ID: 1005371639

View in Genome Browser
Species Human (GRCh38)
Location 6:25139904-25139926
Sequence CGCAGGGGTCTGGAGCCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005371639_1005371653 29 Left 1005371639 6:25139904-25139926 CCTGCGGGCTCCAGACCCCTGCG No data
Right 1005371653 6:25139956-25139978 AGACCCAGCGAGTGCAGCGGCGG No data
1005371639_1005371652 26 Left 1005371639 6:25139904-25139926 CCTGCGGGCTCCAGACCCCTGCG No data
Right 1005371652 6:25139953-25139975 CCAAGACCCAGCGAGTGCAGCGG No data
1005371639_1005371643 -8 Left 1005371639 6:25139904-25139926 CCTGCGGGCTCCAGACCCCTGCG No data
Right 1005371643 6:25139919-25139941 CCCCTGCGCCGCTGCGCCCTGGG No data
1005371639_1005371641 -9 Left 1005371639 6:25139904-25139926 CCTGCGGGCTCCAGACCCCTGCG No data
Right 1005371641 6:25139918-25139940 ACCCCTGCGCCGCTGCGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005371639 Original CRISPR CGCAGGGGTCTGGAGCCCGC AGG (reversed) Intergenic