ID: 1005392674

View in Genome Browser
Species Human (GRCh38)
Location 6:25349631-25349653
Sequence GGCCATGTGATCATCCCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 151}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005392674_1005392682 5 Left 1005392674 6:25349631-25349653 CCACCAGGGATGATCACATGGCC 0: 1
1: 0
2: 0
3: 11
4: 151
Right 1005392682 6:25349659-25349681 GCGGCCCTTCACCATGGGCAAGG 0: 1
1: 0
2: 1
3: 6
4: 97
1005392674_1005392681 0 Left 1005392674 6:25349631-25349653 CCACCAGGGATGATCACATGGCC 0: 1
1: 0
2: 0
3: 11
4: 151
Right 1005392681 6:25349654-25349676 CTGAGGCGGCCCTTCACCATGGG 0: 1
1: 0
2: 0
3: 4
4: 84
1005392674_1005392680 -1 Left 1005392674 6:25349631-25349653 CCACCAGGGATGATCACATGGCC 0: 1
1: 0
2: 0
3: 11
4: 151
Right 1005392680 6:25349653-25349675 CCTGAGGCGGCCCTTCACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005392674 Original CRISPR GGCCATGTGATCATCCCTGG TGG (reversed) Intronic
901775179 1:11555674-11555696 GACCAGGTGACCATTCCTGGAGG + Intergenic
911445262 1:97984486-97984508 GGCTGTGTGATCATCCCAAGGGG - Intergenic
912286041 1:108370396-108370418 GGCCACGGGATGCTCCCTGGAGG + Intergenic
913599585 1:120410377-120410399 GGCCATGGGAAGAACCCTGGAGG - Intergenic
913687457 1:121246341-121246363 AGTCTTATGATCATCCCTGGAGG + Intronic
914039319 1:144033986-144034008 AGTCTTATGATCATCCCTGGAGG + Intergenic
914087796 1:144469238-144469260 GGCCATGGGAAGAACCCTGGAGG + Intergenic
914150140 1:145033950-145033972 AGTCTTATGATCATCCCTGGAGG - Intronic
914212804 1:145596318-145596340 GGCCATGGGATGCTCCATGGAGG - Intergenic
914314358 1:146495756-146495778 GGCCATGGGAAGAACCCTGGAGG + Intergenic
914382736 1:147132860-147132882 GGCCATGGGATGCTCCATGGAGG - Intergenic
914499991 1:148237625-148237647 GGCCATGGGAAGAACCCTGGAGG - Intergenic
914591288 1:149108180-149108202 GGCCATGGGAAGAACCCTGGAGG + Intergenic
916557492 1:165905933-165905955 GCTGATGTGATCATCCCTAGAGG + Exonic
917698558 1:177555830-177555852 GGGCAAGTGATCATTCTTGGTGG - Intergenic
919388676 1:196954374-196954396 GCCCATGAGAGCAGCCCTGGGGG - Intronic
920474785 1:206264861-206264883 AGTCTTATGATCATCCCTGGAGG + Intronic
921222144 1:212980913-212980935 GGCCATATGAATTTCCCTGGGGG - Intronic
924900429 1:248392356-248392378 GGCCATTTGGCCATCCCTGCAGG + Intergenic
1064679228 10:17792720-17792742 GGCCATGTGAGCCTCTCAGGAGG + Intronic
1064902649 10:20311734-20311756 GACCATGAGATCAGCCATGGGGG - Intergenic
1065321041 10:24510458-24510480 GTCCATGAAATCATCCTTGGTGG + Intronic
1074516897 10:114178914-114178936 GGGCATGTGATTATACCTGTTGG - Intergenic
1075646186 10:124098231-124098253 GATGATGTGGTCATCCCTGGAGG - Intergenic
1076420367 10:130327199-130327221 GGCCATCTGTTCATTCCAGGAGG + Intergenic
1076425849 10:130367129-130367151 GGCCATGAGGTCTTCCCTTGTGG + Intergenic
1078006204 11:7534475-7534497 GTCCATTTGTTCCTCCCTGGAGG + Intronic
1078335971 11:10463418-10463440 AGCAGTGTGCTCATCCCTGGAGG + Intronic
1079376893 11:19901069-19901091 AGCCATCTCATCATCCCTTGAGG + Intronic
1079387484 11:19993664-19993686 GGCCATGTGATCAGACTGGGTGG - Intronic
1079695261 11:23474572-23474594 GAACATGTGGTGATCCCTGGAGG + Intergenic
1084447561 11:69212626-69212648 GGCCATGTGCTCAGAGCTGGTGG - Intergenic
1084758921 11:71256127-71256149 GGCCATGAGCTCTTCCCTTGAGG + Intergenic
1087718145 11:101632565-101632587 GGCGATGTGATCATACCTCTGGG - Intronic
1089286438 11:117410889-117410911 TGCCAGGTGAGCCTCCCTGGGGG + Exonic
1090940651 11:131385167-131385189 GGGCATGTGATCATCCACAGGGG - Intronic
1091623130 12:2105036-2105058 GGCCTTGTGGTCATCGCAGGTGG + Intronic
1091671911 12:2457973-2457995 GGCCATCTGAGCCACCCTGGAGG + Intronic
1093836117 12:23830929-23830951 GGCCTTGTGAACATCCCTACAGG - Intronic
1095369761 12:41453091-41453113 AGCCATGCCATTATCCCTGGAGG + Intronic
1097633524 12:62093745-62093767 GGCCATGTGTTCATACTTTGAGG + Intronic
1101568101 12:105928600-105928622 TGCCAGGTGATCACACCTGGTGG - Intergenic
1105259162 13:18766180-18766202 GCCCATGAGAGCATCCATGGGGG + Intergenic
1106638171 13:31553363-31553385 AGCCATCTGATCTTCCCTGGGGG - Intergenic
1109300418 13:60585027-60585049 GGCCATGTGATCAGCCTGTGAGG + Intergenic
1110405305 13:75144285-75144307 GCCCATGTAAGCCTCCCTGGAGG - Intergenic
1111962039 13:94822561-94822583 GTACAGGTGAGCATCCCTGGTGG - Intergenic
1112300957 13:98229802-98229824 GGTCATGTCAGCAACCCTGGTGG + Intronic
1112633322 13:101185705-101185727 GGCTATTTCATCACCCCTGGGGG - Intronic
1114413085 14:22518697-22518719 GGCCGTGTGATTAACGCTGGAGG + Intergenic
1121732603 14:96197005-96197027 GGCAATGTGGTCCTCTCTGGGGG + Intergenic
1122227541 14:100288512-100288534 TGCCATGTGACCCGCCCTGGTGG + Intergenic
1122788428 14:104174459-104174481 GCCCATGTGGCCCTCCCTGGGGG + Intronic
1124847799 15:33309299-33309321 GGCCATATGAGCATTCCAGGTGG - Intergenic
1126987558 15:54330337-54330359 TGGCATGTGGTCATCCTTGGAGG + Intronic
1128694400 15:69749597-69749619 GGCCATGTGACTATCCCTATAGG + Intergenic
1129870383 15:78936471-78936493 GCCCATGTTAGCATCCCTGGAGG + Intronic
1131916623 15:97272439-97272461 GGCCATGTGATCAAGTTTGGAGG - Intergenic
1132559823 16:588571-588593 GGCCATGTCTTCAGCTCTGGGGG + Intergenic
1133555515 16:6903256-6903278 GGCCATATGAGCTCCCCTGGCGG - Intronic
1136052542 16:27662424-27662446 GTCCAGTTGGTCATCCCTGGGGG - Intronic
1136702936 16:32159949-32159971 GCCCATGTGGTCAGCCCTGATGG + Intergenic
1136764764 16:32767647-32767669 GCCCATGTGGTCAGCCCTGATGG - Intergenic
1136803335 16:33102737-33102759 GCCCATGTGGTCAGCCCTGATGG + Intergenic
1138272037 16:55702337-55702359 GGCCATCTGAGCCTGCCTGGAGG + Intronic
1203067120 16_KI270728v1_random:1029772-1029794 GCCCATGTGGTCAGCCCTGATGG - Intergenic
1144734297 17:17546365-17546387 GGCCATTTGATTCTGCCTGGTGG - Intronic
1146617756 17:34370323-34370345 GGCCATGTGCTGATATCTGGAGG + Intergenic
1149292590 17:55231882-55231904 GGCTCAGAGATCATCCCTGGAGG - Intergenic
1149660002 17:58329297-58329319 GGCCATGTGGGCTTCCCTGGTGG - Intergenic
1150621805 17:66813213-66813235 GGCCATGGGATTTGCCCTGGAGG + Intergenic
1150929217 17:69565921-69565943 GGCCATGTGTTCCTCCCTTTTGG + Intergenic
1151034583 17:70783456-70783478 GGCCATTTCACCATCCTTGGTGG + Intergenic
1151667949 17:75556330-75556352 GGGCATGAGTGCATCCCTGGTGG + Intronic
1159018982 18:63127560-63127582 GCCCTGTTGATCATCCCTGGAGG + Exonic
1160695788 19:483673-483695 GGCCCTGTGGACATCCCAGGTGG - Intergenic
1161700145 19:5790016-5790038 GGCCACGTGAGCATTCCTGCCGG - Intronic
1163491633 19:17620316-17620338 GGCCATCTGGTCATTCCTAGAGG + Intronic
1163827127 19:19530018-19530040 GGCCAGGTGATCCCCCGTGGTGG + Intronic
1164750698 19:30652819-30652841 GGGCTTGGGGTCATCCCTGGTGG + Intronic
1202637109 1_KI270706v1_random:52157-52179 GCCCATGAGATCAGCCATGGGGG + Intergenic
925405556 2:3603679-3603701 GGACATCTGACCATCCCAGGAGG - Intronic
927419695 2:22917283-22917305 GGCCATGTGATGTTCCCCAGAGG + Intergenic
927497867 2:23562821-23562843 GACCATGCAAGCATCCCTGGGGG + Intronic
927949019 2:27155046-27155068 GGCCATGCGGTCACCCCTGAGGG - Exonic
928986657 2:37188852-37188874 GGTCATGTAATCAGCCCTTGGGG - Intronic
933778739 2:85787342-85787364 GGGCATTTGATGACCCCTGGGGG + Exonic
935028888 2:99303372-99303394 GGCCATGTTAGCATCCTGGGAGG + Intronic
935118368 2:100157974-100157996 GACCTTCTGAACATCCCTGGAGG - Intergenic
935483835 2:103627900-103627922 GGCCATGTGAATGACCCTGGAGG + Intergenic
938108269 2:128547839-128547861 GGCCATGTCATCCCTCCTGGAGG - Intergenic
938671929 2:133595085-133595107 GGCCATGAGATGACTCCTGGGGG + Intergenic
943650889 2:190456539-190456561 GGCCATGCCATCAGCCCTGCAGG - Intronic
943719800 2:191191841-191191863 GGTCACGTGTTCATGCCTGGAGG - Intergenic
945682875 2:212935033-212935055 TGCTATGTGAACATCCATGGTGG + Intergenic
948465833 2:238151190-238151212 TGCCGTCTGATCACCCCTGGTGG - Exonic
1169489823 20:6061827-6061849 TGCAATGTGATCAGCCCTGGGGG - Intergenic
1169572517 20:6922167-6922189 GGCCATGTGACTATCACTGGTGG - Intergenic
1170956431 20:20984278-20984300 GGCCTTGTGTACATCCCTTGTGG - Intergenic
1171214567 20:23342768-23342790 GGCCATTTGAACAATCCTGGTGG - Intergenic
1173456201 20:43203651-43203673 AGTCATGTGCTCATCCCTGTTGG + Intergenic
1173499890 20:43545492-43545514 TGCCAAGTGGTCATCCCAGGAGG - Intronic
1175201815 20:57283315-57283337 GGCCCTTTGCTCAGCCCTGGTGG + Intergenic
1175573036 20:60038522-60038544 GGCCCAGTGACCATCCCTGCTGG - Intergenic
1176385962 21:6138656-6138678 GGCCCTGTGCTCCTCACTGGAGG - Intergenic
1179737511 21:43399596-43399618 GGCCCTGTGCTCCTCACTGGAGG + Intergenic
1180067147 21:45418220-45418242 GGCCGGGTGCTCATCCCTGGTGG + Intronic
1180787011 22:18553065-18553087 GGCCATGTGGTCAGGCCAGGCGG - Intergenic
1181234729 22:21442241-21442263 GGCCATGTGGTCAGGCCAGGCGG + Intronic
1182062063 22:27405421-27405443 AGCCCTGTGCTCAGCCCTGGGGG - Intergenic
1182115699 22:27755095-27755117 GGCCATGTCACCAGCTCTGGTGG + Intronic
1182769611 22:32784976-32784998 TACCAAGTGATCATACCTGGAGG - Intronic
1183336796 22:37253207-37253229 GGCCCTATGATCATGTCTGGGGG + Intergenic
1184413496 22:44338956-44338978 GGCCATCATCTCATCCCTGGGGG + Intergenic
955949164 3:64224909-64224931 GGGCATTTCATCCTCCCTGGAGG - Exonic
955999525 3:64714393-64714415 GGCCAGGTGTTTATACCTGGTGG - Intergenic
961461594 3:127053495-127053517 GGCCATGAGAACATCTCTGCTGG - Intergenic
963765117 3:149326793-149326815 GCCAATGTGAACATCCCTGTAGG + Intronic
966680025 3:182631989-182632011 GGCCATGTGATCCTGCCGGGAGG - Intergenic
966693729 3:182767871-182767893 GGCCATGTACTCATCCTTGATGG - Intergenic
967816788 3:193806156-193806178 GGAAATGTGTTCATCCCTAGGGG - Intergenic
985949278 5:3210937-3210959 GACCGTGTGATTCTCCCTGGGGG + Intergenic
986480041 5:8177389-8177411 CCCCATGTGATCATACTTGGAGG + Intergenic
988276489 5:29087587-29087609 GGCAATATGATCTTCCCTTGTGG + Intergenic
993306091 5:86277158-86277180 GGCCACGGGATGCTCCCTGGAGG + Intergenic
994285534 5:97960783-97960805 CTCCATCTGTTCATCCCTGGGGG - Intergenic
995063347 5:107835190-107835212 GGATTTGTGATCCTCCCTGGAGG + Intergenic
1000420111 5:161029051-161029073 TGCCATGTAATCATCACTGAGGG - Intergenic
1005392674 6:25349631-25349653 GGCCATGTGATCATCCCTGGTGG - Intronic
1006604973 6:35249613-35249635 CCCCATGTGATGCTCCCTGGGGG + Exonic
1010339716 6:74734559-74734581 TGCCATGTGTGAATCCCTGGAGG + Intergenic
1012346884 6:98199187-98199209 GGCCATGCCATCATCCTTAGTGG - Intergenic
1018953383 6:168392787-168392809 GGCAATGTGCACATCCCTGGAGG + Intergenic
1019235643 6:170610015-170610037 GGCCATGTCTGCATCCCGGGCGG + Intergenic
1020732441 7:11898528-11898550 GCCCATGTGATGAGCCCTGGAGG - Intergenic
1026625044 7:71984611-71984633 CACCATGTGAACATCACTGGAGG + Intronic
1027435418 7:78159279-78159301 GGCCATTTAAACATCCCTGTAGG - Intronic
1029580709 7:101435342-101435364 GGCCATGTAGTCGCCCCTGGAGG + Intronic
1033755638 7:144396761-144396783 CTCCATGTGGTCATGCCTGGTGG + Intergenic
1035515475 8:228986-229008 GGCCATGTCTGCATCCCGGGCGG + Intergenic
1037707539 8:21327875-21327897 GGGCAGGTGATCATCTTTGGGGG - Intergenic
1038844196 8:31213639-31213661 GGCCTTCAGATTATCCCTGGTGG + Intergenic
1039212983 8:35236495-35236517 GGCCAAGTGCTCATCCCGGCTGG - Intronic
1040283765 8:46089167-46089189 GGCCCCGTGGTCATCCATGGGGG - Intergenic
1049693918 8:143974533-143974555 GGCCAGGTGCTGAGCCCTGGGGG - Intronic
1052325101 9:27209127-27209149 GTCCCTGTGATCATCTTTGGAGG - Exonic
1053662779 9:40296016-40296038 GTCCATGAGAGCATCCATGGGGG - Intronic
1054374908 9:64442240-64442262 GTCCATGAGAGCATCCATGGGGG - Intergenic
1054521834 9:66080268-66080290 GTCCATGAGAGCATCCATGGGGG + Intergenic
1058297773 9:103330184-103330206 GGCCATGTTATTTTTCCTGGGGG - Intergenic
1058864968 9:109153427-109153449 GGCAATGTGATAATCCCACGAGG + Intronic
1060343924 9:122800539-122800561 GGCCATGTGCGCAGCCCTGGTGG + Exonic
1061404473 9:130385757-130385779 GCCCAGGTGAGCAACCCTGGGGG + Intronic
1061579102 9:131525943-131525965 GCCGATGTGATCATCCCGCGAGG - Exonic
1062165293 9:135104615-135104637 GGCCCTGTGAACATCCCGTGAGG - Intronic
1062641231 9:137519637-137519659 GGCCATCTGATGAGACCTGGGGG + Intronic
1187322124 X:18249352-18249374 AGCCATGCGATAATCGCTGGAGG + Intronic
1189177735 X:38974777-38974799 GGCCCTGTGTTCAAGCCTGGGGG + Intergenic
1189255770 X:39637802-39637824 GTCCATTTGTTCATTCCTGGGGG + Intergenic
1193313108 X:80030778-80030800 GCCTATGTTATCTTCCCTGGGGG + Exonic
1195112925 X:101665529-101665551 GGCCATGTGATATACCTTGGAGG - Intergenic
1197274187 X:124459103-124459125 TGCCATGGGAGCATCCTTGGGGG + Intronic
1198131192 X:133696992-133697014 GTGCACGTGATCATCCCTGGAGG + Intronic