ID: 1005371647

View in Genome Browser
Species Human (GRCh38)
Location 6:25139935-25139957
Sequence CTTGGGTGCGGCGAAACCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 2, 3: 1, 4: 33}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005371647_1005371656 7 Left 1005371647 6:25139935-25139957 CCCTGGGTTTCGCCGCACCCAAG 0: 1
1: 0
2: 2
3: 1
4: 33
Right 1005371656 6:25139965-25139987 GAGTGCAGCGGCGGCCGCCGAGG No data
1005371647_1005371653 -2 Left 1005371647 6:25139935-25139957 CCCTGGGTTTCGCCGCACCCAAG 0: 1
1: 0
2: 2
3: 1
4: 33
Right 1005371653 6:25139956-25139978 AGACCCAGCGAGTGCAGCGGCGG No data
1005371647_1005371659 23 Left 1005371647 6:25139935-25139957 CCCTGGGTTTCGCCGCACCCAAG 0: 1
1: 0
2: 2
3: 1
4: 33
Right 1005371659 6:25139981-25140003 GCCGAGGAGGTTCGAAAACACGG No data
1005371647_1005371657 10 Left 1005371647 6:25139935-25139957 CCCTGGGTTTCGCCGCACCCAAG 0: 1
1: 0
2: 2
3: 1
4: 33
Right 1005371657 6:25139968-25139990 TGCAGCGGCGGCCGCCGAGGAGG No data
1005371647_1005371652 -5 Left 1005371647 6:25139935-25139957 CCCTGGGTTTCGCCGCACCCAAG 0: 1
1: 0
2: 2
3: 1
4: 33
Right 1005371652 6:25139953-25139975 CCAAGACCCAGCGAGTGCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005371647 Original CRISPR CTTGGGTGCGGCGAAACCCA GGG (reversed) Intergenic