ID: 1005371653

View in Genome Browser
Species Human (GRCh38)
Location 6:25139956-25139978
Sequence AGACCCAGCGAGTGCAGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005371646_1005371653 6 Left 1005371646 6:25139927-25139949 CCGCTGCGCCCTGGGTTTCGCCG 0: 1
1: 1
2: 1
3: 11
4: 131
Right 1005371653 6:25139956-25139978 AGACCCAGCGAGTGCAGCGGCGG No data
1005371644_1005371653 13 Left 1005371644 6:25139920-25139942 CCCTGCGCCGCTGCGCCCTGGGT No data
Right 1005371653 6:25139956-25139978 AGACCCAGCGAGTGCAGCGGCGG No data
1005371640_1005371653 19 Left 1005371640 6:25139914-25139936 CCAGACCCCTGCGCCGCTGCGCC No data
Right 1005371653 6:25139956-25139978 AGACCCAGCGAGTGCAGCGGCGG No data
1005371639_1005371653 29 Left 1005371639 6:25139904-25139926 CCTGCGGGCTCCAGACCCCTGCG No data
Right 1005371653 6:25139956-25139978 AGACCCAGCGAGTGCAGCGGCGG No data
1005371645_1005371653 12 Left 1005371645 6:25139921-25139943 CCTGCGCCGCTGCGCCCTGGGTT No data
Right 1005371653 6:25139956-25139978 AGACCCAGCGAGTGCAGCGGCGG No data
1005371648_1005371653 -3 Left 1005371648 6:25139936-25139958 CCTGGGTTTCGCCGCACCCAAGA No data
Right 1005371653 6:25139956-25139978 AGACCCAGCGAGTGCAGCGGCGG No data
1005371647_1005371653 -2 Left 1005371647 6:25139935-25139957 CCCTGGGTTTCGCCGCACCCAAG No data
Right 1005371653 6:25139956-25139978 AGACCCAGCGAGTGCAGCGGCGG No data
1005371638_1005371653 30 Left 1005371638 6:25139903-25139925 CCCTGCGGGCTCCAGACCCCTGC No data
Right 1005371653 6:25139956-25139978 AGACCCAGCGAGTGCAGCGGCGG No data
1005371642_1005371653 14 Left 1005371642 6:25139919-25139941 CCCCTGCGCCGCTGCGCCCTGGG No data
Right 1005371653 6:25139956-25139978 AGACCCAGCGAGTGCAGCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005371653 Original CRISPR AGACCCAGCGAGTGCAGCGG CGG Intergenic