ID: 1005371656

View in Genome Browser
Species Human (GRCh38)
Location 6:25139965-25139987
Sequence GAGTGCAGCGGCGGCCGCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005371640_1005371656 28 Left 1005371640 6:25139914-25139936 CCAGACCCCTGCGCCGCTGCGCC No data
Right 1005371656 6:25139965-25139987 GAGTGCAGCGGCGGCCGCCGAGG No data
1005371647_1005371656 7 Left 1005371647 6:25139935-25139957 CCCTGGGTTTCGCCGCACCCAAG No data
Right 1005371656 6:25139965-25139987 GAGTGCAGCGGCGGCCGCCGAGG No data
1005371649_1005371656 -5 Left 1005371649 6:25139947-25139969 CCGCACCCAAGACCCAGCGAGTG No data
Right 1005371656 6:25139965-25139987 GAGTGCAGCGGCGGCCGCCGAGG No data
1005371650_1005371656 -10 Left 1005371650 6:25139952-25139974 CCCAAGACCCAGCGAGTGCAGCG No data
Right 1005371656 6:25139965-25139987 GAGTGCAGCGGCGGCCGCCGAGG No data
1005371646_1005371656 15 Left 1005371646 6:25139927-25139949 CCGCTGCGCCCTGGGTTTCGCCG No data
Right 1005371656 6:25139965-25139987 GAGTGCAGCGGCGGCCGCCGAGG No data
1005371644_1005371656 22 Left 1005371644 6:25139920-25139942 CCCTGCGCCGCTGCGCCCTGGGT No data
Right 1005371656 6:25139965-25139987 GAGTGCAGCGGCGGCCGCCGAGG No data
1005371642_1005371656 23 Left 1005371642 6:25139919-25139941 CCCCTGCGCCGCTGCGCCCTGGG No data
Right 1005371656 6:25139965-25139987 GAGTGCAGCGGCGGCCGCCGAGG No data
1005371645_1005371656 21 Left 1005371645 6:25139921-25139943 CCTGCGCCGCTGCGCCCTGGGTT No data
Right 1005371656 6:25139965-25139987 GAGTGCAGCGGCGGCCGCCGAGG No data
1005371648_1005371656 6 Left 1005371648 6:25139936-25139958 CCTGGGTTTCGCCGCACCCAAGA No data
Right 1005371656 6:25139965-25139987 GAGTGCAGCGGCGGCCGCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005371656 Original CRISPR GAGTGCAGCGGCGGCCGCCG AGG Intergenic