ID: 1005371650

View in Genome Browser
Species Human (GRCh38)
Location 6:25139952-25139974
Sequence CGCTGCACTCGCTGGGTCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005371650_1005371659 6 Left 1005371650 6:25139952-25139974 CCCAAGACCCAGCGAGTGCAGCG No data
Right 1005371659 6:25139981-25140003 GCCGAGGAGGTTCGAAAACACGG No data
1005371650_1005371661 27 Left 1005371650 6:25139952-25139974 CCCAAGACCCAGCGAGTGCAGCG No data
Right 1005371661 6:25140002-25140024 GGCCAAAAGAAATGCCGAGAAGG No data
1005371650_1005371656 -10 Left 1005371650 6:25139952-25139974 CCCAAGACCCAGCGAGTGCAGCG No data
Right 1005371656 6:25139965-25139987 GAGTGCAGCGGCGGCCGCCGAGG No data
1005371650_1005371657 -7 Left 1005371650 6:25139952-25139974 CCCAAGACCCAGCGAGTGCAGCG No data
Right 1005371657 6:25139968-25139990 TGCAGCGGCGGCCGCCGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005371650 Original CRISPR CGCTGCACTCGCTGGGTCTT GGG (reversed) Intergenic
No off target data available for this crispr