ID: 1005371651

View in Genome Browser
Species Human (GRCh38)
Location 6:25139953-25139975
Sequence CCGCTGCACTCGCTGGGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005371651_1005371659 5 Left 1005371651 6:25139953-25139975 CCAAGACCCAGCGAGTGCAGCGG No data
Right 1005371659 6:25139981-25140003 GCCGAGGAGGTTCGAAAACACGG No data
1005371651_1005371657 -8 Left 1005371651 6:25139953-25139975 CCAAGACCCAGCGAGTGCAGCGG No data
Right 1005371657 6:25139968-25139990 TGCAGCGGCGGCCGCCGAGGAGG No data
1005371651_1005371661 26 Left 1005371651 6:25139953-25139975 CCAAGACCCAGCGAGTGCAGCGG No data
Right 1005371661 6:25140002-25140024 GGCCAAAAGAAATGCCGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005371651 Original CRISPR CCGCTGCACTCGCTGGGTCT TGG (reversed) Intergenic