ID: 1005360197

View in Genome Browser
Species Human (GRCh38)
Location 6:25024127-25024149
Sequence GTCCCGCGGCGCCACCGGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 31
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 28}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005360197_1005360207 14 Left 1005360197 6:25024127-25024149 CCTTACCGGTGGCGCCGCGGGAC 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1005360207 6:25024164-25024186 GGCGATTTCCACTTGTTTGCTGG 0: 3
1: 3
2: 4
3: 7
4: 87
1005360197_1005360209 23 Left 1005360197 6:25024127-25024149 CCTTACCGGTGGCGCCGCGGGAC 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1005360209 6:25024173-25024195 CACTTGTTTGCTGGCAATGCAGG 0: 1
1: 0
2: 5
3: 16
4: 167
1005360197_1005360210 24 Left 1005360197 6:25024127-25024149 CCTTACCGGTGGCGCCGCGGGAC 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1005360210 6:25024174-25024196 ACTTGTTTGCTGGCAATGCAGGG 0: 1
1: 0
2: 3
3: 15
4: 121
1005360197_1005360211 29 Left 1005360197 6:25024127-25024149 CCTTACCGGTGGCGCCGCGGGAC 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1005360211 6:25024179-25024201 TTTGCTGGCAATGCAGGGCCTGG 0: 1
1: 1
2: 5
3: 22
4: 200
1005360197_1005360200 -8 Left 1005360197 6:25024127-25024149 CCTTACCGGTGGCGCCGCGGGAC 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1005360200 6:25024142-25024164 CGCGGGACACCCCCTCCTGCTGG 0: 1
1: 0
2: 2
3: 9
4: 138
1005360197_1005360201 -7 Left 1005360197 6:25024127-25024149 CCTTACCGGTGGCGCCGCGGGAC 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1005360201 6:25024143-25024165 GCGGGACACCCCCTCCTGCTGGG 0: 1
1: 0
2: 0
3: 15
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005360197 Original CRISPR GTCCCGCGGCGCCACCGGTA AGG (reversed) Intronic
900989244 1:6090485-6090507 CTGCGGCGGCGCCACCGGTTAGG + Intronic
903446397 1:23424939-23424961 GTCCCCCGGCGCCCCTGGAAGGG - Intergenic
1063504018 10:6580176-6580198 GCCCCGCGCCGCCGCCGGGAGGG - Intronic
1074591900 10:114821800-114821822 CTCCGGCGGCGGCACCGGTTGGG - Exonic
1076095848 10:127734986-127735008 GACCCGCAGGGCCACCGGCATGG - Intergenic
1088186446 11:107176627-107176649 GTCCCACGGCACCACGGGAAAGG + Intergenic
1114269308 14:21091480-21091502 GGGCCGGGGCGCCACCGGCAAGG - Exonic
1120167710 14:81219554-81219576 GACCCGAGTCGCCAACGGTACGG + Intronic
1121645885 14:95516738-95516760 CTCCCGCGGGGCCACCGGGCGGG - Intronic
1122131239 14:99605265-99605287 GTCCCGCGAGGCCGCCGGTGGGG - Intergenic
1125679942 15:41524206-41524228 CTCCCGCGGCACCACCTGCAAGG + Exonic
1139530454 16:67540080-67540102 GTCCAGCGGCGTCTCCGGGATGG + Exonic
1142673060 17:1496388-1496410 GTCCCGCAGCCCCACCTGTGAGG + Exonic
1153238758 18:3012839-3012861 GTCCTGCGGCGGCGGCGGTAGGG + Intronic
1160204617 18:76822646-76822668 GGCGCGCGGCGACTCCGGTAAGG + Intronic
1160511013 18:79453392-79453414 GTGCCACGGCGCCATGGGTAAGG + Intronic
1160982748 19:1823744-1823766 GTCCCGCGGTGCCCCCGGCCCGG - Exonic
1163632345 19:18423945-18423967 GTCTGGGGGCGCCACCGGTTGGG - Intronic
1166996673 19:46722804-46722826 GTCCCGGGGCAGCAGCGGTAAGG - Exonic
926097514 2:10091637-10091659 GCCCCGCGGCGCGGCCGCTAAGG - Intergenic
930326212 2:49922168-49922190 GTCCAGCAGCACCACGGGTATGG - Exonic
1169116856 20:3071793-3071815 GTCCCGCGGCGCTCCGGGGAGGG + Intronic
953947698 3:47163765-47163787 GGCCCGCGCCGCCACCCGTCAGG + Intronic
969436750 4:7193156-7193178 GTCCCGCGGTGTCCCGGGTAGGG - Intronic
981044412 4:140252707-140252729 GCCCCGCGGCTCCACCGGGAAGG + Intergenic
1005360197 6:25024127-25024149 GTCCCGCGGCGCCACCGGTAAGG - Intronic
1015704447 6:136072782-136072804 GTCCCGCAGCTCCACCGAAAAGG - Intronic
1015785903 6:136921770-136921792 GTCCCGCCGCTGCACCGGGAGGG + Intergenic
1055626053 9:78178603-78178625 GTCCCACGGTGCCACGGGAAAGG + Intergenic
1061418025 9:130458568-130458590 GTCCCACGGCGCCACAGGAAAGG + Exonic
1196434822 X:115665236-115665258 GTCCCACAGCGCCACAGGAAAGG + Intergenic