ID: 1005389276

View in Genome Browser
Species Human (GRCh38)
Location 6:25316970-25316992
Sequence AACTTCCCAGTTAAAAACTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 215}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005389276_1005389279 29 Left 1005389276 6:25316970-25316992 CCTTAGTTTTTAACTGGGAAGTT 0: 1
1: 0
2: 3
3: 17
4: 215
Right 1005389279 6:25317022-25317044 ACTACAATTTTAAAACTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005389276 Original CRISPR AACTTCCCAGTTAAAAACTA AGG (reversed) Intronic
900995017 1:6117249-6117271 AACTTGCCAGCTAAAAGATAGGG + Intronic
904706145 1:32392453-32392475 GAATTCCCAGTTAAAAGCTGGGG - Intronic
905070913 1:35224579-35224601 ACCTTCCCAGTTCAAAATTCTGG + Intergenic
908348745 1:63263150-63263172 AATTTCCCAGTTACAATGTAAGG + Intergenic
909244571 1:73263011-73263033 AACTACTCAGTAAAAAATTATGG - Intergenic
909312691 1:74173327-74173349 AACTCACCAGTTAAAAGATAAGG - Intronic
909391992 1:75130138-75130160 AGCTTCCCGGCTAAAAGCTATGG - Intronic
909494452 1:76262826-76262848 TACTTCCACGTTCAAAACTATGG + Intronic
911502643 1:98707399-98707421 ATCATCCCAGTCAAAAATTATGG - Intronic
911726854 1:101250913-101250935 ACCCTGCCAGTTCAAAACTACGG - Intergenic
916000391 1:160609477-160609499 AACTTCCCAGCTCAAAACTCAGG - Exonic
918074253 1:181158510-181158532 CACTTCACAGTGAAAAAATAAGG + Intergenic
918908915 1:190539712-190539734 AAAATTACAGTTAAAAACTAAGG + Intergenic
921175188 1:212587128-212587150 AGCTTCCAAGTTGAAAACAATGG + Intronic
921819516 1:219601298-219601320 TATTTCCCAGATATAAACTAGGG + Intergenic
922960760 1:229643883-229643905 AACTTCCCGTTTGAAAACTAAGG - Intronic
922960921 1:229644895-229644917 AACTTCCCCTTTGAAAAATAAGG - Intronic
924219337 1:241856318-241856340 AACTTCCATGTTCTAAACTATGG - Intronic
924584657 1:245351308-245351330 CACTTCCCAGTTTGCAACTAGGG - Intronic
1065262579 10:23939284-23939306 GACATCCCAGTTAAAAAGCAGGG + Intronic
1065413912 10:25463568-25463590 AGTTTCCCAGTTAACAACTCTGG + Intronic
1066420125 10:35257446-35257468 ACCTTCCCAGATAAAAAATGAGG - Intronic
1066637981 10:37525943-37525965 AACTTTTTTGTTAAAAACTAAGG + Intergenic
1067905915 10:50290846-50290868 AAATTCTCAATTAAAAACTTGGG + Intergenic
1071736731 10:88309268-88309290 AACTTAAAAGTTAAAAAATAAGG + Intronic
1072310479 10:94149593-94149615 AAATTCCCAGATAAAAACCTGGG + Intronic
1074075220 10:110117002-110117024 AACTTCCAAGTTATAAATTAAGG + Intronic
1076086019 10:127632850-127632872 AACTTTCCACTTAAAAGATATGG - Intergenic
1079424709 11:20329204-20329226 TACTCCCCAGTTAAAAGCAATGG + Intergenic
1079512128 11:21223524-21223546 GATTTCCCAGTTAAAATATATGG - Intronic
1079512516 11:21228271-21228293 AGATTCCAAGTTAGAAACTAAGG - Intronic
1080766703 11:35303972-35303994 AACTTCCCATTTACAAATCATGG - Intronic
1080899370 11:36473170-36473192 AACTTCCCTGTGGGAAACTAGGG - Intergenic
1081736598 11:45408769-45408791 AACTTCCCAGCTCAAAAGGATGG - Intergenic
1082093315 11:48107067-48107089 TTCTTCCCACTCAAAAACTAAGG - Intronic
1082828306 11:57597589-57597611 CACTGCCCAGTTACAAATTAAGG - Exonic
1086164385 11:83760777-83760799 ATCTTCCCAGTTCAACACCACGG + Intronic
1086236844 11:84641653-84641675 GACTACCCAGTTAAAAACTCTGG + Intronic
1086586305 11:88456401-88456423 AACTTCTCAGTTACAAACACAGG + Intergenic
1087924647 11:103905258-103905280 AAGTTCCCTTTTAAGAACTAAGG - Intergenic
1088953093 11:114590056-114590078 AACTGCCCAGTTAAAATGGATGG + Intronic
1091077637 11:132635204-132635226 AATTTCCCTGTCTAAAACTATGG + Intronic
1092925350 12:13267199-13267221 AACTTTACAGCTAAACACTAGGG + Intergenic
1093405387 12:18798185-18798207 CATTTCCCAGTTAAAAATTAAGG + Intergenic
1093550961 12:20410789-20410811 AACATCTCTGTTAAAATCTAGGG + Intronic
1093631503 12:21415077-21415099 AACTCACCAGTTAAAAGATACGG - Intronic
1095512054 12:42962067-42962089 AACTTCGAATTTAAAAAGTATGG - Intergenic
1095872100 12:47040051-47040073 AAAATCCCAGTTAAAAATAATGG - Intergenic
1097112635 12:56673208-56673230 ACATTCCAAGTTAAAACCTATGG + Intronic
1099205904 12:79726278-79726300 ATCTTCCCAGAGCAAAACTAAGG + Intergenic
1100332359 12:93596436-93596458 GACTTCCCAGTTAGTAACTCAGG - Intergenic
1100910685 12:99358595-99358617 AACTTACCAGTTAAAAACTGTGG - Intronic
1101678856 12:106944752-106944774 AAATTCCCAGTGAAAAAATAAGG + Intergenic
1102099761 12:110269436-110269458 AGCCTCCCAGTATAAAACTAGGG - Intergenic
1102807161 12:115792200-115792222 AAGTTCCCATTTAAAGAATAAGG + Intergenic
1104131574 12:125898967-125898989 GATTTCCCAGTCAAAAATTAAGG - Intergenic
1106456264 13:29929975-29929997 AAGTGCACAGTTAAAACCTAGGG - Intergenic
1107667732 13:42709725-42709747 AACTTTTTTGTTAAAAACTAAGG + Intergenic
1108515140 13:51194419-51194441 AACTTAGCAATTAAAAACTCTGG + Intergenic
1108946618 13:56033971-56033993 AGCTTCCCAGTGAGAAACTCTGG - Intergenic
1109431523 13:62242184-62242206 AACTTTTTTGTTAAAAACTAAGG + Intergenic
1113317036 13:109191748-109191770 TACTTTCCAGTTATGAACTACGG + Intronic
1116216037 14:42018355-42018377 AACTACCCTTTTAAAAACTCAGG - Intergenic
1116926821 14:50647595-50647617 AACGACCCAGTTAAAAAAAAGGG + Intronic
1117786556 14:59291901-59291923 CACTTCCCATTTAAGATCTAGGG + Intronic
1118053844 14:62057522-62057544 AACTTCCCAGGTAAATACAGTGG + Intronic
1119941854 14:78649628-78649650 AACTTCCAAGTTACATACTAGGG + Intronic
1120874921 14:89367163-89367185 AAGTTCCCTGTTGAAAATTAGGG - Intronic
1121142269 14:91554195-91554217 AACTGCCCACTTAAAAAATTGGG - Intergenic
1125143613 15:36439855-36439877 AATTTGCCAGTTACAAACTGGGG + Intergenic
1126725594 15:51628424-51628446 TATTTCCCAGCTAAAAACTGAGG - Intergenic
1127708365 15:61569434-61569456 AAGTTTTCAGTTATAAACTATGG + Intergenic
1127872058 15:63081945-63081967 TTCTTCCCAGTTAACAACTGGGG + Intergenic
1128343288 15:66837462-66837484 AACTTACCAGTTTACACCTAAGG + Intergenic
1129507026 15:76089923-76089945 ATCTTCCCAGTTAAGAGCCATGG - Intronic
1130787075 15:87111183-87111205 AACTTCCCAGTGAAACAAGATGG - Intergenic
1130835734 15:87647882-87647904 AACTCCACAGTTAAAAACTAGGG - Intergenic
1131814894 15:96211947-96211969 AGCTTCCCAGCTAGAAACTTGGG + Intergenic
1135237754 16:20774634-20774656 AATTCCCCAGTTAAAAGATATGG - Intronic
1135376781 16:21953924-21953946 AACTTCATTGTTAAATACTATGG + Intronic
1138787965 16:59869047-59869069 AATCTCCCAGTTAAAAAAGAAGG + Intergenic
1139057567 16:63204122-63204144 AACATTTTAGTTAAAAACTAAGG + Intergenic
1139077145 16:63465054-63465076 AACTGCCCAGTTTAAAATAATGG - Intergenic
1140583723 16:76262023-76262045 CACTTCCCAGTTAGAGACTGGGG - Intergenic
1141124990 16:81394842-81394864 AACCTTCCAGTTAAAAGCTCAGG + Intergenic
1142126419 16:88412832-88412854 ATCTCCCCATTTAAAAACTTTGG - Intergenic
1144153227 17:12471519-12471541 AACTTCCAAGTTAATAGCTTTGG + Intergenic
1144752499 17:17659013-17659035 AACAATCCAGTTAAAAAATAGGG + Intergenic
1145220104 17:21081554-21081576 AACAACCCAATTAAAAAATAGGG + Intergenic
1148042182 17:44716691-44716713 ATCTCCCCAGTTAAGAACCACGG + Intronic
1149039254 17:52168410-52168432 ATCTTCCCACATAAAAAATAAGG - Intergenic
1149267018 17:54938132-54938154 AAATTCTCAATTAAAAACTCAGG - Intronic
1149398874 17:56273458-56273480 AATTTCTAAGTTAAAAACAATGG + Intronic
1153729424 18:7993989-7994011 AATCTCCCAGTTAAAAGATATGG + Intronic
1154969209 18:21390496-21390518 AACTTTTTTGTTAAAAACTAAGG - Intronic
1155352649 18:24921999-24922021 AATTTCTCAGTGAAAAATTATGG - Intergenic
1165452857 19:35895172-35895194 TTATTCCCAGTTAACAACTAGGG + Intronic
1168049120 19:53815531-53815553 AACTTCCCAGTCAAAAAGATTGG - Intronic
927349070 2:22085302-22085324 AATTTATCATTTAAAAACTAAGG + Intergenic
930303288 2:49644690-49644712 AATTTGCCATTTAAAAAATATGG - Intergenic
930445072 2:51460017-51460039 AACTTTACAGTGAAAAAATAGGG - Intergenic
930714430 2:54579615-54579637 ATCTTCCCAGTTCAAAAGCAGGG - Intronic
930833118 2:55766730-55766752 AACTTCCAAATCAAAATCTATGG + Intergenic
933057665 2:77693217-77693239 AACTTTACAGTTAAAAAAAATGG - Intergenic
933904500 2:86876905-86876927 AACTACCCAATTAAAAAATTGGG + Intergenic
935528569 2:104203802-104203824 AACTTCTCAGGGAAAAAATAAGG - Intergenic
936367739 2:111875246-111875268 AACTACCCAATTAAAAAATTGGG - Intronic
937623717 2:124020417-124020439 AACTTCCCAGCTAGAAATTGTGG + Intergenic
941400145 2:165020600-165020622 ATCTTCCTAGTTAAAAAGAAAGG + Intergenic
941689653 2:168486670-168486692 AAATTTGCAGTTAAAAAGTAAGG - Intronic
942074695 2:172346105-172346127 AATTTGCCATTTAAAAACCAAGG - Intergenic
943188723 2:184648438-184648460 AACTTCCCACTTAAAAGACATGG + Intronic
944207183 2:197169127-197169149 AACTTCCCAGAAGAAAATTAAGG - Intronic
944357251 2:198805891-198805913 AACTTTCCAGATTTAAACTATGG + Intergenic
945598700 2:211830315-211830337 AACAACCCAGTTAAGAAATAAGG + Intronic
1170022170 20:11848384-11848406 ACCTTACCATTTAAAAAATAAGG - Intergenic
1170044996 20:12075491-12075513 TATTTACCAGTTAAAAATTAAGG - Intergenic
1171765416 20:29265469-29265491 AACTGCTCAGTTAAAAAAAAAGG - Intergenic
1173175153 20:40759284-40759306 AGCATCACAGTTAAAAACAAGGG + Intergenic
1174748538 20:53088525-53088547 AACTTGGCATTTAAAAACTTGGG - Intronic
1177807024 21:25884521-25884543 AACTTGTAAGTTAAAAACCATGG + Intronic
1182889465 22:33805047-33805069 ATCTTCCCAGTTAGAATATATGG + Intronic
1185295847 22:50054384-50054406 TACATCCCAGTTAAAAGGTAAGG + Intronic
952013108 3:28924471-28924493 TACTTGCCTGTTAAAAATTAAGG + Intergenic
952450883 3:33431775-33431797 ATTTTCCCAGTAAATAACTAAGG + Intronic
952636069 3:35533645-35533667 AAGATCCCAGTTAAAAAGTCAGG + Intergenic
953268201 3:41413722-41413744 AACTCCCCAAATCAAAACTATGG + Intronic
955827182 3:62960676-62960698 ATTTTCCAAATTAAAAACTAAGG - Intergenic
956250110 3:67226762-67226784 ATCTTCCCAGTTAAGGTCTATGG + Intergenic
957607337 3:82418340-82418362 AACTTCAAATTTTAAAACTATGG + Intergenic
958160688 3:89814153-89814175 AACTTTCCAATCAAAAACAATGG + Intergenic
958508347 3:95011962-95011984 AATTTTCCAATTAAAAACTGAGG + Intergenic
958877628 3:99633929-99633951 AACTACCCAGGTGAAAACTTGGG - Intergenic
959240835 3:103792071-103792093 AATTTCCCAGTAAAACAATATGG + Intergenic
959305346 3:104657528-104657550 AACTTTCCACTTAAAAAATATGG - Intergenic
959809956 3:110605144-110605166 ACATTCTCAGATAAAAACTAAGG + Intergenic
960271405 3:115678313-115678335 GAAATCCCAGTTAAAAAATATGG - Intronic
961101444 3:124202552-124202574 GACTTCTCATTAAAAAACTAGGG - Intronic
963571501 3:147002659-147002681 ATCATCCCAGTTTAAAACTGAGG + Intergenic
964991875 3:162823932-162823954 ACTTTCTCAGTCAAAAACTAAGG - Intergenic
965047284 3:163595727-163595749 AACCTCCCAATAAATAACTAGGG - Intergenic
965636512 3:170787635-170787657 AACAACCCAGTAAAAAATTAGGG - Intronic
967920088 3:194608077-194608099 AACTTCCCAGTGCAAAGCTTTGG + Intronic
968720389 4:2198262-2198284 AACTTCACAGTGAGAAGCTAGGG - Intronic
969132538 4:5002345-5002367 AACTCCCCAGTTACCAACAAAGG - Intergenic
970753078 4:19389048-19389070 AATTTCCCAATTAAAAGTTATGG + Intergenic
972675981 4:41259684-41259706 GACTTCCCAGTTAAAGAGTAGGG - Intronic
972741517 4:41891498-41891520 AAATTTCCAGTCAAAACCTACGG - Intergenic
973064413 4:45770384-45770406 GACTTCCAAGTAAAATACTATGG - Intergenic
973227066 4:47798577-47798599 AACATCTCAGTTACAAAATAAGG + Intronic
973549892 4:52023404-52023426 TTCTTCCCAGTGCAAAACTAAGG + Exonic
973620198 4:52718512-52718534 AACTTCTCATTAAAAAACTTAGG - Intergenic
973964198 4:56144515-56144537 AACATCCCAGTTAGAAACCCTGG - Intergenic
974735986 4:65933122-65933144 AACTCCTCTGTTAAAAAATAAGG - Intergenic
976982775 4:91252267-91252289 ACATTCCCAGATAAAAACTGAGG + Intronic
977236758 4:94516835-94516857 AACATCCCTCTTAAAATCTAAGG - Intronic
979983069 4:127280358-127280380 AACTTCCCAGAACAAAATTATGG + Intergenic
980164562 4:129209705-129209727 AATTTCCCAGTTGATAACGATGG + Intergenic
981791846 4:148546381-148546403 AAATCACCAGTTAAAAACTATGG - Intergenic
983499276 4:168480508-168480530 AACTCCCTAGATAAAAACTCAGG - Intronic
985265035 4:188149222-188149244 AACATTCCATTTAAAAACAAAGG - Intergenic
986878067 5:12134856-12134878 AACTCTCCAGCTAAAAACAATGG + Intergenic
987361018 5:17106490-17106512 AACTTACCAATTAAAAAAAAGGG - Intronic
989027273 5:37082156-37082178 GACTTTCCAGTTAGAAACAATGG + Intergenic
990103446 5:52222845-52222867 AACTTCACATTTTAAAATTAAGG - Intergenic
990525534 5:56623271-56623293 AACTTCCCAGTTATAAAGACTGG + Intergenic
990988734 5:61664532-61664554 AACTGCTCATTTAAAAAATAAGG - Intronic
993315895 5:86405851-86405873 TGCTTCCCAATTTAAAACTAGGG - Intergenic
993411138 5:87574624-87574646 AATTTTCAAGTTAAAAATTAGGG + Intergenic
994320565 5:98389924-98389946 ATCTTCTCAGTTAAACACTTTGG - Intergenic
996822999 5:127651430-127651452 AACGTGCCAGTGAAAAACTAGGG + Intronic
1000474763 5:161692347-161692369 AACTTCACAGAGAAAAGCTATGG + Intronic
1000493413 5:161945653-161945675 AACTTGAGAGTTAAAAACTACGG - Intergenic
1000729866 5:164820430-164820452 AGCTTTCCAGTTAAAAGCAAAGG - Intergenic
1000910894 5:167020557-167020579 AACTTCTCAGCTATAAAATAAGG + Intergenic
1001107587 5:168868442-168868464 AACTTTCACGTTAAAAATTATGG + Intronic
1001289606 5:170447465-170447487 AACTTCCCATTCAAACTCTAGGG - Intronic
1002456451 5:179347876-179347898 AACTTCACAGTTAAACCCTCAGG + Intergenic
1002775289 6:323283-323305 AACTTCTCAATTCAAACCTAGGG - Intronic
1003000883 6:2331803-2331825 AATTCCCCAGCTAAAATCTAAGG + Intergenic
1003268942 6:4590525-4590547 AACGTAGCAGTTAAAAGCTAGGG + Intergenic
1004125049 6:12865095-12865117 AACTTCCCATTTTAAAAGTTGGG - Intronic
1005247189 6:23900695-23900717 AACTGCCCAGTTAAAACATGTGG - Intergenic
1005368657 6:25106649-25106671 AATTTCCAAGATAAAAACTCCGG - Intergenic
1005389276 6:25316970-25316992 AACTTCCCAGTTAAAAACTAAGG - Intronic
1009566132 6:65313292-65313314 TATTTCCCAGATATAAACTAGGG - Intronic
1010052066 6:71517413-71517435 AACTTTTTTGTTAAAAACTAAGG + Intergenic
1013145004 6:107380600-107380622 AACTTGAGAGTTAAAAACTAAGG - Intronic
1014045841 6:116885077-116885099 ATCTTCCAAGATAAAAGCTAAGG - Intronic
1014084412 6:117326738-117326760 AACTTCCCAGTTAAAAATCATGG - Intronic
1014673193 6:124332108-124332130 AAGTTTGCACTTAAAAACTAAGG - Intronic
1017135619 6:151144893-151144915 AACTACCCAGATACAAATTAAGG - Intergenic
1018371629 6:163173805-163173827 AAGTTCCTAGTTAAAACCTTGGG + Intronic
1021445878 7:20733023-20733045 AACTACCCTGTGAAATACTATGG + Intronic
1024457378 7:49625061-49625083 AACTGCCAAGTTAAAACCCATGG + Intergenic
1026011188 7:66637725-66637747 CACTTCCCAGTTAATCCCTACGG - Intronic
1026016448 7:66674791-66674813 CACTTCCCAGTTAATCCCTACGG - Intronic
1027482424 7:78715418-78715440 ATCTTACCTGTTAAAAATTAAGG + Intronic
1027636171 7:80677575-80677597 ATCTTCCCAGTTAAAAGGAAAGG - Intronic
1028664829 7:93329699-93329721 GACTTCCCATTAAAAAGCTATGG + Intronic
1029144759 7:98437912-98437934 AACTTTCTAGTTAAAAAAGAGGG + Intergenic
1029225173 7:99021495-99021517 ACCTTCCCAGATAAAAGCTGAGG + Intergenic
1030240106 7:107313199-107313221 AACTTCTCAATTAAAAGCTTGGG + Intronic
1031504996 7:122571162-122571184 AGCAACCCAGTTAAAAACTGGGG + Intronic
1038371812 8:27001531-27001553 AACACCCCAGTTGAAAACAAAGG - Intergenic
1039167454 8:34700100-34700122 AACATCCAAATTAAAACCTACGG - Intergenic
1040125972 8:43738243-43738265 ATAATCCCAGATAAAAACTAGGG + Intergenic
1041508280 8:58625744-58625766 AACTCCCCAATCAAAAAATATGG - Intronic
1042418878 8:68561447-68561469 AACTTTTCTGTTAAAAACTAAGG + Intronic
1043909530 8:85845264-85845286 AACTTTTCTGTTAAAAACTAAGG - Intergenic
1044766314 8:95578872-95578894 AACTTTCCACTTAAAAACACTGG + Intergenic
1044797165 8:95914942-95914964 AAGTTTACAGTTAAAAATTAAGG - Intergenic
1045123193 8:99061060-99061082 AACTTCAAAGTTTCAAACTAAGG - Intronic
1045413775 8:101946009-101946031 AGCATCCCAGTTAATAAATAGGG + Intronic
1045892587 8:107174977-107174999 AAGCTCCCAGTTAAGAGCTATGG + Intergenic
1046100846 8:109612415-109612437 AGCTTGCCAGTTATAAGCTAAGG - Intronic
1047066127 8:121285141-121285163 AATTTCCCAGTTAACATGTATGG + Intergenic
1051955949 9:22693493-22693515 ACAATCCCAGTGAAAAACTAGGG + Intergenic
1052215162 9:25958074-25958096 AACTTTCCACTTAAAAGATATGG + Intergenic
1056420409 9:86420809-86420831 AAGTCCCCAGTTAAAGACTTAGG + Intergenic
1057421251 9:94914667-94914689 ATCTTCCCATTTATAAACTTTGG + Intronic
1187221104 X:17326958-17326980 AACTTCCTATTCAAAAAATAGGG - Intergenic
1188125158 X:26358418-26358440 AACTGACCATTTAAAAACTAAGG + Intergenic
1190037680 X:47040852-47040874 AACTTCCCAGTAAAAGACCCTGG - Intronic
1190605459 X:52138455-52138477 AACAACCCAATTAAAAAATAGGG + Intergenic
1190925185 X:54897048-54897070 AACTTTCCACTTAAAATATAAGG + Intergenic
1191936453 X:66432557-66432579 AACTCCACAGTTAAAAGCTCTGG + Intergenic
1193234031 X:79084632-79084654 TACTTCTCTGTTAAATACTAAGG + Intergenic
1193677920 X:84479879-84479901 AACAACCCAATTAAAAAATATGG - Intronic
1194100610 X:89699270-89699292 AAATTCACATTTAAAAACTCAGG + Intergenic
1195272915 X:103250858-103250880 AACTTCCCAGTTGAAAACATTGG - Intergenic
1196646805 X:118126917-118126939 AACTTAACATTTAAAAACTGAGG + Intergenic
1197583960 X:128320974-128320996 ATCTTTCCAGATAAAAACTTTGG + Intergenic
1198894482 X:141437789-141437811 AAATTCCCACTAAAATACTAAGG + Intergenic
1199923320 X:152434020-152434042 AAATTCACAGTTAAAAACCTTGG + Intronic
1200453565 Y:3360330-3360352 AAATTCACATTTAAAAACTCAGG + Intergenic