ID: 1005385242

View in Genome Browser
Species Human (GRCh38)
Location 6:25279272-25279294
Sequence GAGAAGGAGGAGAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 11535
Summary {0: 7, 1: 77, 2: 663, 3: 2492, 4: 8296}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005385231_1005385242 23 Left 1005385231 6:25279226-25279248 CCGGCTCTCGCGAGGTGAGGAGG 0: 1
1: 0
2: 0
3: 9
4: 111
Right 1005385242 6:25279272-25279294 GAGAAGGAGGAGAAGGAGGAGGG 0: 7
1: 77
2: 663
3: 2492
4: 8296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005385242 Original CRISPR GAGAAGGAGGAGAAGGAGGA GGG Intronic
Too many off-targets to display for this crispr