ID: 1005388902

View in Genome Browser
Species Human (GRCh38)
Location 6:25313488-25313510
Sequence CATAGTGGGCAGAAAGATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 232}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005388896_1005388902 -5 Left 1005388896 6:25313470-25313492 CCTATAAGGCTGCAGATACATAG 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1005388902 6:25313488-25313510 CATAGTGGGCAGAAAGATGGGGG 0: 1
1: 0
2: 0
3: 28
4: 232
1005388894_1005388902 11 Left 1005388894 6:25313454-25313476 CCAGTATAGATTTGGTCCTATAA 0: 1
1: 0
2: 0
3: 6
4: 80
Right 1005388902 6:25313488-25313510 CATAGTGGGCAGAAAGATGGGGG 0: 1
1: 0
2: 0
3: 28
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005388902 Original CRISPR CATAGTGGGCAGAAAGATGG GGG Intronic
901909763 1:12446830-12446852 TATACTAGGAAGAAAGATGGAGG - Intronic
902163604 1:14552217-14552239 AATAGGGGGCAGGAGGATGGTGG - Intergenic
907272654 1:53299926-53299948 CAGAGTGGGCTGACAGAGGGAGG + Intronic
908066776 1:60414735-60414757 AATCGTGGGCAGCAAGAAGGAGG - Intergenic
911825139 1:102473857-102473879 CATGATGGGCTGAAAGGTGGAGG - Intergenic
914409991 1:147418085-147418107 CATTGTTGGCTTAAAGATGGAGG - Intergenic
915233487 1:154463626-154463648 CAAAGTGGGAAGCAAGAGGGAGG + Intronic
916011206 1:160707559-160707581 GATAGTGGGCAGGAAGTTGAAGG + Intronic
916403608 1:164475118-164475140 GACAGTGGGCAGAGGGATGGCGG + Intergenic
919097149 1:193051246-193051268 GATTCTGGTCAGAAAGATGGGGG + Intronic
920666477 1:207966244-207966266 CAAAGTGGGCAGAAAGGTTGAGG - Intergenic
921467137 1:215502288-215502310 GTTAGTGGGCAGGTAGATGGTGG + Intergenic
922468188 1:225859235-225859257 CATGGTGGACAGGATGATGGAGG + Exonic
923299528 1:232629325-232629347 CAAAGTGGGAAGAAAGGTCGCGG + Intergenic
923486316 1:234434850-234434872 AATAATGGCCAGAAAGATGCAGG + Intronic
923673556 1:236062256-236062278 CATGGTGGGGAAAAAGAAGGAGG - Intronic
1063324187 10:5080798-5080820 CACAGTGAGCACAAACATGGTGG - Intronic
1064312565 10:14224465-14224487 CATACTGGGCAGAAAGACTTTGG + Intronic
1064346873 10:14540556-14540578 AAGTGTGGGCAGAAAGCTGGGGG - Intronic
1066449175 10:35512455-35512477 CTGAGTAGCCAGAAAGATGGGGG + Intronic
1066491534 10:35899412-35899434 CATACTGGGAGGAGAGATGGTGG + Intergenic
1067710780 10:48649512-48649534 CACAGTGGAGAGAAAGACGGTGG - Intronic
1068556605 10:58465480-58465502 CATTGTGGGCAGAAAGGGAGGGG - Intergenic
1069944188 10:71974697-71974719 CATAGAGGGCAGACAGCAGGTGG - Intronic
1070041120 10:72781090-72781112 TGTAGTGGGCAGAAAGAGGATGG + Intronic
1070734557 10:78854685-78854707 GAGAGAGGGGAGAAAGATGGAGG - Intergenic
1074169236 10:110917126-110917148 CACAGGGGGAAAAAAGATGGGGG + Intronic
1075107750 10:119553133-119553155 CATATTGTTCAGATAGATGGAGG + Intergenic
1075277504 10:121107598-121107620 AAAAGGGGGCAGAAAGCTGGGGG + Intergenic
1077453357 11:2663974-2663996 CAAAGTGGGCAGAGAGCTTGGGG - Intronic
1077980056 11:7291069-7291091 CTTAGCGGGAAGAAAGTTGGAGG + Intronic
1081630576 11:44686840-44686862 GAGAGTGGGCAGAAAGGTGGTGG + Intergenic
1084302087 11:68258588-68258610 CAGAGTGGGCAGGCAGTTGGTGG + Intergenic
1088054421 11:105557915-105557937 CACAGTGGGAAAAAAGATGAAGG - Intergenic
1089124805 11:116169326-116169348 CACAGTGTGGAAAAAGATGGGGG + Intergenic
1090442702 11:126737350-126737372 CACAGTGGGCAGGGAGAGGGCGG + Intronic
1090479556 11:127056050-127056072 CATATTAGGCAGAAAGAAGGAGG - Intergenic
1091139177 11:133220740-133220762 AAGAGGGGGCAGAAAAATGGAGG - Intronic
1091480379 12:823105-823127 CATAGAGGGCAGAAAGCAGTGGG - Intronic
1094414234 12:30201195-30201217 CATTTTGGGGAGAACGATGGGGG + Intergenic
1098418358 12:70263057-70263079 AATGGTGGCCAGAAAGATGTAGG - Intronic
1098618330 12:72558080-72558102 CAGACTGGGCACAAAGATGTTGG + Intronic
1100221439 12:92508418-92508440 CTTTGAGGGCAGAAAGATTGAGG - Intergenic
1100891692 12:99132600-99132622 CATAGTGGCCAAAAAAAGGGGGG + Intronic
1102073627 12:110042709-110042731 CAGGGTGGGCAGCAAGAAGGGGG + Intronic
1102753820 12:115320684-115320706 CAAAGTAGGCTGAATGATGGGGG + Intergenic
1103489941 12:121309515-121309537 CATGCTTGGCAGAAAGATTGAGG - Intronic
1104763589 12:131312828-131312850 CACAGTGGGCAGGATGATGACGG - Intergenic
1104815911 12:131645249-131645271 CACAGTGGGCAGGATGATGACGG + Intergenic
1106418263 13:29564080-29564102 AATAGTGGGGAGAAAGAGGAAGG + Intronic
1106768257 13:32937667-32937689 CAGATTGGGTTGAAAGATGGAGG + Intergenic
1107758677 13:43652735-43652757 CATAGTGGGCAGGAAGGTCTGGG + Intronic
1108173291 13:47766415-47766437 CAGAGGGTGCAGCAAGATGGAGG + Intergenic
1110166857 13:72452642-72452664 CATCCTGGGCAAACAGATGGGGG + Intergenic
1110881698 13:80579222-80579244 CATATTTGGAAGAAAAATGGAGG + Intergenic
1111420178 13:88000715-88000737 CATAGGGAGCAGAGAGATGAAGG - Intergenic
1113790862 13:113027424-113027446 CTTGGTGGGCAGAAAGAAGGGGG + Intronic
1115112862 14:29844871-29844893 CGTTCTGGTCAGAAAGATGGAGG + Intronic
1117762149 14:59040514-59040536 CAGACTGGGAAGAAAGATGAAGG + Intergenic
1117946948 14:61037242-61037264 CATTTTTGGCAGAAGGATGGTGG + Intronic
1119950408 14:78738679-78738701 CATAGTGGGGAAAAAGAATGGGG - Intronic
1120905213 14:89614497-89614519 CATAGTGAGCAGGAAAAAGGTGG - Intronic
1121298095 14:92846546-92846568 CATAGTGGTCAGAGAGATGAGGG - Intergenic
1121964728 14:98293633-98293655 CATGGTGTGCAGGAAGGTGGGGG - Intergenic
1123627910 15:22239946-22239968 CCTTGTAGGGAGAAAGATGGGGG - Intergenic
1125750276 15:42023162-42023184 GAAATTGGGCAGAAAGAAGGAGG + Intronic
1126808542 15:52378090-52378112 CAGAGGAGGCTGAAAGATGGAGG - Intronic
1127920723 15:63492225-63492247 CACAGTGGCCAGAGAGAGGGAGG + Intergenic
1129458511 15:75688405-75688427 TAGAGTGGGGAGAAATATGGTGG + Exonic
1130056896 15:80533800-80533822 CACAGTGGGCAGAAGCCTGGGGG + Intronic
1130273326 15:82463673-82463695 CAGAGTGGGGAGAAATATGGTGG - Intergenic
1130465678 15:84191044-84191066 CAGAGTGGGGAGAAATATGGTGG - Intergenic
1130487014 15:84403776-84403798 CAGAGTGGGGAGAAATATGGTGG + Intergenic
1130498587 15:84482492-84482514 CAGAGTGGGGAGAAATATGGTGG + Intergenic
1130587967 15:85195639-85195661 CAGAGTGGGGAGAAATATGGTGG - Intergenic
1130602511 15:85285983-85286005 CATGGAGGCCAGAAAGTTGGAGG + Intergenic
1130766377 15:86875668-86875690 CATGGAGGCCAGAAAGTTGGAGG - Intronic
1131783766 15:95888926-95888948 AATGGTGGGCAGACAGAAGGTGG + Intergenic
1132282202 15:100629585-100629607 CGTAGTGGGCAGCCACATGGAGG - Exonic
1132969658 16:2680226-2680248 CACTGTGGGCAGGGAGATGGGGG - Intergenic
1133477951 16:6141462-6141484 CATAGTTGGAAGAGAAATGGAGG - Intronic
1134445037 16:14324579-14324601 CATAGTGGTAAGAAAGTTGGGGG + Intergenic
1135915064 16:26598072-26598094 CTTTGCGGGCAGAGAGATGGAGG - Intergenic
1137758673 16:50922847-50922869 CAGAGTGGGAAGGAAGAGGGTGG + Intergenic
1138832754 16:60395031-60395053 CAGGGTGGGCAGAGAGATGGTGG - Intergenic
1139412664 16:66776837-66776859 CAGAGTGGGCTGAAAAATGAAGG + Intronic
1139684632 16:68593408-68593430 CAGAGAGGGCAGAAGGCTGGCGG + Intergenic
1140127218 16:72128110-72128132 GATAGAGGAAAGAAAGATGGAGG - Intronic
1140380130 16:74479378-74479400 TATAGTGACCAGAAAGATGCCGG + Intronic
1141423193 16:83930472-83930494 AATTATGGGCAGAAATATGGTGG + Intronic
1143057623 17:4173984-4174006 CCTGCTGGGCAGCAAGATGGAGG + Exonic
1144821959 17:18081408-18081430 CTTTGTGGGCACAAAGGTGGTGG + Intergenic
1148208127 17:45792270-45792292 CAGAGTTGGCAGAAAGAGGAAGG - Intronic
1148987130 17:51632748-51632770 CAGTGTGGAAAGAAAGATGGAGG - Intronic
1151535986 17:74738950-74738972 CATAGTGGGTAGAAGGAGGAGGG - Intronic
1152032353 17:77851776-77851798 GACAGTGGGCAGGAGGATGGCGG - Intergenic
1153459881 18:5321908-5321930 CATACTGGAAAGAAAGGTGGGGG + Intergenic
1155546394 18:26920210-26920232 AAGAGTGGTCAGAAAGATGGTGG - Intronic
1156595256 18:38541459-38541481 CATGGTGGAGAGGAAGATGGAGG - Intergenic
1156892687 18:42208237-42208259 CATGGTGGGCAAAAAGAAAGGGG + Intergenic
1157891892 18:51426009-51426031 CAAAGTGGCTTGAAAGATGGGGG - Intergenic
1160525123 18:79531381-79531403 TATCGTGGACATAAAGATGGCGG - Intergenic
1163567192 19:18058707-18058729 CAGTGTGGGCAGAAAGAGGGAGG + Intergenic
1164441636 19:28284226-28284248 GATGGTGGGAAGAATGATGGAGG - Intergenic
1165258904 19:34596861-34596883 CAGAGAGGGAAGGAAGATGGAGG - Intronic
1165425624 19:35743908-35743930 CATAGAGGGTAGAGAGATGGAGG + Intronic
1166976597 19:46608516-46608538 CATGATGGCCAGAAAGATGAAGG + Exonic
1167097209 19:47380893-47380915 CAAAGAGGCCAGGAAGATGGGGG - Exonic
1168583516 19:57574984-57575006 CATGGAGGGCAGGAAGATGGGGG + Intronic
926228200 2:10983320-10983342 CGTAGTGGGAAGCAGGATGGAGG - Intergenic
926573210 2:14552552-14552574 AAGAGTGGGAAGAAACATGGGGG - Intergenic
926691800 2:15740791-15740813 CATAGTGGAGAAAAACATGGTGG - Intronic
927333173 2:21890285-21890307 AACAGTGGGCAGAGAGATGAAGG + Intergenic
927450254 2:23203177-23203199 CAGAGTGGGCATACAGAAGGGGG - Intergenic
928902695 2:36337645-36337667 CTTAGTGGGCAGGAAGGTGTAGG + Intergenic
929802615 2:45117284-45117306 CATCGATGGCACAAAGATGGTGG + Intergenic
932183803 2:69673992-69674014 CACAGTGGGCAGCCAGCTGGGGG - Intronic
933949151 2:87313545-87313567 CATATAGGGCAGAAAGACGGAGG - Intergenic
934028123 2:88017557-88017579 AACAGCGGGCAGATAGATGGTGG - Intergenic
935931335 2:108129635-108129657 CATAGAACGCAGAAAGGTGGGGG - Intergenic
936076405 2:109404469-109404491 GACAGGGGACAGAAAGATGGGGG + Intronic
936229180 2:110685019-110685041 CAGACTGGGAGGAAAGATGGAGG + Intergenic
936331045 2:111548052-111548074 CATATAGGGCAGAAAGACAGAGG + Intergenic
936663683 2:114570486-114570508 CACAGTAGGCAGAATGATGGGGG + Intronic
936760798 2:115779137-115779159 AATAATGGGAAGAAAGATTGAGG - Intronic
937089828 2:119198769-119198791 CTGAGTGGGCAGGAAGATTGAGG - Intergenic
938615946 2:132998773-132998795 CATATTGGGGAGACAGATGGTGG - Intronic
938796289 2:134720044-134720066 CTTAGTGGGGAGAAAGTCGGGGG - Intergenic
940188144 2:151009562-151009584 AATATTTGGCAGAAAGGTGGAGG - Intronic
940227047 2:151410568-151410590 TATAGTGGGGAGAAAGAAGGTGG + Intronic
940288658 2:152056828-152056850 CAATGAGGGCAGAAAGTTGGAGG - Intronic
943642976 2:190379236-190379258 CATTTTGGGCAGCAAGATAGAGG + Intergenic
944586694 2:201179085-201179107 CAAAGAGGGCAGAGAGGTGGTGG + Intergenic
948136160 2:235637923-235637945 CAAAGAGGGCAAAAAGGTGGAGG - Intronic
948832789 2:240606454-240606476 GACAGTGGGCAGCAAGATGGTGG - Intronic
1169983673 20:11417353-11417375 CATAGAGGGCAGAAAAAGAGAGG - Intergenic
1170683168 20:18544789-18544811 CATAGTGGCAGGAGAGATGGAGG + Intronic
1170704509 20:18733176-18733198 CTCAGTGGGCAGAAGGAGGGTGG + Intronic
1173571298 20:44078193-44078215 CACAGGGGGAAGCAAGATGGAGG - Intergenic
1178484214 21:33006989-33007011 CATAGTGGACTGAAAGATCCCGG - Intergenic
1179136565 21:38684879-38684901 CTCACTTGGCAGAAAGATGGTGG + Intergenic
1180086052 21:45508377-45508399 GATGGTGGGCAGATGGATGGTGG + Intronic
1181634577 22:24168685-24168707 CATAGTGGGCAGGAACTTGACGG + Intronic
1182119041 22:27775055-27775077 CCCAGTGGGCAGAAAGAATGGGG + Intronic
1182296935 22:29315444-29315466 CCGAGTGGGCAGACAGGTGGCGG + Exonic
1182327673 22:29526009-29526031 CATAGGGGGTAGTAAGGTGGGGG + Intronic
1182513438 22:30836810-30836832 GATATTGGCCAGAAAGAAGGAGG + Intronic
1183008110 22:34920274-34920296 CACAATGAGCTGAAAGATGGTGG - Intergenic
1183909704 22:41069236-41069258 CATGGGGGGCAGAAAGAAGAAGG - Intergenic
1184586637 22:45452519-45452541 CATAGTGGACAGAAGGAAGGGGG - Intergenic
950565329 3:13766597-13766619 CATGGTGTGCAGAGAGATGGTGG - Intergenic
950851868 3:16069869-16069891 CAAAGCGGACAGAAAGATGCTGG + Intergenic
955128617 3:56140548-56140570 CAGAGTGGGCAGATAAATTGTGG - Intronic
955943351 3:64167646-64167668 CTGCCTGGGCAGAAAGATGGAGG + Intronic
960547139 3:118928530-118928552 CATAGGGGGCAGGAACATTGGGG - Exonic
960794202 3:121467393-121467415 CACCGTAGACAGAAAGATGGAGG + Intronic
960840939 3:121957985-121958007 CATACTGGGCAGAAATCTGCTGG + Intergenic
961346973 3:126269278-126269300 CATCGTGGCCAGAAAAATGCAGG - Intergenic
961664255 3:128486392-128486414 CAGGGTGGGCAGAAAGATCAGGG + Intronic
961995618 3:131238771-131238793 CATAGTGAGCAAAAAGATCTTGG + Intronic
962312193 3:134334488-134334510 CCTGGTGAGCAGAAAGGTGGTGG + Intergenic
962800130 3:138883180-138883202 CAAAGTGGGCAGATAGCTTGAGG - Intergenic
964440120 3:156699944-156699966 CCTAGTAGGGAGAAAGATGAGGG + Intronic
965683494 3:171276357-171276379 CCTAGGGAGCAGAAAGATGGAGG + Intronic
965730489 3:171767067-171767089 CATACTGGGCAGAAATAAAGAGG + Intronic
965874807 3:173303419-173303441 CATAGAGAGGAGAAAGAGGGAGG + Intergenic
967604419 3:191427413-191427435 CATAGTGGACATTAAGATGTAGG - Intergenic
968003668 3:195224911-195224933 TCTAGAGGGCAGACAGATGGAGG - Intronic
969339188 4:6529689-6529711 TCTAGTGGGCAGAGAGATGTGGG - Intronic
970748749 4:19332470-19332492 CAATGTGGCCAGAAATATGGAGG + Intergenic
970876358 4:20875130-20875152 CATATTGTGCAGGAAGATGGTGG - Intronic
972697821 4:41465191-41465213 CACAGGGGGAAGAAAGTTGGGGG - Intronic
973835414 4:54804520-54804542 CATTCTGTGAAGAAAGATGGTGG - Intergenic
974267767 4:59607403-59607425 TATACGGGGCAGAAAGAAGGTGG + Intergenic
974305420 4:60131835-60131857 TATAGTGGGTTGAGAGATGGAGG + Intergenic
975779844 4:77826691-77826713 CATAGTGGGAAGATACTTGGTGG + Intergenic
975816156 4:78218325-78218347 CATAGAGGGTAGAAAGTTTGGGG + Intronic
979561326 4:122105194-122105216 CCTAGTGAGGAGAAGGATGGAGG + Intergenic
983904896 4:173171898-173171920 CATAGGGGGCAAGAAAATGGAGG + Intronic
984438793 4:179739116-179739138 CACATGGCGCAGAAAGATGGAGG - Intergenic
985487335 5:158792-158814 CAGAGTGGGGAGGGAGATGGAGG - Intronic
986493369 5:8316889-8316911 CTTGGTGGGCAGGAGGATGGGGG + Intergenic
986664454 5:10088401-10088423 CATAGTATTCAGAAATATGGAGG + Intergenic
988410643 5:30881392-30881414 CAAAGTGAACACAAAGATGGAGG - Intergenic
988718188 5:33848382-33848404 CATAGTGAGGTGAAAGATGGAGG + Intronic
988778250 5:34496448-34496470 CCTAGTGGGCAGAAATAGGAAGG + Intergenic
988823663 5:34913409-34913431 CATAGTGGTCAGAAAAATACAGG - Intronic
990380075 5:55214197-55214219 CAAAGTAGGAAGAAAGAAGGGGG - Intergenic
991651986 5:68865112-68865134 CAGAGTGGGCAGAAGCAGGGTGG + Intergenic
992636673 5:78731267-78731289 CAGAGTGGGCAGTAAGACAGGGG + Intronic
994292849 5:98050570-98050592 CATAGCAGACAGCAAGATGGGGG + Intergenic
994618809 5:102138291-102138313 CATAGTGGGTATAAAAATGTGGG + Intergenic
996939035 5:128981605-128981627 TAGAGTGAGCAGAAGGATGGAGG + Intronic
999380146 5:151115730-151115752 CATTGTGGGCACATGGATGGGGG - Intronic
999649649 5:153752954-153752976 TATTGTGGGCTTAAAGATGGAGG + Intronic
999969452 5:156844704-156844726 GATAGTAAGGAGAAAGATGGAGG + Intergenic
1002467563 5:179415255-179415277 CATAGAGGGGGGTAAGATGGGGG - Intergenic
1003175248 6:3749320-3749342 AATAGGGGTCAGAATGATGGTGG - Intronic
1005250358 6:23938576-23938598 CTTAGAGGGCAGAAAGTTGCAGG + Intergenic
1005388902 6:25313488-25313510 CATAGTGGGCAGAAAGATGGGGG + Intronic
1007937029 6:45741584-45741606 CAGAGTGGGCAGAAACAGGAGGG - Intergenic
1009668841 6:66719011-66719033 CATATTAGGCAGAAATATGAAGG + Intergenic
1011667789 6:89651682-89651704 CATAGTTGGCAGAAAAATCATGG - Intronic
1012865532 6:104613940-104613962 CAAAGTGGGCTGAAAGCTTGAGG - Intergenic
1015693687 6:135956148-135956170 TAGAGTGGGCAGAAAGATAAAGG + Intronic
1015693697 6:135956226-135956248 TAGAGTGGGCAGAAAGATAAAGG + Intronic
1016755339 6:147678565-147678587 TCTGGTAGGCAGAAAGATGGGGG + Intronic
1022582088 7:31565501-31565523 CACAGTGGGCAGAGAGCTTGAGG + Intronic
1022637243 7:32147907-32147929 CATAGTGGTCAGAAAGTTTGGGG - Intronic
1022764912 7:33401279-33401301 AAAAGTGGGAAAAAAGATGGAGG - Intronic
1023022509 7:36022827-36022849 AAAAGTGGGGAGAGAGATGGAGG + Intergenic
1023088637 7:36597394-36597416 CATTGTAAGCAGAAAGATGTAGG - Intronic
1026951527 7:74350493-74350515 CATATAGGGCCCAAAGATGGTGG - Intronic
1031012680 7:116539943-116539965 CATAGTGCGGGGATAGATGGGGG - Intronic
1033227114 7:139571097-139571119 TCTAGTGGGCAGAAGGTTGGAGG - Exonic
1033259296 7:139828629-139828651 TAAAGTGGACAGAGAGATGGAGG - Intronic
1033585783 7:142773436-142773458 GGCAGTGGGCAGAGAGATGGCGG - Intergenic
1037619896 8:20554593-20554615 CATTGTGGGCAGGCAGAGGGAGG - Intergenic
1040850453 8:51896244-51896266 CATAGTTGGAAGAAATGTGGCGG - Intronic
1041330076 8:56714678-56714700 CAAACTGGGCAGGAAGACGGTGG - Intergenic
1041976712 8:63807575-63807597 CATAATGGGTAGAAAGTGGGTGG - Intergenic
1042777590 8:72450893-72450915 CAAAGTGGGCAGAGACAGGGTGG + Intergenic
1045649442 8:104328529-104328551 CAGGTTGGGCAGAAAGAGGGAGG + Intergenic
1047142975 8:122162820-122162842 AATAGTTGGCAGAATGTTGGGGG + Intergenic
1047612276 8:126532785-126532807 CCAAGTGGACAGAAATATGGGGG + Intergenic
1048744974 8:137604353-137604375 CATAGTAAGCAGAAAGACTGAGG + Intergenic
1049289843 8:141796007-141796029 CTGTTTGGGCAGAAAGATGGGGG - Intergenic
1049632777 8:143667679-143667701 CCAAGTGGGAAGAAAGATGGTGG + Intergenic
1050705574 9:8392851-8392873 CACACTGTGCAGAAAGATGAAGG + Intronic
1050963213 9:11764895-11764917 AATAGAGAGCAGAAGGATGGAGG + Intergenic
1052100498 9:24440616-24440638 CAAAGTGGGCAGGGAGATGTGGG + Intergenic
1052102333 9:24463851-24463873 CATACTTTCCAGAAAGATGGAGG + Intergenic
1052901497 9:33797999-33798021 GGTGGTGGGCAGAGAGATGGTGG - Exonic
1057065660 9:92048259-92048281 CTGAGTGGTCAGAAAGATGTAGG - Intronic
1058803573 9:108568051-108568073 CAGACAGGGGAGAAAGATGGGGG - Intergenic
1059036058 9:110754744-110754766 AATAGTGGGAAGAAAGACAGTGG - Intronic
1060158721 9:121339656-121339678 CTTACTGGCCAGAAAGCTGGCGG - Exonic
1060549924 9:124480063-124480085 CAGTGTGAGCAGAAGGATGGAGG - Intergenic
1061204136 9:129153237-129153259 CACAGTGGGGAGGAAGAAGGAGG + Intergenic
1062214153 9:135380023-135380045 CACAGTGGGCATGAGGATGGAGG - Intergenic
1062463531 9:136671616-136671638 CCTGGTGGGGACAAAGATGGGGG - Intronic
1186017718 X:5216761-5216783 GATAGTAGATAGAAAGATGGTGG + Intergenic
1186432989 X:9520645-9520667 GATAGTGGCTAAAAAGATGGGGG + Intronic
1187900873 X:24025654-24025676 CGTTTTGGGCTGAAAGATGGCGG - Intronic
1188742176 X:33799046-33799068 CATAATGGGAACATAGATGGAGG + Intergenic
1191731389 X:64339484-64339506 CACAGTGGGCTGAAAGGTGAAGG + Intronic
1192201142 X:69067482-69067504 CCAAGTGGGCAGAAAGGTGAAGG + Intergenic
1194161227 X:90454719-90454741 CCTTGTGGGCAAAAATATGGGGG + Intergenic
1194212277 X:91083094-91083116 CATTGTGGGCAGTGAGAAGGAGG + Intergenic
1194379379 X:93175273-93175295 CAAAGAGGGCAGAGAGATGATGG + Intergenic
1194942845 X:100032952-100032974 ATTTGTGGGGAGAAAGATGGGGG - Intergenic
1195274863 X:103272163-103272185 CATATTATTCAGAAAGATGGAGG + Intergenic
1195867597 X:109450029-109450051 CGTGGTGGGCAGAGAGAGGGAGG + Intronic
1195913325 X:109911554-109911576 AATAGTAGGCAGAAAGATAAAGG + Intergenic
1196914130 X:120514230-120514252 AGTAGTGGACAGAAGGATGGAGG - Intergenic
1198699455 X:139382093-139382115 CAAAATGGGCAGAGAGATGCTGG - Intergenic
1199268848 X:145859107-145859129 AATAGAGGGCAGAGAAATGGGGG - Intergenic
1199268854 X:145859133-145859155 GATAGAGGGCAGAGAAATGGGGG - Intergenic
1199418228 X:147611796-147611818 CACAGTAAGCAGAAAGAAGGTGG + Intergenic
1202369557 Y:24187683-24187705 CAGAGTGGGGAGAAATATAGTGG + Intergenic
1202501228 Y:25482434-25482456 CAGAGTGGGGAGAAATATAGTGG - Intergenic