ID: 1005389278

View in Genome Browser
Species Human (GRCh38)
Location 6:25316982-25317004
Sequence ACTGGGAAGTTGAGCAGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005389275_1005389278 -10 Left 1005389275 6:25316969-25316991 CCCTTAGTTTTTAACTGGGAAGT 0: 1
1: 0
2: 0
3: 18
4: 220
Right 1005389278 6:25316982-25317004 ACTGGGAAGTTGAGCAGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005389278 Original CRISPR ACTGGGAAGTTGAGCAGAGA GGG Intronic
No off target data available for this crispr