ID: 1005371659

View in Genome Browser
Species Human (GRCh38)
Location 6:25139981-25140003
Sequence GCCGAGGAGGTTCGAAAACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005371655_1005371659 -2 Left 1005371655 6:25139960-25139982 CCAGCGAGTGCAGCGGCGGCCGC No data
Right 1005371659 6:25139981-25140003 GCCGAGGAGGTTCGAAAACACGG No data
1005371649_1005371659 11 Left 1005371649 6:25139947-25139969 CCGCACCCAAGACCCAGCGAGTG No data
Right 1005371659 6:25139981-25140003 GCCGAGGAGGTTCGAAAACACGG No data
1005371651_1005371659 5 Left 1005371651 6:25139953-25139975 CCAAGACCCAGCGAGTGCAGCGG No data
Right 1005371659 6:25139981-25140003 GCCGAGGAGGTTCGAAAACACGG No data
1005371648_1005371659 22 Left 1005371648 6:25139936-25139958 CCTGGGTTTCGCCGCACCCAAGA No data
Right 1005371659 6:25139981-25140003 GCCGAGGAGGTTCGAAAACACGG No data
1005371647_1005371659 23 Left 1005371647 6:25139935-25139957 CCCTGGGTTTCGCCGCACCCAAG No data
Right 1005371659 6:25139981-25140003 GCCGAGGAGGTTCGAAAACACGG No data
1005371654_1005371659 -1 Left 1005371654 6:25139959-25139981 CCCAGCGAGTGCAGCGGCGGCCG No data
Right 1005371659 6:25139981-25140003 GCCGAGGAGGTTCGAAAACACGG No data
1005371650_1005371659 6 Left 1005371650 6:25139952-25139974 CCCAAGACCCAGCGAGTGCAGCG No data
Right 1005371659 6:25139981-25140003 GCCGAGGAGGTTCGAAAACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005371659 Original CRISPR GCCGAGGAGGTTCGAAAACA CGG Intergenic