ID: 1005371640

View in Genome Browser
Species Human (GRCh38)
Location 6:25139914-25139936
Sequence GGCGCAGCGGCGCAGGGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005371640_1005371653 19 Left 1005371640 6:25139914-25139936 CCAGACCCCTGCGCCGCTGCGCC No data
Right 1005371653 6:25139956-25139978 AGACCCAGCGAGTGCAGCGGCGG No data
1005371640_1005371652 16 Left 1005371640 6:25139914-25139936 CCAGACCCCTGCGCCGCTGCGCC No data
Right 1005371652 6:25139953-25139975 CCAAGACCCAGCGAGTGCAGCGG No data
1005371640_1005371656 28 Left 1005371640 6:25139914-25139936 CCAGACCCCTGCGCCGCTGCGCC No data
Right 1005371656 6:25139965-25139987 GAGTGCAGCGGCGGCCGCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005371640 Original CRISPR GGCGCAGCGGCGCAGGGGTC TGG (reversed) Intergenic