ID: 1005395702

View in Genome Browser
Species Human (GRCh38)
Location 6:25379613-25379635
Sequence TCTGATCACTAAAAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005395699_1005395702 -6 Left 1005395699 6:25379596-25379618 CCAGGGCTTTGCTTCTTTCTGAT 0: 1
1: 0
2: 1
3: 27
4: 389
Right 1005395702 6:25379613-25379635 TCTGATCACTAAAAGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005395702 Original CRISPR TCTGATCACTAAAAGGTGGA TGG Intronic
No off target data available for this crispr