intergenic
1018602138 6:165555801-165555823 CCTTGGGCACCCATCTCTGTGGG - Intronic
1018743697 6:166748578-166748600 CCTCGGGCCCCCATTTCCTCAGG + Intronic
1018743781 6:166748770-166748792 CCTTGGGCCCCCATTTCCTCAGG + Intronic
1018743827 6:166748881-166748903 CCTTGGGCCCCCATTTCCTCAGG + Intronic
1018743874 6:166748993-166749015 CCTTGGGCCCCCATTTCCTCAGG + Intronic
1018744095 6:166749553-166749575 CCTCGGGCCCCCATTTCCTCAGG + Intronic
1019597553 7:1865202-1865224 CCTTGGGCCCCTGACTCTGTGGG - Intronic
1022186100 7:27970926-27970948 CCTTGGGCATCCATTTCTTTAGG + Intronic
1023165369 7:37338218-37338240 CCTTGAGCCTCAGTTTCTTTGGG - Intronic
1026688580 7:72533453-72533475 CCCTGGCCCCCACTTTCTTTGGG + Intergenic
1029426058 7:100494502-100494524 CCCTGGGCCCCTTCTTCTCTCGG - Exonic
1030750123 7:113222234-113222256 CCTTTGGCCCATGTTTCTTTTGG + Intergenic
1034374476 7:150630320-150630342 TTTAGGGACCCTATTTCTTTAGG + Intronic
1034538364 7:151740013-151740035 GCCTGGGCCCCTATCTTTTTGGG - Intronic
1036013651 8:4756700-4756722 CCATGGTTCCATATTTCTTTTGG + Intronic
1036977279 8:13427687-13427709 CCTTGGGCCCCTTGTTCTCATGG + Intronic
1039194745 8:35018553-35018575 GCCTGGGCCAGTATTTCTTTTGG - Intergenic
1039840084 8:41286777-41286799 GCTAGGGCCCCCATCTCTTTAGG - Intronic
1043562586 8:81511675-81511697 CCCTGGACACTTATTTCTTTTGG - Intergenic
1045766897 8:105683066-105683088 CCTTGGGCCCCTTTTTATAAGGG + Intronic
1045984237 8:108229896-108229918 CCTTAGTCCCCTCTTTTTTTAGG - Intronic
1047132992 8:122042766-122042788 CCTTGGGCATCTCTTTCTCTAGG + Intergenic
1048208278 8:132433062-132433084 TCTTTGACCCCAATTTCTTTGGG - Intronic
1048937605 8:139369841-139369863 CCTTGGGCCCCCATTCCCCTGGG - Intergenic
1049107653 8:140623796-140623818 CCTGGGGCCTCTTTTTCTTGTGG - Intronic
1052672912 9:31581076-31581098 CCCTGGGACCCTATTTCCTTGGG - Intergenic
1053257063 9:36626653-36626675 TCTTGGGCTGCTATTTCTTGAGG - Intronic
1055755275 9:79551353-79551375 CCAAGGGCTCCAATTTCTTTTGG + Intergenic
1057255728 9:93545498-93545520 CCTATTGCCCCTGTTTCTTTTGG + Intronic
1060717712 9:125949393-125949415 CCTTTGCTCCCTCTTTCTTTTGG - Intronic
1060960298 9:127676066-127676088 CCTAGGGGCCCTTTTTGTTTGGG + Intronic
1187432017 X:19233846-19233868 CATGGGGCCCCAATTTCTATGGG - Intergenic
1187477744 X:19626867-19626889 CCTGGGTCCCCTCTTTCTCTAGG + Intronic
1193458220 X:81756636-81756658 TATTGGGCCCCAATATCTTTTGG - Intergenic
1197274784 X:124465568-124465590 CCTTGATCTCTTATTTCTTTTGG + Intronic
1200050102 X:153424645-153424667 CCTGGGACCCCTTTGTCTTTGGG + Intergenic