ID: 1005407683

View in Genome Browser
Species Human (GRCh38)
Location 6:25507943-25507965
Sequence TGTATTGGTTTATGATAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 230}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005407683 Original CRISPR TGTATTGGTTTATGATAGAT TGG (reversed) Intronic
901269088 1:7936648-7936670 TGTATTGGTTTGTAACAGACTGG - Intronic
903637025 1:24827452-24827474 TGTGGTGGTTTAGCATAGATTGG + Intronic
906916558 1:50017415-50017437 TGGATAGGATTGTGATAGATAGG - Intronic
907261390 1:53221043-53221065 TGTATTGGTTTATCAGATTTGGG + Intergenic
909795030 1:79723335-79723357 TGTCTTGGTTTCAGGTAGATTGG - Intergenic
911443324 1:97958643-97958665 TGGATGGGTTTATGCTGGATTGG - Intergenic
916281074 1:163052225-163052247 TGTATTGTTTTAGCAGAGATTGG + Intergenic
916326367 1:163564395-163564417 TGTCCTGGTATAAGATAGATAGG + Intergenic
917784831 1:178443270-178443292 TATCTTGGTTTATGAAAGGTAGG - Intronic
919108216 1:193181576-193181598 AGTAGTGGTATATGAGAGATTGG + Exonic
924084304 1:240434290-240434312 TGTATTGGTATATGGTGGCTGGG + Intronic
1063436838 10:6039427-6039449 TGTCTTCCTTTATGATGGATAGG + Intronic
1066149787 10:32604110-32604132 TGCATTGATTTTTGAGAGATTGG + Intronic
1067516860 10:46955884-46955906 TGTAATGTTTTATCCTAGATGGG + Intronic
1067645391 10:48095942-48095964 TGTAATGTTTTATCCTAGATGGG - Intergenic
1067822909 10:49546343-49546365 AGGATTGGTTTAAGTTAGATAGG - Intergenic
1067982697 10:51104900-51104922 TGTATTGTTTTAGTAGAGATGGG + Intronic
1068040018 10:51812033-51812055 TTTATAGGTATATGATAGGTTGG + Intronic
1068277072 10:54813571-54813593 TGTATTGGTATGTGTTTGATTGG - Intronic
1068700909 10:60018673-60018695 TGTATTTTTTTAGGAGAGATGGG - Intergenic
1068795381 10:61073620-61073642 TGTTTTGGTTAATGACAGACAGG - Intergenic
1071025501 10:81108168-81108190 TGTATTTTTTTATTAGAGATGGG - Intergenic
1072769133 10:98123013-98123035 TTTATTTGTCTTTGATAGATTGG + Intergenic
1073979098 10:109133661-109133683 TGTATCTGTTTATGTGAGATGGG - Intergenic
1074604504 10:114947330-114947352 TGTATTGTTTTAAGACAGATTGG + Intronic
1074945918 10:118280531-118280553 TGTTTTGGATAATGATAAATGGG - Intergenic
1077823855 11:5782587-5782609 TGGTTTGGTTTAAGAGAGATGGG - Intronic
1079064999 11:17282430-17282452 TGTATTTGTTTAGTAGAGATGGG + Intronic
1081411092 11:42759318-42759340 TGTATTTTTTTAGGAGAGATGGG - Intergenic
1081512580 11:43790818-43790840 TGTATTTTTTTATTAGAGATGGG - Intronic
1085191077 11:74623258-74623280 TGTATTTTTTTAGGAGAGATGGG - Intronic
1085224741 11:74909369-74909391 TGTGTTGATTTATAATTGATTGG + Intronic
1086211992 11:84331870-84331892 TGAATTGGTTTCTGAAAAATTGG + Intronic
1086593752 11:88546265-88546287 TGTATTTGTTTATGTTTTATTGG + Intronic
1086908787 11:92448389-92448411 TGTATGGCATTATGATTGATAGG + Intronic
1087903576 11:103670094-103670116 TGTATTGGTCCATGAAAGAGAGG - Intergenic
1096364715 12:51018755-51018777 TTTATTTGTTTATGACAGACAGG - Intronic
1097422688 12:59399933-59399955 TTTATTTGTTTATTATAAATTGG + Intergenic
1099163230 12:79271945-79271967 TTGAGTGGTTTATGTTAGATGGG - Intronic
1099521182 12:83665008-83665030 TTTTTTTGTTTATGTTAGATAGG - Intergenic
1103163105 12:118747187-118747209 TTTATTTGTCTATGCTAGATGGG + Intergenic
1103213967 12:119187527-119187549 TGTATTTGTTTAGTAGAGATGGG + Intronic
1103883686 12:124185644-124185666 TGTATTTTTTTAGGAGAGATGGG - Intronic
1106173345 13:27307936-27307958 TGTAAAGGTTAATGAAAGATAGG - Intergenic
1106633070 13:31497302-31497324 TGTCTTGGTTTATGATTATTTGG - Intergenic
1106697582 13:32193237-32193259 TGTATTTCTTTTTGAAAGATAGG + Intronic
1107240533 13:38228837-38228859 TGTATTCTTTTATAATATATGGG + Intergenic
1107646270 13:42497057-42497079 TGTATTGTTTTAGTAGAGATGGG - Intergenic
1108877467 13:55063885-55063907 TGTATAGGTTCATAATACATTGG + Intergenic
1108964106 13:56274766-56274788 TGTATTGTTTTAGTAGAGATGGG + Intergenic
1109705643 13:66088310-66088332 TGTGTAGGTTTATGACAGAAGGG - Intergenic
1110356609 13:74574855-74574877 TGTACTGGATAATGATAAATGGG - Intergenic
1110504086 13:76264324-76264346 TGTATGTGGTTATTATAGATGGG - Intergenic
1110980062 13:81885921-81885943 TTTATTGGTTTAGGAGAGAGTGG + Intergenic
1111007978 13:82275033-82275055 TGAATTGGTCAATTATAGATTGG + Intergenic
1112379845 13:98878442-98878464 TGGATTGGATGAAGATAGATTGG - Intronic
1114365618 14:22024601-22024623 TGTAGTGGTCCATGATAAATTGG + Intergenic
1115487555 14:33926721-33926743 TATGATGGTTTATGATAGATGGG - Intronic
1117603036 14:57394597-57394619 CGTAATGGTGTATGATATATTGG + Intronic
1118035368 14:61860606-61860628 AGTATTGGTCTATAATAGATTGG + Intergenic
1119667033 14:76492167-76492189 TTTATTTGTTTATTATAGACGGG + Intronic
1120140063 14:80920255-80920277 GGTGTTGGCTGATGATAGATCGG - Intronic
1122563769 14:102636450-102636472 TGTATTTGTTTACTAGAGATAGG + Intronic
1125099537 15:35895213-35895235 GGGTTTGGTTTATGAGAGATAGG - Intergenic
1125656522 15:41362176-41362198 TGTATTTGTTTATTTGAGATGGG - Intronic
1128850616 15:70951891-70951913 TCTATAGGTTTATGTTATATGGG + Intronic
1131485309 15:92815274-92815296 TGTATAGTTTTAGTATAGATGGG - Intergenic
1132034971 15:98474829-98474851 TGTATTGATGTTTGAGAGATGGG - Intronic
1135105789 16:19648136-19648158 TGTGTTGTTTTTTGAGAGATGGG + Intronic
1138899949 16:61256709-61256731 TATAATAGTTTAGGATAGATGGG + Intergenic
1139740563 16:69031832-69031854 TGTATTGTTTTAGTAGAGATGGG + Intronic
1140080517 16:71742796-71742818 TGTATTTTTTTATTAGAGATGGG - Intronic
1143552132 17:7636748-7636770 TGTATTGGCTGCTGATACATTGG + Intergenic
1143855647 17:9846442-9846464 TGTATTGATTTTTTAGAGATGGG - Intronic
1144073815 17:11699442-11699464 TGGATTGGTCTACTATAGATAGG - Intronic
1146020749 17:29276506-29276528 TATATTGTTTTAGGAGAGATGGG + Intronic
1150898905 17:69248181-69248203 TGTTTTGGTTTATATTAGAGAGG - Intronic
1150994616 17:70302910-70302932 TTTTTTGTTTTATGATAAATGGG - Intergenic
1152149842 17:78592100-78592122 TGACTTGGTTTATAATATATTGG + Intergenic
1156295615 18:35787236-35787258 AGTATTAGTCTATGATAAATTGG - Intergenic
1157117406 18:44875002-44875024 TGTATTGGTTTGCTACAGATGGG + Intronic
1159060853 18:63512381-63512403 AGTATTGGTCTATGATGAATTGG - Intergenic
1159404243 18:67978800-67978822 TGTATTTAGTTATGATACATGGG + Intergenic
1159612782 18:70545281-70545303 TGTATTTGTTTTTGTCAGATTGG + Intergenic
1160421773 18:78752943-78752965 TGTATTGGTTTCTGACAGCTTGG + Intergenic
1163670548 19:18625553-18625575 TGTATTGTTTTATTAGAGATGGG + Intergenic
1164079227 19:21848315-21848337 TGTATTGTTTTAGTAGAGATGGG + Intronic
1164297877 19:23931143-23931165 TGTATTGTTTTAGTAGAGATGGG + Intronic
1165086244 19:33349777-33349799 TGTTTTGGTTTAGGATCAATAGG + Intergenic
1165337843 19:35184952-35184974 TGTATTGCTGGATCATAGATAGG - Intergenic
1165451399 19:35885822-35885844 TGTATTTGTTTAGTAGAGATTGG - Intergenic
1165529895 19:36389890-36389912 TGAATTGGTGTATGAGAGTTTGG - Intronic
1165639451 19:37371516-37371538 TGTATGTGTTTATGAGAGACTGG + Intronic
1167805696 19:51782744-51782766 TTTATTGGTTTATGAGACTTTGG - Intronic
925584893 2:5455247-5455269 TCTATTGCTTTATGAAAGTTAGG - Intergenic
925835773 2:7945316-7945338 TGTATTTTTTTATGAGACATAGG + Intergenic
928015244 2:27650027-27650049 TGTACTGTTTTCTGATGGATGGG + Intronic
928288193 2:30011827-30011849 TGTATTGATTTATAATTCATAGG - Intergenic
928293362 2:30059740-30059762 TGTAGTGGTTTTTAATACATTGG + Intergenic
929294539 2:40232349-40232371 TGTATTATTTTAAGAGAGATGGG + Intronic
929325397 2:40604545-40604567 TGGGTTGGTTAAAGATAGATGGG - Intronic
931014286 2:57958106-57958128 TTTATTGATTTATAATACATGGG - Intronic
931509076 2:62969610-62969632 TGGATTTGTTTAAGATACATAGG - Intronic
931926690 2:67081122-67081144 TGTATTGGTTTGTTTTAGTTTGG - Intergenic
935067877 2:99667100-99667122 TGTATTGGTATATGTTTTATAGG - Intronic
935375539 2:102392641-102392663 AGTATTGGTTTCTGAAGGATTGG + Intronic
935487433 2:103674969-103674991 TGGAAAGGTTTATGAGAGATAGG + Intergenic
935756239 2:106278090-106278112 TGTATTTGTATTTGCTAGATGGG - Intergenic
936383848 2:112011575-112011597 TGTATTTTTTCATGAGAGATGGG - Intronic
939075147 2:137591636-137591658 TCGATTGGTTTATGACAAATAGG - Intronic
942886837 2:180935828-180935850 TGTATAGGTTTCTGAAAGCTTGG - Intergenic
943288513 2:186037448-186037470 TTTATTGCTTTTAGATAGATAGG - Intergenic
943758304 2:191582064-191582086 TGTATTTGTTTAGTAGAGATGGG + Intergenic
944363095 2:198882147-198882169 AGTATTGGTTTATTTTACATAGG - Intergenic
944739610 2:202598975-202598997 TGTATTTGTTTGTTAGAGATGGG - Intergenic
944829432 2:203518342-203518364 TGTATTGTTTTAGTAGAGATGGG - Intronic
945808642 2:214521048-214521070 TGTATTTGTTTAGTAGAGATGGG - Intronic
946845773 2:223857650-223857672 TTTATTTATTTATAATAGATGGG - Intronic
947762685 2:232614993-232615015 TGTATTTATTTATTAAAGATGGG + Intronic
1170696130 20:18660732-18660754 TGAATTTGTTTATGGTATATAGG - Intronic
1171079720 20:22166476-22166498 TTCATTGTTTTATGACAGATGGG + Intergenic
1173254710 20:41386155-41386177 TGTATTGTTTTATAAGAGTTGGG + Intergenic
1173694690 20:44998897-44998919 TGTATTGTTTTAGTAGAGATGGG - Intronic
1173886705 20:46465524-46465546 TGTTTTGGTTTTTTAGAGATGGG - Intergenic
1173981130 20:47224918-47224940 TGTATAGGTATTTGATTGATAGG - Intronic
1174919888 20:54690595-54690617 TGGAAGGGATTATGATAGATGGG - Intergenic
1175526683 20:59639110-59639132 TGTATGGGTTGATGATGGCTAGG + Intronic
1175838296 20:62010517-62010539 TGTTTTGATTTCTGAGAGATGGG - Intronic
1177900684 21:26911440-26911462 TGTTTTTGTTTATGTTACATTGG + Intergenic
1178888968 21:36505293-36505315 AGTATTGGTCCATAATAGATTGG + Intronic
1180254352 21:46613806-46613828 TGTATTTGTTTAATAGAGATGGG + Intergenic
1181096867 22:20511316-20511338 TGTATTTGTTTATGTTACCTAGG - Intronic
1182784090 22:32892119-32892141 TGTATTATTTTATTAGAGATGGG - Intronic
1184622857 22:45695666-45695688 TGTATTTTTTTATTAGAGATGGG + Intronic
949199144 3:1351625-1351647 TGGATTATTTTATGAAAGATGGG + Intronic
951354957 3:21654627-21654649 AGTATTGGTCTATGACTGATGGG - Intronic
953478682 3:43229629-43229651 TGTATTGGTTTATACTACAAGGG + Intergenic
955290487 3:57688165-57688187 TGTATTTTTTTATTAGAGATGGG + Intronic
957522848 3:81342756-81342778 TGTATTGGTTTGGGATATTTTGG - Intergenic
959858138 3:111185445-111185467 TTTATTAGTTTATGATAGGAAGG + Intronic
960377259 3:116918473-116918495 TGACTTAGTTTATGATAAATTGG - Intronic
960709101 3:120509296-120509318 AGGATTGTTTTATGTTAGATAGG + Intergenic
961126488 3:124423128-124423150 TGTATTAGTTTCTGAAAGCTTGG + Intronic
962946629 3:140176870-140176892 AAGATTGTTTTATGATAGATGGG + Intronic
963946984 3:151156417-151156439 TGTATTGGTTCATGTAAAATAGG - Intronic
964603242 3:158527529-158527551 TGTATTGGTTTATTAGAGGATGG - Intronic
966663401 3:182442055-182442077 TGTCTTGTTTTGTTATAGATTGG + Intergenic
968594717 4:1476447-1476469 TGTATGGGTGAATGATAAATGGG + Intergenic
969910669 4:10442384-10442406 TACATTGGTTTATGACATATGGG - Exonic
971211070 4:24616797-24616819 TGTATTGGTTTTTTAGAAATTGG - Intergenic
971769416 4:30877399-30877421 TGTATTGATTAGTGAGAGATGGG + Intronic
971874975 4:32296885-32296907 TGTATTTTTTTAGGAAAGATGGG - Intergenic
972920095 4:43928234-43928256 TATTTTGGTTTATGATATAAAGG - Intergenic
978619627 4:110625632-110625654 TCTGTGGGTTTATGAGAGATGGG - Intronic
981108602 4:140909836-140909858 TTTATTAGTTTTTGATAAATAGG - Intronic
981944225 4:150322287-150322309 TGTCTTGGATTATGACATATGGG - Intronic
982047471 4:151463182-151463204 TGTTTTGGTTTAGAAGAGATGGG + Intronic
983816454 4:172134208-172134230 TGTATTGTTTTAGTAGAGATGGG - Intronic
986389933 5:7275822-7275844 TGTTTTGTTTTATATTAGATTGG + Intergenic
986891551 5:12314526-12314548 TGTATTGAGTTATGATGAATAGG + Intergenic
988442476 5:31248590-31248612 TGTATAGGTAGATGATAAATTGG + Intronic
989219027 5:38934486-38934508 TATATTGGTTTGGGATATATTGG - Exonic
989808416 5:45641189-45641211 TGTATTGTATAATTATAGATAGG + Intronic
990560188 5:56976005-56976027 TGCATTGGTTTATCATACAATGG + Intergenic
992020642 5:72620240-72620262 TGTATTGGCTTATTCTTGATTGG - Intergenic
992191605 5:74297296-74297318 TGTTTTGTTTTAAGAGAGATAGG - Intergenic
993016981 5:82545257-82545279 TGTATTTTTTTAGGAGAGATGGG - Intergenic
993604843 5:89976500-89976522 AGTATTGGATAATGTTAGATGGG - Intergenic
993983599 5:94570682-94570704 TGTATTGGTTTATACTACAGGGG - Intronic
994122408 5:96131021-96131043 TTTATTGCTGTAGGATAGATTGG - Intergenic
998881780 5:146652556-146652578 TGTATTGGAATGTGAAAGATGGG + Intronic
1000414289 5:160967197-160967219 TGTATAGGATTTTGAAAGATAGG - Intergenic
1002406739 5:179039922-179039944 TGTATTTTTTTAGTATAGATGGG - Intergenic
1003549571 6:7091012-7091034 TGTATTTTTTTTTAATAGATAGG - Intergenic
1004945824 6:20611452-20611474 ATTATTGGTATATGATAGATGGG + Intronic
1005000660 6:21237360-21237382 TCTATTGGTTTGTGATTAATTGG - Intergenic
1005407683 6:25507943-25507965 TGTATTGGTTTATGATAGATTGG - Intronic
1005411685 6:25555219-25555241 TGTATTGGTTTGTGCTAAATTGG + Intronic
1005947852 6:30607883-30607905 TGTGTTGTTCTATGAGAGATGGG + Exonic
1006218956 6:32471625-32471647 TGTATTTGATTAAGATAGAGAGG - Intergenic
1008074224 6:47129010-47129032 TGTATTGTTTTAGTATAGACAGG - Intergenic
1008856505 6:56094712-56094734 AGTATTGGTTTATGCAAGAGTGG + Intronic
1011363909 6:86559147-86559169 TCTATAGGTTGATGATACATTGG + Intergenic
1012073447 6:94653497-94653519 TGTGGTGGTTTATGATTGATTGG - Intergenic
1012273077 6:97239010-97239032 TGTGATGGTTTCTGATAGGTAGG - Intronic
1013339073 6:109195329-109195351 TCTAGTTGTTTATGATAGAAGGG + Intergenic
1014118273 6:117690816-117690838 TGTATTTTTTTAGGAGAGATGGG - Intronic
1014315393 6:119857994-119858016 TCTAGTGGTTTATAATAGGTGGG + Intergenic
1015724385 6:136285741-136285763 TGTATTATTTCATGAAAGATAGG - Intronic
1016136340 6:140548414-140548436 TATATTGGATTAGGATAGAAGGG + Intergenic
1017363029 6:153598854-153598876 TGTAGTAGTTTTTGAGAGATGGG - Intergenic
1021493565 7:21247210-21247232 AGAATTGGTGTATGACAGATTGG + Intergenic
1023048054 7:36228677-36228699 TGGATAGGATTGTGATAGATAGG + Intronic
1023479161 7:40614317-40614339 TGTACTGCTTTATGTTAGTTTGG + Intronic
1023639695 7:42245092-42245114 TGTACTGGTTTATGCTGGACTGG + Intergenic
1023743268 7:43300148-43300170 TGTAGTGATTTAGGATAGAATGG - Intronic
1024781216 7:52851782-52851804 GGTGTTGGTTGATGATATATAGG - Intergenic
1025012880 7:55412846-55412868 TCTCTTTGTTTAGGATAGATAGG + Intronic
1027009038 7:74725853-74725875 TTTTTTGGTTTATGATCGATTGG + Intronic
1031384869 7:121137175-121137197 TTTATTTATTTATTATAGATAGG + Intronic
1031386159 7:121153697-121153719 TGTTTTGGTATGTGATAGAGTGG - Intronic
1033820233 7:145126167-145126189 TGTATTGGTTGATATTATATTGG - Intergenic
1035213191 7:157344165-157344187 TGTATTGTTTTAGTAGAGATGGG - Intronic
1035820126 8:2582130-2582152 TGTGTTGTTTTATGCTAGATAGG + Intergenic
1035961228 8:4140323-4140345 TGTATTGTTTTAGTAGAGATGGG - Intronic
1036941181 8:13054142-13054164 TGTATTGTTTTAGTAGAGATGGG + Intergenic
1037576844 8:20213862-20213884 AGTATTGGTCTGTGATGGATGGG - Intronic
1038687946 8:29735534-29735556 TGTATTGTTTTAGTAGAGATGGG - Intergenic
1039525324 8:38209339-38209361 TGTACTGGTTTGTGTTAAATGGG + Intronic
1042188840 8:66165075-66165097 TGTATTGGTTTCTGAAAGACTGG - Intronic
1043483319 8:80674574-80674596 TGGATTGGTTTTTGAGAGAATGG - Intronic
1044771208 8:95636562-95636584 GCTATGGGTTTATCATAGATGGG - Intergenic
1046423112 8:114010489-114010511 TGTTTTGGTTTGTGGTACATAGG - Intergenic
1046641837 8:116739923-116739945 AGTGTTGGTCTGTGATAGATTGG - Intronic
1046776089 8:118165282-118165304 TGTATTCTTTTATAATAAATGGG - Intergenic
1048367957 8:133754873-133754895 TGGATAGGATTGTGATAGATAGG - Intergenic
1049135797 8:140898091-140898113 AGTATTGGTCTGTGATAGGTTGG - Intronic
1050386410 9:5095685-5095707 TGGATAGGATTGTGATAGATAGG - Intronic
1051631939 9:19148547-19148569 TGTATTTGTTTAGTAGAGATGGG - Intronic
1052520535 9:29542676-29542698 TATATAGGTAGATGATAGATAGG - Intergenic
1055145550 9:72930138-72930160 GGTATTTGTTTATGTTAAATTGG + Intronic
1055683362 9:78742265-78742287 TGGATAGGATTGTGATAGATAGG + Intergenic
1055782058 9:79830814-79830836 TGTATTTTTTTAATATAGATGGG + Intergenic
1058201036 9:102040787-102040809 TGTATTGTTTTAATAGAGATGGG + Intergenic
1058306983 9:103455917-103455939 TGTATTGGTTACTCATTGATAGG - Intergenic
1058950025 9:109894663-109894685 AGTATTGGTCTGTGATGGATTGG + Intronic
1061398836 9:130357503-130357525 TGGATTGGTAGATGATGGATGGG + Intronic
1188481667 X:30642402-30642424 TGGATTGTCTTGTGATAGATGGG + Intergenic
1189179162 X:38987206-38987228 TGTCATGGTTTATGGTAGAGTGG + Intergenic
1190785443 X:53643521-53643543 TGTATTGTTTTAGTAGAGATGGG + Intronic
1191032852 X:55993655-55993677 TGGAATAGTTTCTGATAGATTGG + Intergenic
1191639363 X:63413684-63413706 TGTATAGTTTTTTGAGAGATAGG - Intergenic
1192690619 X:73359165-73359187 TGTATAGGTTTCTTATATATAGG + Intergenic
1194568005 X:95518111-95518133 TGTAGTGGTATATAATAGAGTGG + Intergenic
1194609815 X:96028937-96028959 TATGTAGGTTTATGATAGTTCGG + Intergenic
1195621686 X:106962556-106962578 TTGATTGATTTATAATAGATAGG - Intronic
1198531640 X:137554136-137554158 TGTATTGTTTTAGTAGAGATGGG + Intergenic
1198889828 X:141381273-141381295 TGTATTTGTTTATCAGATATAGG - Intergenic
1198974101 X:142315812-142315834 TATTTTGGTTTATGATATATTGG - Intergenic
1199096463 X:143746986-143747008 TTTGATGGTTTATGGTAGATTGG - Intergenic
1200810691 Y:7481612-7481634 TTTTTTGGTTGATGATAGCTGGG - Intergenic
1200895568 Y:8372686-8372708 TGGATAGGTTCTTGATAGATAGG - Intergenic
1202036207 Y:20639203-20639225 TGTATTTTTTTAGGAGAGATGGG + Intergenic