ID: 1005361657

View in Genome Browser
Species Human (GRCh38)
Location 6:25036802-25036824
Sequence CTCCTGTTCTTCTGGGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 316}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005361657_1005361662 -8 Left 1005361657 6:25036802-25036824 CCATTTTCCCAGAAGAACAGGAG 0: 1
1: 0
2: 1
3: 27
4: 316
Right 1005361662 6:25036817-25036839 AACAGGAGTCACACCCCTAGGGG 0: 1
1: 0
2: 0
3: 5
4: 84
1005361657_1005361661 -9 Left 1005361657 6:25036802-25036824 CCATTTTCCCAGAAGAACAGGAG 0: 1
1: 0
2: 1
3: 27
4: 316
Right 1005361661 6:25036816-25036838 GAACAGGAGTCACACCCCTAGGG No data
1005361657_1005361660 -10 Left 1005361657 6:25036802-25036824 CCATTTTCCCAGAAGAACAGGAG 0: 1
1: 0
2: 1
3: 27
4: 316
Right 1005361660 6:25036815-25036837 AGAACAGGAGTCACACCCCTAGG 0: 1
1: 0
2: 0
3: 12
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005361657 Original CRISPR CTCCTGTTCTTCTGGGAAAA TGG (reversed) Intronic
900040051 1:453094-453116 CTCCAGTTCTTCTGACACAAAGG + Intergenic
900061483 1:688070-688092 CTCCAGTTCTTCTGACACAAAGG + Intergenic
900803921 1:4755100-4755122 CTCCTGTCCTGGTGGGAGAAGGG + Intronic
901309680 1:8259393-8259415 TTCCCTTTCTTCTGGGAATAAGG + Intergenic
901661510 1:10800642-10800664 CTCCTGAGCTTCTGAGATAAAGG - Intergenic
902069271 1:13719653-13719675 CTCCTGTTCTTTTTAAAAAATGG + Intronic
903871474 1:26438113-26438135 CTCATATTCTTCAGGGATAAAGG - Intronic
904328313 1:29741885-29741907 TTCCTGTTATTGTGGGAAACAGG - Intergenic
905455620 1:38086057-38086079 CTCCTGACCTTCTGGACAAAGGG + Intergenic
906738658 1:48158686-48158708 CTCCTTTTCTTCTGGTAAAGGGG + Intergenic
907273662 1:53305144-53305166 CACCTGTTTTTGTGGGAGAATGG - Intronic
907603202 1:55790434-55790456 GGCCCCTTCTTCTGGGAAAAAGG + Intergenic
908291662 1:62673233-62673255 CTCCTTTTCTGGTGGGAAAAAGG + Intronic
908661032 1:66435300-66435322 CTGCTTTACTACTGGGAAAAGGG - Intergenic
908845236 1:68317806-68317828 CTGCTTTTCTTCTGGGCACATGG - Intergenic
909515389 1:76501469-76501491 CTCTTTTTATTCTGGGTAAAGGG + Intronic
909729351 1:78873915-78873937 TTCCTGTTCATCTGGGGAGAGGG - Intergenic
909884838 1:80928283-80928305 GCTCTGTTCTTCTGGAAAAAAGG + Intergenic
912190536 1:107334421-107334443 CTCCAGTGCTGCTGGGAACAGGG + Intronic
913297966 1:117340106-117340128 CCTCTGTTCTTGAGGGAAAATGG + Intergenic
913395722 1:118369680-118369702 CTCCTTTTTTTCTGCAAAAATGG - Intergenic
914860010 1:151378028-151378050 CTCCTGTCCTTCTGGGACACTGG - Intergenic
917114420 1:171587835-171587857 TTCCTTTTCTGCTTGGAAAAGGG - Intronic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
921334459 1:214072363-214072385 AGCTTGTGCTTCTGGGAAAATGG - Intergenic
924109845 1:240688011-240688033 CTACTGTCCTTCAGAGAAAAAGG - Intergenic
924517095 1:244775211-244775233 CTCCTGTGCTTTTGGCAATAAGG - Intergenic
1063171205 10:3511483-3511505 CCCCTGTTCTTCTGTAAAACGGG + Intergenic
1063259984 10:4377158-4377180 CTCTTGTTCTACTGGGAGGAGGG + Intergenic
1063559284 10:7111522-7111544 CCCCTGTTCTTCTGGAAGGATGG + Intergenic
1065739619 10:28785075-28785097 CTTCCCTTCTTGTGGGAAAAGGG + Intergenic
1066667716 10:37802372-37802394 CTCCTGTTCTTAGGGTTAAAGGG - Intronic
1067199567 10:44155660-44155682 CTTCTGTGCGTCTGGGAACATGG - Intergenic
1067817699 10:49495050-49495072 CTCCTGCCCTTCTGGGACAAAGG + Intronic
1069953486 10:72035618-72035640 CACCTGGTCTGCTGTGAAAAGGG + Intergenic
1071808948 10:89156906-89156928 CTCTTATTTTTCTGAGAAAAGGG - Intergenic
1072204054 10:93186964-93186986 CTCCCTTTCATCTGGGAAGAGGG + Intergenic
1073033953 10:100550025-100550047 CTCCACTTCTTTTGGGAAAGAGG + Exonic
1073394542 10:103207208-103207230 TTCCTGTTCATCTGGGGAAAGGG - Intergenic
1075053875 10:119203900-119203922 CTCGTGGTCTTCTTGAAAAATGG - Intergenic
1075417390 10:122274801-122274823 CTGCTATTGTTCTGGGAAAGTGG - Intronic
1076837879 10:133030206-133030228 CTCCTGTTCCTCCGGGACACAGG + Intergenic
1076966275 11:89001-89023 CTCCAGTTCTTCTGACACAAAGG + Intergenic
1078572345 11:12470130-12470152 ATTTTGTTTTTCTGGGAAAAAGG + Intronic
1079413597 11:20212341-20212363 CTGGTGTTCTTCTAAGAAAAGGG + Intergenic
1079502897 11:21121639-21121661 CTCCTATTCTTCTGAGATAGTGG - Intronic
1079540243 11:21564418-21564440 ATCCTGTTCACCTGAGAAAATGG - Intronic
1082867874 11:57916406-57916428 CTACTTTTCACCTGGGAAAATGG + Intergenic
1083284912 11:61652170-61652192 CTCCTGTATTTCTGGTAAACTGG - Intergenic
1083644444 11:64164519-64164541 CTCCTGCTGTTCTGGGGCAAGGG + Intronic
1085114890 11:73922243-73922265 CTACTTTTCTGCTGGGAAGAAGG + Intronic
1086284090 11:85225476-85225498 CTCCTCTTCTCCAGGGAAAGAGG + Intronic
1086403202 11:86477905-86477927 CTGTTGTTCTTCTGAGAACATGG + Intronic
1091061269 11:132464628-132464650 CTACTTTTTATCTGGGAAAATGG + Intronic
1091714079 12:2764641-2764663 CTCCAATTTCTCTGGGAAAATGG - Intergenic
1091946491 12:4549563-4549585 CTCCTGTCCTTCTGGAACAACGG + Intronic
1093771773 12:23026522-23026544 TACCTCCTCTTCTGGGAAAAGGG + Intergenic
1095878553 12:47107492-47107514 TTCTGCTTCTTCTGGGAAAATGG - Intronic
1096198729 12:49665898-49665920 CTCCTGAACTTCTGTAAAAAGGG + Exonic
1098213307 12:68188557-68188579 CTCTTATTCCTCTGGGAAATAGG - Intergenic
1098720659 12:73893450-73893472 CTCCTCTTCTTCTAGGGGAAGGG - Intergenic
1098921298 12:76304571-76304593 ATGCTGTTCTTCTGGAAGAAAGG - Intergenic
1099365252 12:81759393-81759415 CTCCTCTTCCTCTGGAACAAGGG + Intronic
1099646700 12:85366722-85366744 ATCCTGTGCTTCGGGGAAAAAGG - Intergenic
1099872707 12:88369324-88369346 TTCCTGTTCATCTGGGGAGAGGG - Intergenic
1100082970 12:90875618-90875640 AAGCTGTTCTTCTGGCAAAAAGG - Intergenic
1101604382 12:106236967-106236989 CTGCTGTTCCTCTGTGAAATGGG + Intergenic
1101884929 12:108654514-108654536 CTTCTGTTATTCTAGGAAAATGG - Intronic
1103044168 12:117721625-117721647 CTCCTCTTCTTCTGGGGAGGAGG - Intronic
1104097889 12:125575995-125576017 CTTGTGTACTTCTGGAAAAAAGG + Intronic
1107373821 13:39780903-39780925 TTTCTTTTCTTCTTGGAAAATGG + Intronic
1108201721 13:48050762-48050784 CTCCTATTCTTCTCAGAGAAGGG + Intergenic
1109020965 13:57092577-57092599 CTTTTGTTTGTCTGGGAAAATGG + Intergenic
1109609111 13:64740037-64740059 ACCTTGTTTTTCTGGGAAAAAGG + Intergenic
1109858579 13:68167247-68167269 CACATGTTCTTCTTGTAAAATGG + Intergenic
1110248215 13:73352136-73352158 CACCTCCTCTTCTGGGAAAGGGG - Intergenic
1110813724 13:79839117-79839139 AACCTGTTCCTCTAGGAAAAGGG + Intergenic
1110882042 13:80583933-80583955 CTGCTTTTCTCCTGGGAAAGTGG - Intergenic
1111234514 13:85391156-85391178 CTCCTGTTATGCAGGGAAAATGG - Intergenic
1111764667 13:92513147-92513169 ATACTGTTCTTCTAGGAGAAGGG + Intronic
1111803920 13:93014783-93014805 CCCCTGTACTTCAGGCAAAAGGG + Intergenic
1112434986 13:99385430-99385452 CTGATGTTCTTGTGGGAAGAGGG + Exonic
1116039923 14:39673745-39673767 TTCCTTTTCTTTGGGGAAAATGG - Intergenic
1116808092 14:49512777-49512799 CTCCTGGGCTCCTGAGAAAAAGG + Intergenic
1118331255 14:64817695-64817717 CTCCTGTACATAAGGGAAAAGGG + Intronic
1118550421 14:66944043-66944065 ATCTTGTTTTTCTGGAAAAAGGG - Intronic
1119272738 14:73323984-73324006 CTCCTGCTCTTCAGGGGAGAAGG - Intronic
1119417413 14:74482326-74482348 CTCTTTTTCTTCATGGAAAAAGG + Intronic
1120379432 14:83755562-83755584 CTCCTTTTCTTTTGTGAAAGTGG - Intergenic
1120850694 14:89166468-89166490 CTTCTGTTTTTCTGTGAAATGGG - Intronic
1121493655 14:94377687-94377709 CTCCTCTTCATCTGGGGAGAAGG + Exonic
1121875236 14:97445448-97445470 CATCTGTTTTTCTGGGAATATGG + Intergenic
1122015546 14:98792447-98792469 CTCTTTTTCCTCTGGTAAAATGG + Intergenic
1122476994 14:102017191-102017213 CTCCTGTTCAACTTGGAAAGTGG + Exonic
1122914813 14:104853950-104853972 CTGCGGTTCATCAGGGAAAATGG - Intergenic
1124142692 15:27091067-27091089 TTCCTGTTCTTAAGGGAGAAAGG + Intronic
1125821486 15:42635934-42635956 CTCCTGATTTTCTGTGATAAAGG - Intronic
1126232637 15:46344743-46344765 CTCCTGTTGCTTTGGGAAAAGGG + Intergenic
1127306048 15:57706709-57706731 ACCCCGTTCTTCCGGGAAAATGG + Exonic
1128671331 15:69576616-69576638 CTCTTGTTTTTTTGGGGAAAGGG + Intergenic
1129444466 15:75607155-75607177 CTCCTCTCCTCCTGGGAAAGCGG - Intronic
1130375716 15:83327036-83327058 CTCTTGATTTTCTGAGAAAATGG + Intergenic
1131875035 15:96796802-96796824 CAGCTCTTCTTCTGAGAAAACGG + Intergenic
1132096158 15:98986634-98986656 CACCTGTACTTCTGGCCAAATGG - Intronic
1132441855 15:101874524-101874546 CTCCAGTTCTTCTGACACAAAGG - Intergenic
1132633877 16:933487-933509 CCCCTGCTCTCCTGGGAAAGGGG + Intronic
1133293077 16:4735377-4735399 CCTCTGTACTTCTGGGAATAGGG - Intronic
1133489429 16:6252544-6252566 ATCCTGTTCTTCTGGCCAACTGG - Intronic
1133973466 16:10583206-10583228 CTCCTGTCCCTCTAGGAAGATGG + Intergenic
1134313573 16:13098064-13098086 CTCCGTTTCTTCTGCGAAATGGG - Intronic
1134381792 16:13734137-13734159 CTGCTGTTCAACGGGGAAAAAGG - Intergenic
1134901570 16:17942829-17942851 CTCCTGGTCCTGTGGGAAGAAGG - Intergenic
1137541694 16:49367337-49367359 CTCCTGGCCTTGTGGGATAAGGG - Intergenic
1138212693 16:55176351-55176373 CTCCAGCTACTCTGGGAAAATGG + Intergenic
1138262449 16:55634810-55634832 CCCCAGTTCTTTGGGGAAAATGG - Intergenic
1138290130 16:55839741-55839763 GTGCTATTCATCTGGGAAAATGG - Intergenic
1138589398 16:57991516-57991538 CTTCTGTCCATCTGGGAAGATGG + Intergenic
1140844798 16:78876362-78876384 CTCCTTTCCTTTTGTGAAAAAGG + Intronic
1140898479 16:79347109-79347131 TTCCTGTTCTTGTGAGAAACTGG + Intergenic
1140931861 16:79635137-79635159 CCCCTCTTCTTCTCGGGAAAGGG + Intergenic
1141695845 16:85619038-85619060 CTCCAGTCTTTTTGGGAAAAGGG - Intronic
1142617868 17:1147021-1147043 CTCCTGTCTTTCTGGGCACATGG + Intronic
1143323782 17:6085022-6085044 CTCTGGTTCTTCTGGAAACAGGG - Intronic
1144232319 17:13220471-13220493 CTGCTGGGCTTCTGGGAAGAGGG + Intergenic
1145051072 17:19661281-19661303 CTCCTTTTCCTATGGGAAGATGG + Intronic
1147574958 17:41593665-41593687 CTCCTGCTCTCTGGGGAAAAGGG - Intergenic
1149442588 17:56687320-56687342 CTCATGGTCTTCTGCTAAAATGG - Intergenic
1149689714 17:58565092-58565114 CCCCTGCTCTCCTGGGAAGAGGG - Intronic
1154933803 18:21029920-21029942 CTCATGTTCTTTTAGGGAAAAGG + Intronic
1156892156 18:42203344-42203366 CTGCTGATCTTGTGGGAAACTGG + Intergenic
1157842893 18:50976126-50976148 TTATTGTTCTACTGGGAAAAAGG + Intronic
1158694401 18:59690783-59690805 CACCTGTTCTTGTGGGAAGGCGG + Intronic
1158980536 18:62756353-62756375 CTCCTCTCCTTCTGGGCACATGG - Intronic
1160643078 19:158625-158647 CTCCAGTTCTTCTGACACAAAGG + Intergenic
1160987604 19:1846483-1846505 CCCCCGTTCCTATGGGAAAAAGG - Intronic
1161294951 19:3514846-3514868 TTCCTGTTCCCCTGGGAAATGGG - Intronic
1161734582 19:5983599-5983621 CTCCTCTCTTGCTGGGAAAAGGG - Intergenic
1162226349 19:9225791-9225813 GTCCTGTTCTTCAGGGCATAAGG + Intergenic
1162522589 19:11190712-11190734 CAGCTGTTCTTCTGGAAACATGG - Intronic
1163768753 19:19178243-19178265 CTTCTGGACTTCTGGGAACATGG + Intronic
1164427579 19:28155773-28155795 CTGCTGTTATTCTGGGCAAGAGG + Intergenic
1164565818 19:29325016-29325038 CTCCAGTTCTTCTGGGAGCATGG - Intergenic
1164596369 19:29533125-29533147 CTCCATATCTTCTGGGAAGAAGG - Intronic
1164672644 19:30081655-30081677 GTCGTGTTCTTCTGGGTACAAGG - Intergenic
1168093383 19:54100444-54100466 CTCCTGATTCCCTGGGAAAAGGG - Intronic
926726128 2:15999413-15999435 CTTCTTTTCTCCAGGGAAAATGG + Intergenic
928335756 2:30396616-30396638 CTGCTGCTATTCTGGGGAAAGGG - Intergenic
928444694 2:31322575-31322597 CTCCTGTACTTCTGGCCAACTGG - Intergenic
929376592 2:41294447-41294469 CTGCTGTCCTTCTGAGAAAAAGG + Intergenic
929511204 2:42567875-42567897 GGCCTGTTCTGCTGGGAAAAGGG - Intronic
930278869 2:49345798-49345820 CTGTTGTTCTTCTGGAACAACGG + Intergenic
930822996 2:55666580-55666602 CTCCTGGTGTTCTGGGATACAGG - Intronic
931591613 2:63889553-63889575 TTCCTATTTTGCTGGGAAAATGG - Intronic
933914610 2:86976590-86976612 TTCTTGTTCTTCAGGAAAAACGG - Exonic
934008383 2:87793309-87793331 TTCTTGTTCTTCAGGAAAAACGG + Exonic
934895958 2:98120184-98120206 CACCTGTTGTTCTGGTGAAAGGG - Intronic
935222656 2:101028351-101028373 CTCCTGGTCGTCGGAGAAAAAGG + Exonic
935546217 2:104402354-104402376 TTCCTGAGCATCTGGGAAAATGG - Intergenic
936251019 2:110868389-110868411 CACCTTTTCTTCTTGGGAAAAGG + Intronic
936375922 2:111941584-111941606 CTCCTGTTTTTCTGGGCAGAGGG + Intronic
936856374 2:116962709-116962731 TTCCTGTTCTGCTGGAGAAAGGG + Intergenic
937185497 2:120036902-120036924 TTCCTGATCTTAGGGGAAAAAGG - Intronic
938702097 2:133888622-133888644 TTCCTGTTCTTCTGGGGTGATGG - Intergenic
938901738 2:135804261-135804283 TTCTTTTTCTTTTGGGAAAAGGG + Intronic
939256819 2:139754694-139754716 CTCCTGCTGTGCTGTGAAAAAGG + Intergenic
940672922 2:156692867-156692889 ATCCTGTTCGTTTGGAAAAAAGG + Intergenic
941185187 2:162313954-162313976 CTCTGGTTCTTCTGTGTAAATGG + Intronic
944723807 2:202449533-202449555 CTCCCTTTCTTCTGGGAATTTGG + Intronic
945993675 2:216417507-216417529 CTGGTGTTCTTCTAAGAAAAGGG - Intronic
946979078 2:225187372-225187394 CGCCTGCTCTCCTGAGAAAAGGG + Intergenic
947104441 2:226653918-226653940 CTCGTGCTCCTCTGGGAAACTGG + Intergenic
947565048 2:231188438-231188460 CTTTTATTCGTCTGGGAAAAGGG + Intergenic
948377515 2:237531224-237531246 CTACAGTTATTCTGAGAAAAGGG + Intronic
1169274007 20:4221149-4221171 CCCCTCCTCTTCTGGGAAATAGG - Exonic
1171040455 20:21757882-21757904 CCCCTGATCTTCTCGGAGAAAGG + Intergenic
1171090449 20:22280607-22280629 CTGCTGTTGTTGTGGGAAAGTGG - Intergenic
1173392553 20:42648063-42648085 CCCCTGATCCTCTGGGGAAACGG + Intronic
1173781638 20:45761438-45761460 TTCCTGTTCATCTGGGGAGAGGG - Intronic
1173944121 20:46936684-46936706 CTCCTGTTCTGCTGGGAGAAGGG - Intronic
1174042718 20:47711215-47711237 CACCTGTGTTACTGGGAAAAGGG - Intronic
1174556975 20:51402819-51402841 CTCCCCCTCTTCTGGGAGAAGGG + Intronic
1174755681 20:53156032-53156054 CTCATTTTCTCCTGGGAACAAGG + Intronic
1177962523 21:27685081-27685103 CTTGTGTTTTTCTGGGTAAATGG - Intergenic
1179595109 21:42438132-42438154 CTCCTCTTTGTCTGGGAAGAGGG + Intronic
1180641696 22:17304243-17304265 CTCCTGTCCTGCTGGGACAAGGG - Intergenic
1181153964 22:20905887-20905909 CTCCTCTACTTCTGAGAATATGG + Intergenic
1181466428 22:23112998-23113020 GTCCCCTTCTTCTGGTAAAATGG - Intronic
1182981358 22:34674435-34674457 CTGCTGTTCTTCTAAAAAAATGG - Intergenic
949113648 3:293539-293561 CCCCTGTATTTCTGAGAAAAAGG + Intronic
950454693 3:13085722-13085744 CTCCTGTCCGTCTGTGAAATGGG - Intergenic
951848526 3:27112028-27112050 TTTCTGGGCTTCTGGGAAAAAGG - Intronic
952294711 3:32051069-32051091 CTCTTGTTTTTCTGGAAAAGAGG + Intronic
952895294 3:38074731-38074753 TTCCTGTTCATCTGGGGAGAGGG + Intronic
953111916 3:39950666-39950688 CTCATGTTCTTCTTGGAATCCGG - Intronic
953157706 3:40389821-40389843 CTGTTATTCTTCTGGGAAAATGG + Intronic
954111503 3:48436097-48436119 CTCAGCTTTTTCTGGGAAAATGG - Intronic
956352247 3:68350650-68350672 CTGCTGTTTTTCTGTTAAAAAGG - Intronic
956467098 3:69529987-69530009 TTCCTGTTATCATGGGAAAAAGG - Intronic
957046412 3:75378461-75378483 CTCCTCTTCTCCTGGGAGGAGGG + Intergenic
958662638 3:97091092-97091114 TGCCTGTTGTCCTGGGAAAATGG - Intronic
959165932 3:102778122-102778144 TTCCTGTACTTCTAGAAAAAAGG + Intergenic
959912510 3:111779525-111779547 CTCCTGTTCTCTTAGGATAATGG + Intronic
960845457 3:122000661-122000683 CACCTGTGCTTCTGAGCAAATGG - Intronic
960990984 3:123311073-123311095 TCCATGTTGTTCTGGGAAAATGG + Intronic
961224868 3:125234564-125234586 CTGCTGTTCTCCTTGGAAAGAGG - Intronic
962725216 3:138218860-138218882 CTTTTGGTCTACTGGGAAAAGGG + Intronic
963365989 3:144335142-144335164 CTACTGTTCTTCTGGAGAAGTGG + Intergenic
963419868 3:145048108-145048130 CTCCTGTTCTACAGGGAAGAAGG + Intergenic
963930264 3:150996738-150996760 CTCCAGTTTTTCTGGGATGAGGG + Intergenic
964060481 3:152516144-152516166 AACCTATTCTTCAGGGAAAAGGG - Intergenic
964080682 3:152752351-152752373 CTACAGTTCTTCTGGGAATTTGG - Intergenic
965837708 3:172869538-172869560 CTCCTATTTCACTGGGAAAATGG + Intergenic
966179454 3:177174567-177174589 CTCCTCTTTTTCTGGGGAACAGG - Intronic
967174341 3:186849210-186849232 ATCCTTTTCTGCTGGGAAACAGG - Intronic
967375520 3:188796386-188796408 TTCCTGTACTTTTGGGAAAAAGG - Intronic
968314213 3:197709225-197709247 TTCCTGTTCTTATCGAAAAATGG + Intronic
969137396 4:5041152-5041174 GTCCTTTTCTTCAGGGAAATGGG + Intergenic
970333889 4:15011629-15011651 CTCCTATTTTTTTGGGAAGAGGG - Intronic
970656341 4:18234623-18234645 CACATGTTATCCTGGGAAAAGGG - Intergenic
971193295 4:24447819-24447841 CTCCTGTTGTTCTGTGGGAAAGG - Intergenic
971301893 4:25448759-25448781 CTCCTGGCCTTCTGGGAGAGGGG + Intergenic
971450183 4:26792904-26792926 TTCCTGTTTTTCCAGGAAAATGG + Intergenic
971562731 4:28101799-28101821 AGCCTGTGCTTCTGGGAAGATGG + Intergenic
972763893 4:42133551-42133573 CACCTGTACAACTGGGAAAATGG + Intronic
973291694 4:48477413-48477435 CCCCTATTCTTCTGGGAAATAGG - Intergenic
974565375 4:63573995-63574017 CTCCAGTTCTTGTTGGAAATGGG + Intergenic
975390394 4:73810136-73810158 CTTCAGTACTTCTGGGAATATGG - Intergenic
975894670 4:79074579-79074601 ATCATGTTCTTGTGGGAACATGG + Intergenic
976675967 4:87703828-87703850 CTCATGTTTTTCAAGGAAAAGGG - Intergenic
977041986 4:92027863-92027885 TTCCTGTTCATCTGGGGAGAGGG - Intergenic
977092513 4:92695792-92695814 CATCTGTCCTTCTGGGTAAATGG - Intronic
977552323 4:98455526-98455548 CTTCTTTTCTTCTGGGTAGATGG - Intergenic
980107803 4:128604535-128604557 GTGCTTTTCTTCTGGGAAATAGG + Intergenic
980843200 4:138291795-138291817 ATCCTCTTTCTCTGGGAAAATGG - Intergenic
980889159 4:138795732-138795754 ATGCTAATCTTCTGGGAAAAAGG - Intergenic
981209438 4:142085214-142085236 CTTACTTTCTTCTGGGAAAAAGG - Intronic
981838007 4:149077914-149077936 CTGCTGTTTTTAAGGGAAAATGG - Intergenic
982474644 4:155835061-155835083 ATCCAGTTCTTCTGGGACACTGG + Intronic
983111738 4:163758584-163758606 CTTCTGTCCTTCAGGGAAATTGG - Intronic
983658418 4:170106997-170107019 CTCCAATTCTTTGGGGAAAATGG - Intergenic
983789028 4:171771928-171771950 CTCCAGTTCTGCTGGCAAACAGG - Intergenic
984006569 4:174317945-174317967 CTCCTTTTGTACTGGGAAACAGG + Intronic
984209913 4:176834006-176834028 CTCTTTTTCTTCTGGTAATAAGG + Intergenic
984529077 4:180893887-180893909 CTCCTGATGTTCTGAGTAAAGGG - Intergenic
988584935 5:32500110-32500132 CTACTGTTGTTGTAGGAAAAGGG + Intergenic
988794255 5:34637776-34637798 CTCCTGTGCTTCTGTGAATGAGG + Intergenic
988891234 5:35618925-35618947 AGCAAGTTCTTCTGGGAAAATGG - Intronic
990387014 5:55274946-55274968 CTGCTGTACTTTTGGTAAAATGG + Exonic
990503683 5:56423376-56423398 CTCCCCTCATTCTGGGAAAAAGG - Intergenic
992809141 5:80369285-80369307 CTCCTGTTCCTTTGCTAAAAGGG + Intergenic
993323854 5:86509858-86509880 CTCCTGTTCTTAATAGAAAAAGG - Intergenic
993372598 5:87110925-87110947 CTCCTGATCTTCTGAGTAAGTGG + Intergenic
993998018 5:94745383-94745405 TTCCATTTCTTCTGGGAGAATGG + Intronic
994079470 5:95690741-95690763 CTCCTATATTTCTGGGAAACTGG - Intronic
994607525 5:101988145-101988167 TTCCTGTTCTGCTTGGAAAGCGG + Intergenic
999764461 5:154728529-154728551 AGCCTATCCTTCTGGGAAAATGG + Intronic
1001354559 5:171007084-171007106 TTCCCGTTCATCTGGGGAAAGGG + Intronic
1002104544 5:176873618-176873640 TGCCTGCTCTTCTGGGACAAGGG - Intronic
1002733796 5:181365849-181365871 CTCCAGTTCTTCTGACACAAAGG - Intergenic
1002750747 6:108271-108293 CTCCAGTTCTTCTGACACAAAGG + Intergenic
1002812604 6:647254-647276 CTACTGTTTTTCTGGAAACAAGG - Intronic
1002865676 6:1120007-1120029 CTCCAGTTCTTCTGGTGAAATGG + Intergenic
1003552480 6:7110648-7110670 CTCCTTTTCTTTTGTAAAAATGG - Intronic
1004283793 6:14301914-14301936 GTCCTGCTTTTCTGGGAAAGGGG - Intergenic
1004484038 6:16048781-16048803 CTCCTTTTCTTCATGGAAACTGG - Intergenic
1005361657 6:25036802-25036824 CTCCTGTTCTTCTGGGAAAATGG - Intronic
1007016986 6:38478731-38478753 CTCCTGTTTTCCTTGGAGAAGGG + Intronic
1007131923 6:39483181-39483203 CTGCTGATCTTTTGGGGAAAGGG + Intronic
1007347275 6:41241420-41241442 CTCCTTTGCTTCTGGGACACTGG - Intergenic
1007556801 6:42773043-42773065 CTCCCCTTCTTCTGTGAAGAAGG - Intronic
1008159372 6:48058837-48058859 CTCCAGTTCTTCAGTGCAAAAGG + Intronic
1008367581 6:50700418-50700440 CTCTCCTTCTTCTGGGAATAGGG + Intergenic
1013342012 6:109224217-109224239 CTCATTTTCTTCTGGGAAGTTGG - Intergenic
1014002306 6:116378130-116378152 CTTCTTTTCTTCAGGGAAGATGG - Intronic
1014395975 6:120926858-120926880 TTCCTGTTCATCTGGGGAGAGGG - Intergenic
1014437138 6:121433316-121433338 CTTCTCTTCTTTTGGGATAATGG - Intergenic
1016650569 6:146455432-146455454 GTCCTGCTTTTCTGGGGAAAGGG - Intergenic
1017820801 6:158047954-158047976 CTCCTGTCTTTGTGGGAACAGGG + Intronic
1018389162 6:163329687-163329709 GTCCTGCTTTTCTGGGAATAGGG - Intergenic
1018801905 6:167229356-167229378 ATCTTGTTTTTCTGGAAAAAAGG + Intergenic
1019238043 6:170638169-170638191 CTCCAGTTCTTCTGACACAAAGG - Intergenic
1019945377 7:4324552-4324574 CTCCTTTTCTTCTGGGACTCAGG + Intergenic
1020545902 7:9529795-9529817 ATTCTGTTCTTCTGGGAATGAGG - Intergenic
1021148655 7:17121282-17121304 CTCCTATCCTTCTAGGCAAATGG + Intergenic
1021433890 7:20592495-20592517 TTCCTTTTCATCTGTGAAAAAGG - Intergenic
1021512679 7:21451462-21451484 CCCCAGTTCTTTGGGGAAAATGG + Intronic
1024203814 7:47133897-47133919 AGACTGTACTTCTGGGAAAATGG - Intergenic
1024641224 7:51330215-51330237 CTCCTGTTTTTCAGAGAAAATGG + Intergenic
1024736595 7:52311730-52311752 TGCCTTTTCTTCTGGGAGAAGGG - Intergenic
1027158188 7:75783273-75783295 TTCCTGTTCATCTGGGGAGAGGG - Intronic
1028416330 7:90584379-90584401 CTCCTGTACATCTGGGAACCAGG + Intronic
1028453102 7:91007640-91007662 GTTCTATTCATCTGGGAAAAAGG - Intronic
1030738332 7:113078017-113078039 ATCATTTTCTTCTGTGAAAAAGG - Intergenic
1031160407 7:118160764-118160786 ATCTTGTTTTTTTGGGAAAAAGG - Intergenic
1031525319 7:122817627-122817649 GTCCTGCTTTTCTGGGAAAGGGG + Intronic
1032691468 7:134291553-134291575 CTTCTCTTCTTCTGGAAAGATGG - Exonic
1033571338 7:142631818-142631840 CCCCTTTTCTTCTTGAAAAATGG - Intergenic
1034077156 7:148243204-148243226 CTCCTGGTCTCCTGGGGAAATGG + Intronic
1035509725 8:168440-168462 CTCCAGTTCTTCTGACACAAAGG + Intergenic
1035985717 8:4429681-4429703 CTCCTGTTCTTTTGGGGTATTGG - Intronic
1037026421 8:14043858-14043880 CTCCTGCTGGCCTGGGAAAAAGG - Intergenic
1037229374 8:16636748-16636770 CTCCTTTTATGCTGGGAAAACGG + Intergenic
1037570860 8:20156647-20156669 CTCTTCTTCTTTTAGGAAAAAGG + Intronic
1038032386 8:23653880-23653902 CTCCTGTGTTTCTTTGAAAAGGG + Intergenic
1040636886 8:49285511-49285533 CTTTTTTTCTGCTGGGAAAATGG - Intergenic
1040851701 8:51907557-51907579 ATTCTGTTCTTCTTGGAAAATGG - Intergenic
1043693616 8:83189090-83189112 CTGCTTTTCTTCTGGGAATCTGG + Intergenic
1044384797 8:91575031-91575053 CACTTGTGCTGCTGGGAAAATGG + Intergenic
1045173560 8:99696716-99696738 CCCCGGATCTTCTGGGAAAACGG - Intronic
1046085323 8:109427218-109427240 CTCCAGTTCTTTTTGGAATAAGG - Intronic
1046991563 8:120462443-120462465 TTCCTTTTCCTCTGCGAAAATGG - Intronic
1047424181 8:124730332-124730354 CTCCTGAACTCCTGGGATAAGGG + Intergenic
1047755316 8:127913671-127913693 CTTCTCTTCTGCTGGGGAAATGG + Intergenic
1049384875 8:142338142-142338164 CTCCAGTTCTGCTGTGAACAGGG + Intronic
1050978068 9:11967255-11967277 CTCCAGTTCTCCTTGGCAAAGGG + Intergenic
1052883715 9:33623273-33623295 CCCCTTTTCTTCTTGAAAAATGG - Intergenic
1053060011 9:35023344-35023366 TTCCTGTTCATCTGGGGAGAGGG + Intergenic
1053134120 9:35638677-35638699 TTCCTGTTCATCTGGGGAGAGGG - Intronic
1055430685 9:76240308-76240330 CAGCTCTGCTTCTGGGAAAATGG - Intronic
1055823198 9:80292458-80292480 CCCCTTTTCTTCTGGGAAAGGGG - Intergenic
1056280413 9:85036355-85036377 CAACTGTTCTTCTGGCATAATGG - Intergenic
1060134449 9:121138615-121138637 CTCCTTTTCTTCTGAGAACTGGG - Exonic
1062758249 9:138318464-138318486 CTCCAGTTCTTCTGACACAAAGG - Intergenic
1185506283 X:634085-634107 CTGCTGTTCTGCTGAGAAACAGG + Intronic
1187306113 X:18096672-18096694 AGCCTATTCTTTTGGGAAAAGGG + Intergenic
1187368765 X:18686466-18686488 ATCCTCTTCTCCTGGCAAAAAGG - Intronic
1189024742 X:37381078-37381100 CTGCTGTTCTTTTTGGAGAAGGG + Intronic
1189595392 X:42559580-42559602 CTCCTGTTCTTTTTTGAAGAAGG - Intergenic
1190842255 X:54156123-54156145 TTCCTGTTTTACTGAGAAAATGG - Intronic
1190946324 X:55097464-55097486 CTGCAATTCTTCTTGGAAAAAGG + Intronic
1191778547 X:64844167-64844189 CTCCTTTTCTTCTGGAAGGAAGG - Intergenic
1192210052 X:69122043-69122065 CTCCTGGTATGCAGGGAAAATGG + Intergenic
1193213288 X:78834069-78834091 CTCATTTTCTTCTAGGACAAAGG - Intergenic
1195424579 X:104713926-104713948 CTCCTCTCCTTCTGGAAACATGG - Intronic
1195724810 X:107903630-107903652 CTGCTGTTCTTTTGGAAAGAGGG - Intronic
1195996216 X:110734145-110734167 ATCGATTTCTTCTGGGAAAAGGG + Intronic
1197566833 X:128098529-128098551 ATCCTGTTCTTCTCTGGAAAAGG + Intergenic
1198113272 X:133521632-133521654 ATGCTGTTATTCTTGGAAAACGG + Intergenic
1198317011 X:135478089-135478111 TTCCTACTCTTCAGGGAAAATGG + Intergenic
1198957850 X:142151296-142151318 CACATGTACTTCTGGGAGAATGG - Intergenic
1198995562 X:142569788-142569810 CTCCAGCTTTTCAGGGAAAAGGG - Intergenic
1199576013 X:149314693-149314715 CAGCTGTTCTTCTGAGAAAAAGG + Intergenic
1200208509 X:154334775-154334797 CTCCTGTTTTTGTCTGAAAATGG + Intergenic
1201054659 Y:9976471-9976493 CTCCTGTTCTGCTGGAGGAATGG - Intergenic
1202191724 Y:22252980-22253002 CTCCTGTTCTGCTGGAGGAATGG + Intergenic