ID: 1005371644

View in Genome Browser
Species Human (GRCh38)
Location 6:25139920-25139942
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005371644_1005371657 25 Left 1005371644 6:25139920-25139942 CCCTGCGCCGCTGCGCCCTGGGT No data
Right 1005371657 6:25139968-25139990 TGCAGCGGCGGCCGCCGAGGAGG No data
1005371644_1005371652 10 Left 1005371644 6:25139920-25139942 CCCTGCGCCGCTGCGCCCTGGGT No data
Right 1005371652 6:25139953-25139975 CCAAGACCCAGCGAGTGCAGCGG No data
1005371644_1005371656 22 Left 1005371644 6:25139920-25139942 CCCTGCGCCGCTGCGCCCTGGGT No data
Right 1005371656 6:25139965-25139987 GAGTGCAGCGGCGGCCGCCGAGG No data
1005371644_1005371653 13 Left 1005371644 6:25139920-25139942 CCCTGCGCCGCTGCGCCCTGGGT No data
Right 1005371653 6:25139956-25139978 AGACCCAGCGAGTGCAGCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005371644 Original CRISPR ACCCAGGGCGCAGCGGCGCA GGG (reversed) Intergenic