ID: 1005371661

View in Genome Browser
Species Human (GRCh38)
Location 6:25140002-25140024
Sequence GGCCAAAAGAAATGCCGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005371651_1005371661 26 Left 1005371651 6:25139953-25139975 CCAAGACCCAGCGAGTGCAGCGG No data
Right 1005371661 6:25140002-25140024 GGCCAAAAGAAATGCCGAGAAGG No data
1005371660_1005371661 -3 Left 1005371660 6:25139982-25140004 CCGAGGAGGTTCGAAAACACGGC No data
Right 1005371661 6:25140002-25140024 GGCCAAAAGAAATGCCGAGAAGG No data
1005371654_1005371661 20 Left 1005371654 6:25139959-25139981 CCCAGCGAGTGCAGCGGCGGCCG No data
Right 1005371661 6:25140002-25140024 GGCCAAAAGAAATGCCGAGAAGG No data
1005371650_1005371661 27 Left 1005371650 6:25139952-25139974 CCCAAGACCCAGCGAGTGCAGCG No data
Right 1005371661 6:25140002-25140024 GGCCAAAAGAAATGCCGAGAAGG No data
1005371655_1005371661 19 Left 1005371655 6:25139960-25139982 CCAGCGAGTGCAGCGGCGGCCGC No data
Right 1005371661 6:25140002-25140024 GGCCAAAAGAAATGCCGAGAAGG No data
1005371658_1005371661 0 Left 1005371658 6:25139979-25140001 CCGCCGAGGAGGTTCGAAAACAC No data
Right 1005371661 6:25140002-25140024 GGCCAAAAGAAATGCCGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005371661 Original CRISPR GGCCAAAAGAAATGCCGAGA AGG Intergenic