ID: 1005395808

View in Genome Browser
Species Human (GRCh38)
Location 6:25380888-25380910
Sequence AAGTAGCAAGAAACCTGCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005395804_1005395808 22 Left 1005395804 6:25380843-25380865 CCAGATGTGGACTCATGCCTTGG 0: 1
1: 0
2: 0
3: 8
4: 135
Right 1005395808 6:25380888-25380910 AAGTAGCAAGAAACCTGCATTGG No data
1005395807_1005395808 -2 Left 1005395807 6:25380867-25380889 CCACATGAAATATTTGCTCTAAA 0: 1
1: 0
2: 0
3: 35
4: 337
Right 1005395808 6:25380888-25380910 AAGTAGCAAGAAACCTGCATTGG No data
1005395806_1005395808 5 Left 1005395806 6:25380860-25380882 CCTTGGACCACATGAAATATTTG 0: 1
1: 1
2: 0
3: 15
4: 186
Right 1005395808 6:25380888-25380910 AAGTAGCAAGAAACCTGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005395808 Original CRISPR AAGTAGCAAGAAACCTGCAT TGG Intronic
No off target data available for this crispr