ID: 1005371648

View in Genome Browser
Species Human (GRCh38)
Location 6:25139936-25139958
Sequence TCTTGGGTGCGGCGAAACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005371648_1005371653 -3 Left 1005371648 6:25139936-25139958 CCTGGGTTTCGCCGCACCCAAGA No data
Right 1005371653 6:25139956-25139978 AGACCCAGCGAGTGCAGCGGCGG No data
1005371648_1005371659 22 Left 1005371648 6:25139936-25139958 CCTGGGTTTCGCCGCACCCAAGA No data
Right 1005371659 6:25139981-25140003 GCCGAGGAGGTTCGAAAACACGG No data
1005371648_1005371657 9 Left 1005371648 6:25139936-25139958 CCTGGGTTTCGCCGCACCCAAGA No data
Right 1005371657 6:25139968-25139990 TGCAGCGGCGGCCGCCGAGGAGG No data
1005371648_1005371656 6 Left 1005371648 6:25139936-25139958 CCTGGGTTTCGCCGCACCCAAGA No data
Right 1005371656 6:25139965-25139987 GAGTGCAGCGGCGGCCGCCGAGG No data
1005371648_1005371652 -6 Left 1005371648 6:25139936-25139958 CCTGGGTTTCGCCGCACCCAAGA No data
Right 1005371652 6:25139953-25139975 CCAAGACCCAGCGAGTGCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005371648 Original CRISPR TCTTGGGTGCGGCGAAACCC AGG (reversed) Intergenic