ID: 1005379687

View in Genome Browser
Species Human (GRCh38)
Location 6:25220598-25220620
Sequence TGGTGCTAAAGCTATTGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005379687_1005379693 10 Left 1005379687 6:25220598-25220620 CCACCCCAATAGCTTTAGCACCA No data
Right 1005379693 6:25220631-25220653 GAGATGAAGTAGCAGCAACTGGG No data
1005379687_1005379692 9 Left 1005379687 6:25220598-25220620 CCACCCCAATAGCTTTAGCACCA No data
Right 1005379692 6:25220630-25220652 TGAGATGAAGTAGCAGCAACTGG No data
1005379687_1005379694 23 Left 1005379687 6:25220598-25220620 CCACCCCAATAGCTTTAGCACCA No data
Right 1005379694 6:25220644-25220666 AGCAACTGGGTCATAAAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005379687 Original CRISPR TGGTGCTAAAGCTATTGGGG TGG (reversed) Intergenic
No off target data available for this crispr