ID: 1005371646

View in Genome Browser
Species Human (GRCh38)
Location 6:25139927-25139949
Sequence CGGCGAAACCCAGGGCGCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005371646_1005371652 3 Left 1005371646 6:25139927-25139949 CCGCTGCGCCCTGGGTTTCGCCG No data
Right 1005371652 6:25139953-25139975 CCAAGACCCAGCGAGTGCAGCGG No data
1005371646_1005371653 6 Left 1005371646 6:25139927-25139949 CCGCTGCGCCCTGGGTTTCGCCG No data
Right 1005371653 6:25139956-25139978 AGACCCAGCGAGTGCAGCGGCGG No data
1005371646_1005371656 15 Left 1005371646 6:25139927-25139949 CCGCTGCGCCCTGGGTTTCGCCG No data
Right 1005371656 6:25139965-25139987 GAGTGCAGCGGCGGCCGCCGAGG No data
1005371646_1005371657 18 Left 1005371646 6:25139927-25139949 CCGCTGCGCCCTGGGTTTCGCCG No data
Right 1005371657 6:25139968-25139990 TGCAGCGGCGGCCGCCGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005371646 Original CRISPR CGGCGAAACCCAGGGCGCAG CGG (reversed) Intergenic