ID: 1005371649

View in Genome Browser
Species Human (GRCh38)
Location 6:25139947-25139969
Sequence CACTCGCTGGGTCTTGGGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005371649_1005371659 11 Left 1005371649 6:25139947-25139969 CCGCACCCAAGACCCAGCGAGTG No data
Right 1005371659 6:25139981-25140003 GCCGAGGAGGTTCGAAAACACGG No data
1005371649_1005371657 -2 Left 1005371649 6:25139947-25139969 CCGCACCCAAGACCCAGCGAGTG No data
Right 1005371657 6:25139968-25139990 TGCAGCGGCGGCCGCCGAGGAGG No data
1005371649_1005371656 -5 Left 1005371649 6:25139947-25139969 CCGCACCCAAGACCCAGCGAGTG No data
Right 1005371656 6:25139965-25139987 GAGTGCAGCGGCGGCCGCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005371649 Original CRISPR CACTCGCTGGGTCTTGGGTG CGG (reversed) Intergenic