ID: 1005389957 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:25322980-25323002 |
| Sequence | GAGGAGGGCTAGAATTGTGA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1005389953_1005389957 | 0 | Left | 1005389953 | 6:25322957-25322979 | CCATTTGTATTAGGGAAGACTCA | 0: 1 1: 0 2: 0 3: 9 4: 154 |
||
| Right | 1005389957 | 6:25322980-25323002 | GAGGAGGGCTAGAATTGTGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1005389957 | Original CRISPR | GAGGAGGGCTAGAATTGTGA TGG | Intronic | ||
| No off target data available for this crispr | |||||