ID: 1005389957

View in Genome Browser
Species Human (GRCh38)
Location 6:25322980-25323002
Sequence GAGGAGGGCTAGAATTGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005389953_1005389957 0 Left 1005389953 6:25322957-25322979 CCATTTGTATTAGGGAAGACTCA 0: 1
1: 0
2: 0
3: 9
4: 154
Right 1005389957 6:25322980-25323002 GAGGAGGGCTAGAATTGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005389957 Original CRISPR GAGGAGGGCTAGAATTGTGA TGG Intronic
No off target data available for this crispr