ID: 1005397581

View in Genome Browser
Species Human (GRCh38)
Location 6:25399109-25399131
Sequence GTGGAGAGAAGGCCTCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005397576_1005397581 24 Left 1005397576 6:25399062-25399084 CCGCTCACAGATGGTTCAAAAAA 0: 1
1: 1
2: 1
3: 54
4: 923
Right 1005397581 6:25399109-25399131 GTGGAGAGAAGGCCTCTGGAAGG No data
1005397574_1005397581 26 Left 1005397574 6:25399060-25399082 CCCCGCTCACAGATGGTTCAAAA 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1005397581 6:25399109-25399131 GTGGAGAGAAGGCCTCTGGAAGG No data
1005397575_1005397581 25 Left 1005397575 6:25399061-25399083 CCCGCTCACAGATGGTTCAAAAA 0: 1
1: 0
2: 2
3: 15
4: 205
Right 1005397581 6:25399109-25399131 GTGGAGAGAAGGCCTCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005397581 Original CRISPR GTGGAGAGAAGGCCTCTGGA AGG Intronic
No off target data available for this crispr