ID: 1005398022

View in Genome Browser
Species Human (GRCh38)
Location 6:25404097-25404119
Sequence GAGTAATCTTAGAAGTGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 161}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005398022_1005398029 14 Left 1005398022 6:25404097-25404119 CCCCTCCACTTCTAAGATTACTC 0: 1
1: 0
2: 0
3: 12
4: 161
Right 1005398029 6:25404134-25404156 GCTTTCTGCCTGGCTCAACAAGG 0: 1
1: 0
2: 2
3: 17
4: 169
1005398022_1005398030 15 Left 1005398022 6:25404097-25404119 CCCCTCCACTTCTAAGATTACTC 0: 1
1: 0
2: 0
3: 12
4: 161
Right 1005398030 6:25404135-25404157 CTTTCTGCCTGGCTCAACAAGGG No data
1005398022_1005398028 4 Left 1005398022 6:25404097-25404119 CCCCTCCACTTCTAAGATTACTC 0: 1
1: 0
2: 0
3: 12
4: 161
Right 1005398028 6:25404124-25404146 TTTAGGCTCTGCTTTCTGCCTGG No data
1005398022_1005398031 16 Left 1005398022 6:25404097-25404119 CCCCTCCACTTCTAAGATTACTC 0: 1
1: 0
2: 0
3: 12
4: 161
Right 1005398031 6:25404136-25404158 TTTCTGCCTGGCTCAACAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005398022 Original CRISPR GAGTAATCTTAGAAGTGGAG GGG (reversed) Intronic
909755053 1:79215210-79215232 GCCTAATCTCAGAAGTGGGGAGG - Intergenic
910442291 1:87265366-87265388 GAGTAAGGTGGGAAGTGGAGAGG - Intergenic
910604063 1:89064159-89064181 GAGGAATAGTAGGAGTGGAGAGG + Intronic
910636018 1:89408756-89408778 GAGGAATAGTAGGAGTGGAGAGG - Intergenic
915224415 1:154402026-154402048 GATTATTCTGAGAAGTGCAGTGG - Intergenic
917736783 1:177928621-177928643 GAGTAGACTTAGAAGTTAAGAGG + Intronic
917810206 1:178651149-178651171 GAGTAATCAGAGAAGTAGAGAGG - Intergenic
921741684 1:218692516-218692538 GAGTAAACCAAGATGTGGAGAGG + Intergenic
923385358 1:233460584-233460606 GGGAAACCTGAGAAGTGGAGAGG + Intergenic
1064656008 10:17556877-17556899 TATAAATCTTAGAAGTGGAATGG - Intergenic
1068895175 10:62190960-62190982 TAGTAGTCATAGAAGTGGAAAGG - Intronic
1069116855 10:64517745-64517767 GAGCATTATTAAAAGTGGAGGGG - Intergenic
1069297275 10:66861882-66861904 GTTTAATATTAGAAGTGGTGTGG + Intronic
1069680527 10:70281968-70281990 AACTAATCTTAGCAGTGTAGAGG + Intronic
1072420696 10:95289151-95289173 TATAAATCTCAGAAGTGGAGAGG + Intronic
1075349057 10:121707875-121707897 GAGCAAAGTTTGAAGTGGAGGGG - Intergenic
1076404279 10:130201778-130201800 GAGAAATCTTAGGAGGTGAGGGG + Intergenic
1079395979 11:20063999-20064021 GAGGAATTTTAGAGTTGGAGGGG - Intronic
1083734049 11:64669593-64669615 AAGTAATCTTAGATGGGGCGGGG + Intronic
1085718271 11:78891695-78891717 GAGGAAACTGAGATGTGGAGAGG + Intronic
1088914633 11:114218063-114218085 GAATAATCTCAGAACTGGTGGGG + Intronic
1089953505 11:122550377-122550399 GAATAAGGTGAGAAGTGGAGGGG - Intergenic
1093915776 12:24801142-24801164 GAGAAAGCTTAGAATTGGAAGGG + Intergenic
1094096079 12:26706412-26706434 AAGTAATGTTAGAAGGTGAGAGG - Intronic
1094136821 12:27136547-27136569 GAGGAAACTTAGTAATGGAGAGG - Intergenic
1094825937 12:34269057-34269079 GAATAAGGTGAGAAGTGGAGGGG - Intergenic
1096342232 12:50810693-50810715 GATTAATGTTAGGAGTGGAGGGG - Intronic
1096798377 12:54092706-54092728 GAGCAATGCTAGAAGTTGAGAGG + Intergenic
1097081008 12:56430856-56430878 GAGTATTCTTACATCTGGAGTGG - Intronic
1097592494 12:61589916-61589938 GAATAAGGTGAGAAGTGGAGGGG - Intergenic
1098304314 12:69087232-69087254 GAGTCAGGTTAGAAGAGGAGAGG + Intergenic
1098920093 12:76294888-76294910 GAATAAGGTGAGAAGTGGAGGGG - Intergenic
1101096483 12:101347072-101347094 GAGTAATCTGAGAAGAAGTGAGG + Intronic
1102604678 12:114059271-114059293 GAATAACGTGAGAAGTGGAGGGG - Intergenic
1107326354 13:39247220-39247242 GAGTTATTTTATAAGTGGAATGG - Intergenic
1108589029 13:51895840-51895862 TTGGAATCTGAGAAGTGGAGAGG - Intergenic
1109343771 13:61091787-61091809 GAATAAGGTGAGAAGTGGAGGGG - Intergenic
1109579689 13:64312103-64312125 GAGAAATCTTAAAAATAGAGAGG - Intergenic
1109985429 13:69977533-69977555 CTGTAATCTTAAAAGTAGAGGGG + Intronic
1110106028 13:71677415-71677437 GTGTAACCTTAGAAGGGGTGTGG - Intronic
1111932440 13:94525654-94525676 CAGTAATCTTAGCTGTGCAGAGG - Intergenic
1113324522 13:109268770-109268792 GAATAAGGTGAGAAGTGGAGGGG - Intergenic
1116491232 14:45505907-45505929 GAGAAATCTTAAAATTGGAAAGG + Intergenic
1117218753 14:53579912-53579934 AAGCAATCTGAGAAATGGAGGGG + Intergenic
1118764089 14:68898669-68898691 CAGTCACCTTAGAAGTGGTGGGG + Intronic
1118937061 14:70298082-70298104 GAATAAGGTGAGAAGTGGAGGGG + Intergenic
1119681429 14:76595018-76595040 GAGTAATCTGAGAAGTGTCAGGG + Intergenic
1120649974 14:87120230-87120252 GAGTAGGCTCAGGAGTGGAGAGG + Intergenic
1121957445 14:98227157-98227179 GAGTAAACTGAGACTTGGAGAGG + Intergenic
1122491846 14:102122626-102122648 GAGTAATGGCAGGAGTGGAGTGG - Intronic
1123457120 15:20436325-20436347 GAGGAGTCTTAGAAGAAGAGTGG - Intergenic
1123660942 15:22564034-22564056 GAGGAGTCTTAGAAGAAGAGTGG + Intergenic
1124314743 15:28658268-28658290 GAGGAGTCTTAGAAGAAGAGTGG + Intergenic
1125387269 15:39151485-39151507 GAGGAATCTGAGGAGTAGAGAGG + Intergenic
1126534543 15:49747059-49747081 GAGGAAAGCTAGAAGTGGAGAGG + Intergenic
1127078286 15:55349566-55349588 GAATAATCTGAAAAGTGGTGTGG - Intronic
1127836598 15:62795545-62795567 CAGGAGTGTTAGAAGTGGAGAGG + Intronic
1128756862 15:70189220-70189242 GAGTAACCAGAGCAGTGGAGAGG + Intergenic
1136856984 16:33666547-33666569 GAGGACTCTAGGAAGTGGAGAGG + Intergenic
1140579631 16:76214374-76214396 CAGGAATCTGAAAAGTGGAGGGG - Intergenic
1142788165 17:2241758-2241780 TAAGAATTTTAGAAGTGGAGGGG + Intronic
1143766478 17:9141096-9141118 GAGCAATCTGAGATGTGGGGTGG + Intronic
1144530494 17:16034091-16034113 AAGTACTCTTAGAAGTGGCATGG + Intronic
1153726106 18:7956962-7956984 GAGTGAGCTTAGAAGTAGAAAGG - Intronic
1155271711 18:24148276-24148298 GAGTATTCGTAGATGTAGAGGGG - Intronic
1155779123 18:29808815-29808837 GAGCCATCTTAGAGGAGGAGAGG + Intergenic
1156265301 18:35482608-35482630 GAAAGACCTTAGAAGTGGAGAGG - Intronic
1156355549 18:36337378-36337400 GAATAATCCTGGAAGAGGAGTGG + Intronic
1156792862 18:40998744-40998766 GTGCAATCTTAGATGTGAAGAGG - Intergenic
1156916009 18:42464997-42465019 GAATAAGGTGAGAAGTGGAGGGG - Intergenic
1157392740 18:47316566-47316588 GAGTATCCAGAGAAGTGGAGTGG - Intergenic
1158742514 18:60159685-60159707 GAGTTAGCTGAGAGGTGGAGTGG + Intergenic
1163597647 19:18229677-18229699 GAGTAAACTGAGACGTGGAGAGG + Intronic
1167683360 19:50939956-50939978 GAGAAATCTTAGAGCTGGATTGG + Intergenic
926628090 2:15110803-15110825 GAGTAGACTTAAAAGTGGAATGG - Intergenic
926770404 2:16367769-16367791 GATAAATCTTAGAATTTGAGGGG - Intergenic
930196639 2:48517131-48517153 GAGTAGTAATAGAAGTGTAGGGG - Intergenic
930917139 2:56706667-56706689 AAGTAATAATAGAAGTGGAGAGG + Intergenic
938033152 2:128012803-128012825 GAGGAATCAGAGAAGTGAAGAGG - Intronic
939221100 2:139302293-139302315 AAGTGATTTTAGAAGAGGAGTGG - Intergenic
939737936 2:145872737-145872759 GTCTAATATTAGAAGTGGGGAGG + Intergenic
942112486 2:172695875-172695897 GAGTAAGCTTAGAAGAGGCTGGG + Intergenic
944251224 2:197581533-197581555 GAATAAGGTGAGAAGTGGAGGGG - Intronic
1168813463 20:721174-721196 GAGGAATCTGAGGTGTGGAGAGG + Intergenic
1177179795 21:17732849-17732871 CAGGCATCTTAGAAGTGGAAGGG - Intergenic
1177527266 21:22310653-22310675 GATGAATAATAGAAGTGGAGTGG - Intergenic
952797941 3:37259650-37259672 GAGTATTCTCATAATTGGAGTGG + Intronic
953020963 3:39112758-39112780 AAGAAATCTGAGAAGTAGAGTGG - Intronic
953795470 3:45982484-45982506 GAATTATCTTAGAAGTTAAGAGG - Intronic
954688435 3:52383100-52383122 GAGTAAACTGAGACATGGAGAGG + Intronic
955741209 3:62093468-62093490 TAGTAATCTCACAGGTGGAGGGG + Intronic
957553449 3:81735969-81735991 TAGTAGGCTTAGATGTGGAGTGG - Intronic
957904663 3:86540665-86540687 GAATAAGGTGAGAAGTGGAGGGG + Intergenic
959889535 3:111539068-111539090 GAGTTATCTTAGGGGTAGAGTGG - Intronic
960440704 3:117684032-117684054 GAGTTATCTTAGTGGTGGATAGG + Intergenic
963319929 3:143800714-143800736 GAATAAGGTGAGAAGTGGAGGGG - Intronic
965995370 3:174875216-174875238 CAGAAATCCTAGAATTGGAGAGG - Intronic
966260334 3:177970033-177970055 GACTAATATCAGAAGTGGAGAGG + Intergenic
966950621 3:184813202-184813224 CAAGAATCTAAGAAGTGGAGGGG - Intronic
968472379 4:788030-788052 GAGAAAACTTAGGAGGGGAGTGG + Intronic
971661119 4:29417458-29417480 GCTTCATCTTTGAAGTGGAGAGG + Intergenic
973605935 4:52587921-52587943 GAGAAATCTAAGAAGAAGAGAGG - Intergenic
973998889 4:56489966-56489988 TAGTACTGTTAGCAGTGGAGGGG + Intronic
977537404 4:98270820-98270842 GAGTAGGCTGAGAAGAGGAGGGG - Intronic
978220601 4:106269175-106269197 GTGTAATTTAAGAAATGGAGAGG + Intronic
978568406 4:110110078-110110100 GAGGACTCTTAAAAGAGGAGGGG - Intronic
981544495 4:145880293-145880315 GAGGAAACTGAGAAATGGAGAGG - Intronic
983774028 4:171584003-171584025 GTTTATTCTTAGAAGTGGAGAGG - Intergenic
985004618 4:185521691-185521713 AAGTAATCTTGAAAGTTGAGTGG - Intronic
986588371 5:9342990-9343012 GAGTAACTTTCAAAGTGGAGAGG - Intronic
987829066 5:23073010-23073032 GAGTTATAATAGAAGTAGAGAGG - Intergenic
989215996 5:38905201-38905223 TAATAATCTTAGGAGTGCAGTGG + Intronic
989519789 5:42388019-42388041 GACTGATCTTTGATGTGGAGAGG - Intergenic
994986541 5:106940857-106940879 GAGTAATGGTGGAATTGGAGAGG - Intergenic
995027922 5:107446084-107446106 GAGGAACCTGAGATGTGGAGAGG - Intronic
995115530 5:108473813-108473835 CAGTGATCTTTGTAGTGGAGGGG - Intergenic
997092679 5:130875835-130875857 TAGTAATATTGGAAGTGGTGTGG - Intergenic
1000388623 5:160700150-160700172 GAGGAATTTTAGAAGTTGTGGGG + Intronic
1001121782 5:168986748-168986770 GAGGAATCTAAGCAGTAGAGAGG - Intronic
1001303000 5:170551293-170551315 ACGTAATCTTAGAAGTGGTGAGG - Intronic
1001354111 5:171003674-171003696 GAATAAGGTGAGAAGTGGAGGGG + Intronic
1003053494 6:2799864-2799886 GAGTATTTTTAGAAGTGGCCAGG + Intergenic
1003493626 6:6644828-6644850 AAGGAATCTCAGAATTGGAGAGG + Intronic
1003814335 6:9821003-9821025 AAGTCATCTTAGAAGTGGTTGGG - Intronic
1004358570 6:14951202-14951224 GGGAAGTCTGAGAAGTGGAGAGG - Intergenic
1005398022 6:25404097-25404119 GAGTAATCTTAGAAGTGGAGGGG - Intronic
1008439671 6:51518688-51518710 GAGGAATGGTAGAAGTGGAGGGG + Intergenic
1011292417 6:85790569-85790591 GAACAATCTTAGAAGCAGAGAGG - Intergenic
1012275485 6:97269375-97269397 AAATATTCTTAGAAGTAGAGTGG - Intronic
1014069936 6:117169111-117169133 GAGTTATCTTTGAAATGGAGAGG + Intergenic
1015126055 6:129756186-129756208 GATTCATCTTAGTGGTGGAGAGG - Intergenic
1016464388 6:144311012-144311034 GGGCAATCTTAGAAGAGGAAAGG - Intronic
1017680943 6:156863088-156863110 AGGCATTCTTAGAAGTGGAGAGG - Intronic
1018345447 6:162894104-162894126 GAGTAGTCTGAGACCTGGAGTGG + Intronic
1019357684 7:589420-589442 GAGGAATCTTGGCAGTGGTGGGG - Intronic
1020794397 7:12662964-12662986 GAATAAGGTGAGAAGTGGAGGGG - Intergenic
1022248474 7:28584005-28584027 GACTAAACTAAAAAGTGGAGTGG - Intronic
1024907369 7:54401555-54401577 GAGAAAACTGAGAAGTGGAGAGG + Intergenic
1028097271 7:86776908-86776930 GAGAAATCACAGAAGTGAAGTGG - Intronic
1031328047 7:120426945-120426967 GAGTAATATTAGAAATGCAAAGG - Intronic
1032282321 7:130514286-130514308 GACTAATATTGGAAGAGGAGTGG + Intronic
1033773385 7:144579229-144579251 GAATAAACATAGAAGAGGAGAGG - Intronic
1035132745 7:156670601-156670623 GAGTCATCTTGGAAGTGGCCAGG + Intronic
1040783859 8:51141972-51141994 GTTTAATCTTGGAGGTGGAGGGG + Intergenic
1041003869 8:53480669-53480691 GTATGATCTTAGAAGTGGATAGG - Intergenic
1046144452 8:110140053-110140075 GAATACTCATGGAAGTGGAGAGG - Intergenic
1048203864 8:132400261-132400283 AGGTAATGTTAGAAGTGGATAGG - Intronic
1048347981 8:133592344-133592366 GAGAAAGATTTGAAGTGGAGAGG - Intergenic
1049868634 8:144956546-144956568 GAATAAGGTGAGAAGTGGAGGGG + Intergenic
1052037321 9:23697039-23697061 GAGCAATCATCGAAGGGGAGAGG + Intronic
1052692873 9:31837266-31837288 GAGTCCTGTTAGAAGTTGAGGGG - Intergenic
1053787984 9:41665820-41665842 GAGCAATGCTAGAAGTTGAGAGG + Intergenic
1054157148 9:61648948-61648970 GAGCAATGCTAGAAGTTGAGAGG - Intergenic
1054176260 9:61877162-61877184 GAGCAATGCTAGAAGTTGAGAGG + Intergenic
1054476923 9:65579953-65579975 GAGCAATGCTAGAAGTTGAGAGG - Intergenic
1054661279 9:67703646-67703668 GAGCAATGCTAGAAGTTGAGAGG - Intergenic
1058201732 9:102050787-102050809 GAAAATACTTAGAAGTGGAGTGG + Intergenic
1059614181 9:115930973-115930995 AAGTTATCTGAGAGGTGGAGAGG - Intergenic
1061729581 9:132603452-132603474 GAGTTAGATTAGAAGAGGAGAGG + Intronic
1189273442 X:39767902-39767924 GAGAAATCCTAGAAGTAGTGTGG + Intergenic
1189317415 X:40065857-40065879 GAGTAATATTTGAAGTGGGTTGG - Intronic
1189842312 X:45093447-45093469 GGGTAAGCTTAGAAGTAGGGAGG + Intronic
1189949178 X:46211097-46211119 GTATTATCTTATAAGTGGAGAGG + Intergenic
1191761473 X:64652327-64652349 GAATAAGGTGAGAAGTGGAGGGG - Intergenic
1192500875 X:71651133-71651155 GAGGAATCTAAGAGCTGGAGGGG - Intergenic
1192527256 X:71858239-71858261 GAGGAATCTAAGAGCTGGAGGGG - Intergenic
1193273978 X:79563915-79563937 GAAAAATCCTAGAAGTAGAGGGG + Intergenic
1196148058 X:112341775-112341797 GAGTAATCTTAAAACTGGAAGGG + Intergenic
1196189139 X:112776974-112776996 GAGGAATCTGAGAACTGGAGAGG - Exonic
1196673122 X:118390503-118390525 GAATAATAATAGAAGTGCAGAGG + Intronic
1197664824 X:129212296-129212318 GAGGAAACTGAGATGTGGAGAGG + Intergenic
1198671039 X:139081155-139081177 GAGTATTTTTAGTAGTGTAGTGG - Intronic
1198729100 X:139708063-139708085 GAGTAATATAAGAAATGGATTGG - Intronic
1201937313 Y:19422397-19422419 GAATAAGGTGAGAAGTGGAGGGG - Intergenic