ID: 1005385325

View in Genome Browser
Species Human (GRCh38)
Location 6:25279550-25279572
Sequence TGACGCCTCCTCGCAGTTCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 70}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005385325 Original CRISPR TGACGCCTCCTCGCAGTTCC CGG (reversed) Exonic
900226898 1:1537140-1537162 GGACACCTCCTCCCTGTTCCTGG - Intronic
908829061 1:68162102-68162124 TGACGCCTGCTTGCTGTACCAGG + Intronic
909571940 1:77123620-77123642 TGTCCCCTCCTCCCAGCTCCTGG - Intronic
917478133 1:175386275-175386297 TGACGGCCCCACGCAGATCCTGG - Exonic
918233126 1:182553827-182553849 TGACTCCTCTTCTCATTTCCAGG + Intronic
919838858 1:201594832-201594854 TGAAGCCCCCTCGCTGCTCCAGG + Intergenic
921326369 1:213989129-213989151 TCTCTCCTCCTCCCAGTTCCCGG - Intronic
922116215 1:222617542-222617564 TGGCGCCTTCTCGCAGTTTCTGG - Intergenic
1065367809 10:24952549-24952571 TGGCGCCTCCTCGCTGCTCCCGG + Exonic
1073732172 10:106302241-106302263 TGACCACTCCCCGCATTTCCAGG + Intergenic
1075776624 10:124993251-124993273 TGACGCCTGCTCACTGTACCAGG + Exonic
1076417834 10:130304235-130304257 TGACGCCAGCCTGCAGTTCCTGG + Intergenic
1076614564 10:131747121-131747143 TGACCACTCATTGCAGTTCCAGG - Intergenic
1086462902 11:87023204-87023226 TGAAACCTCCTCCCAGTTTCAGG + Intergenic
1099649328 12:85404436-85404458 TGAAGCCTTCTCAGAGTTCCAGG - Intergenic
1100814102 12:98368878-98368900 TGACTGCTCCATGCAGTTCCGGG + Intergenic
1104696719 12:130869675-130869697 TGACCTCTCTCCGCAGTTCCTGG + Intergenic
1114657781 14:24326285-24326307 TGAGGCCTCCTCACCGATCCAGG + Exonic
1118635177 14:67742231-67742253 TTACCCCTCCTCACAGTCCCTGG - Intronic
1121704295 14:95979877-95979899 TGACGTCTGCACACAGTTCCAGG - Intergenic
1121713397 14:96055707-96055729 TGAAGCCTCCTCACCGTGCCTGG + Intronic
1129251079 15:74309277-74309299 TGGTGCCTCCTCCCAGCTCCAGG + Intronic
1129994892 15:79996124-79996146 TGATTCCTCCTCTCTGTTCCAGG + Intergenic
1133038332 16:3046737-3046759 TGACTCCACCGCGCACTTCCCGG + Exonic
1137597250 16:49732884-49732906 TACTGCCTCCGCGCAGTTCCAGG - Intronic
1137735442 16:50719985-50720007 CAACACCTCCTTGCAGTTCCTGG + Exonic
1138103335 16:54272244-54272266 TTATGCCTCCTCCCATTTCCTGG + Intergenic
1144169064 17:12641103-12641125 TGACGCTTCCTCCCTGTTCTGGG - Intergenic
1147725488 17:42564094-42564116 TGACCCCTCCCTGGAGTTCCTGG + Exonic
1148053311 17:44779717-44779739 TGATGCCCCCTCTCCGTTCCAGG + Exonic
1148203871 17:45767541-45767563 TGACCCCTCCTTCCAGTTCCTGG + Intergenic
1150636407 17:66916277-66916299 TGCCGCCTCCTAGCTGCTCCTGG - Intergenic
1167384276 19:49155076-49155098 TGATGCCTCCTCGGAGAGCCCGG + Exonic
1167743644 19:51339029-51339051 TGCTGCCTCCCTGCAGTTCCAGG - Exonic
927640157 2:24840939-24840961 TCACGCCTCCTCACACTTGCTGG - Intronic
929532660 2:42762439-42762461 TGACGCCTACTGACAGTCCCAGG + Intergenic
930238885 2:48915606-48915628 TGACGCCTGCTCACTGTACCAGG + Intergenic
938118079 2:128615615-128615637 TGCTGCCTCTTAGCAGTTCCTGG + Intergenic
944529048 2:200649693-200649715 TGGCTCCTCCTCCCAGATCCTGG + Intronic
1168883500 20:1226411-1226433 AGACGACTCCTCAGAGTTCCGGG - Intronic
1169144544 20:3243848-3243870 CTCCGCCTCCTCGCTGTTCCTGG + Intergenic
1182308450 22:29388060-29388082 TGAGGCCTCCTCGTTGTTCAGGG - Intronic
950773577 3:15331878-15331900 CGACACCTCCTCGCAGAGCCTGG + Intronic
954446928 3:50551847-50551869 TGCCACCTGCTTGCAGTTCCAGG - Intergenic
957361340 3:79163178-79163200 TGCTGCCTCCCCACAGTTCCTGG + Intronic
966186158 3:177228819-177228841 TGGCGCCTCCTCCCAGATGCTGG + Intergenic
970140578 4:12977636-12977658 TGATGGCTCCTAGCAGTTCTAGG - Intergenic
974188698 4:58475011-58475033 TGTCTGCTCCTGGCAGTTCCAGG + Intergenic
986287748 5:6372452-6372474 TCACGCCGCATCGCAGTCCCAGG + Exonic
987236758 5:15950448-15950470 TGCGGCCTCCTGCCAGTTCCTGG - Intergenic
991660840 5:68949352-68949374 TAATGCCTCTCCGCAGTTCCTGG - Intergenic
994336849 5:98576890-98576912 TGACGCCTGCTCGCTGTACCAGG - Intergenic
998004817 5:138649837-138649859 TGACCCCTCCTAGCTGTCCCCGG - Intronic
1003311147 6:4970960-4970982 TGACCCCTCCTCGCTGTGCCTGG - Intergenic
1003405147 6:5821716-5821738 TGACGCCACTTTCCAGTTCCAGG - Intergenic
1005281923 6:24283654-24283676 ACACCCCTCCTCGCAGTGCCAGG + Intronic
1005385325 6:25279550-25279572 TGACGCCTCCTCGCAGTTCCCGG - Exonic
1005649458 6:27873378-27873400 TAACGCCTCCACGCCGTGCCAGG + Exonic
1007414239 6:41682839-41682861 TGGCGCCTCCTCCTAGTTCCAGG - Intergenic
1007685610 6:43665685-43665707 TGAGGACTCCTGGCATTTCCTGG + Intronic
1019661294 7:2225401-2225423 TGAACCCACCTCGTAGTTCCTGG + Exonic
1019890744 7:3943879-3943901 TGACGCCTCTTTGTAGTTACAGG - Intronic
1021889611 7:25174501-25174523 TCACGCCTCCTAGTAGTTACTGG - Intronic
1024235366 7:47393624-47393646 TGCAGCCTCCTCCCAGTGCCTGG - Intronic
1027125340 7:75553050-75553072 TGACTCCACCTCCCAGTACCTGG + Intronic
1033304242 7:140212786-140212808 TGAAGCCTCCTCCCTGCTCCAGG + Intergenic
1034670238 7:152852261-152852283 AGAGGCCTCCACGCAGTGCCTGG + Intronic
1038176842 8:25187936-25187958 TGCTTCTTCCTCGCAGTTCCTGG + Intronic
1038335717 8:26643813-26643835 TGACGCCTCCTCTCCCTTCTTGG - Intronic
1048752140 8:137690665-137690687 TGGGGCCTCCTTGCAGATCCAGG - Intergenic
1048880198 8:138866174-138866196 TGACACAACCTCGCAGTTACTGG - Intronic
1049360597 8:142210911-142210933 TGACACCTCCTCGGACATCCTGG + Intergenic
1051336568 9:16071072-16071094 TGACGGCTCCTGGGAGCTCCAGG - Intergenic
1053108188 9:35432160-35432182 TGACCTCTCCTCTCAGTCCCTGG - Intergenic
1062022491 9:134326142-134326164 CGCCGCCTCCTCGCGGCTCCCGG + Intronic
1203784047 EBV:117292-117314 TGACACCTCCTCGCTGAGCCAGG + Intergenic
1197781624 X:130165771-130165793 AGACTCCTCCTCCCAGCTCCGGG + Exonic