ID: 1005366044

View in Genome Browser
Species Human (GRCh38)
Location 6:25078101-25078123
Sequence AATGGTTGCCAGAGTGTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005366044_1005366048 16 Left 1005366044 6:25078101-25078123 CCCACTACACTCTGGCAACCATT No data
Right 1005366048 6:25078140-25078162 ATATATTTGTATTTTGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005366044 Original CRISPR AATGGTTGCCAGAGTGTAGT GGG (reversed) Intergenic
No off target data available for this crispr