ID: 1005410452

View in Genome Browser
Species Human (GRCh38)
Location 6:25539677-25539699
Sequence TTAAGCAGCTTTGAAACCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 179}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005410452 Original CRISPR TTAAGCAGCTTTGAAACCAC AGG (reversed) Intronic
906087691 1:43149874-43149896 ACAAGCAGCTTGGAGACCACTGG + Intronic
906842273 1:49152383-49152405 TTATTCATCTCTGAAACCACAGG - Intronic
912170145 1:107090165-107090187 ATAAGCATATTTGAAACTACTGG - Intergenic
912882542 1:113431033-113431055 CTAGCGAGCTTTGAAACCACTGG + Intronic
913149146 1:116023016-116023038 ATAAGCATATTTGAAGCCACAGG - Intronic
913792849 1:122559975-122559997 TTCAGCAGCTTTGAAGTCAAAGG + Intergenic
913795731 1:122610984-122611006 TTCAGCCGCTTTGAAGCCAATGG + Intergenic
913801384 1:122712968-122712990 TTCAGCAGCTTTGAAGTCAAAGG + Intergenic
913816013 1:122975774-122975796 TTCAGCCGCTTTGAAATCAAAGG + Intergenic
913829112 1:123210141-123210163 TTCAGCAGCTTTGAAGTCAAAGG + Intergenic
913829717 1:123221322-123221344 TTCAGCCGCTTTGAAGTCACAGG + Intergenic
913840614 1:123416052-123416074 TTCAGCCGCTTTGAAGTCACAGG + Intergenic
913855095 1:123676584-123676606 TTCAGCAGCTTTGAAGTCAAAGG + Intergenic
913865046 1:123855195-123855217 TTCAGCCGCTTTGAAATCAAAGG + Intergenic
913882358 1:124165264-124165286 TTCAGCAGCTTTGAAGTCAAAGG + Intergenic
916056158 1:161069957-161069979 TAGAGCATCTTTGCAACCACAGG + Intronic
917049857 1:170909248-170909270 TTAAGGATCTTTTAAACTACAGG - Intergenic
918052018 1:180981863-180981885 TTAAGCAGCATTGCAAGCTCAGG + Intronic
922972598 1:229755502-229755524 TTTAGCAGCTGTGTAACCCCGGG + Intergenic
923348204 1:233078339-233078361 TTAGGCAGATTTGAAACATCTGG - Intronic
924461183 1:244259833-244259855 CAAAGCAGCTGTGAAATCACCGG + Intergenic
1063258294 10:4353499-4353521 TTAAGCATCTCTCCAACCACTGG + Intergenic
1063670005 10:8092554-8092576 TTATGCATCTTTCATACCACAGG - Intergenic
1064328956 10:14376129-14376151 TGAACCAGCTCTGAACCCACTGG + Intronic
1064346579 10:14537974-14537996 TTAAGCAGCTTGGTAACCTTGGG - Intronic
1066273413 10:33845307-33845329 GGAAGCAACTTTGAAACTACTGG - Intergenic
1067540927 10:47152253-47152275 TTCAGAAGCTTTTAACCCACCGG - Intergenic
1068577654 10:58702380-58702402 ATAAGCATCCTTGAAATCACAGG - Intronic
1069926482 10:71854237-71854259 TGAAGCAGCTTTGAAACAGGAGG + Intergenic
1072181143 10:92981752-92981774 TTAAGCATATTTGAAAGCAAAGG - Intronic
1075504692 10:123011491-123011513 TTAAAATGCTTTGGAACCACAGG - Intronic
1075712035 10:124536014-124536036 TTCTGCTGCTTTAAAACCACTGG + Intronic
1080066484 11:28021451-28021473 TTGAACAGCTTTTAAACCAAAGG - Intronic
1080086026 11:28283334-28283356 TCAAGCACCTTAGAAACCATGGG + Intronic
1081346747 11:41996686-41996708 TTAAGCAGCTTTTTAACTACTGG + Intergenic
1081353396 11:42083500-42083522 TTAAGCAGCTTTTAACCTAGGGG + Intergenic
1087914640 11:103795871-103795893 TTAAACAGCATGGAAACCAGAGG - Intergenic
1089437177 11:118479376-118479398 TTAAGCATCTTGTAAACTACTGG + Intronic
1090313823 11:125767347-125767369 ATTAGCTGCTTTGAACCCACAGG - Intergenic
1094407177 12:30128778-30128800 TTTAACAGCTTTGATACCACAGG + Intergenic
1094975634 12:36323884-36323906 TTAAATCGCTTTGAAACCAAAGG + Intergenic
1095179365 12:39129513-39129535 TTAGCCAGATTTGCAACCACTGG - Intergenic
1098123463 12:67266788-67266810 TGAAGCAGCTTGGAAACCACCGG + Intergenic
1098232386 12:68385479-68385501 TTAAACTGCTTTGAACCCTCAGG - Intergenic
1098276977 12:68822484-68822506 TTAAAGAGCTTTAAAACAACAGG - Intronic
1099365326 12:81759752-81759774 TTAAGCAGCTTTCTTCCCACTGG + Intergenic
1099874298 12:88385479-88385501 TTAAGCAGTTTTGGACCCAAGGG + Intergenic
1100121133 12:91370577-91370599 TTGCGGAGGTTTGAAACCACTGG - Intergenic
1102552054 12:113698474-113698496 TCCAGAAGCTTTGAAACCAGGGG + Intergenic
1106016160 13:25870925-25870947 TAAAGCAGGTTTCAAACAACAGG + Intronic
1107319312 13:39168533-39168555 CTCAGCAACTTTGAAACCCCAGG - Intergenic
1107597393 13:41977068-41977090 TTAACCAAATTAGAAACCACAGG + Intergenic
1108697231 13:52913203-52913225 TAAAACAGCTTTCAAAGCACCGG - Intergenic
1109167198 13:59051065-59051087 TTAAGAAGCTTTGAAATGACTGG + Intergenic
1110422156 13:75324032-75324054 TCAAAAAGCTTTGAAACTACTGG + Intronic
1110620825 13:77593612-77593634 TTAAGCATTTTTGAAACACCAGG - Intronic
1111176146 13:84598967-84598989 TTAAGTACATTTGAAATCACTGG - Intergenic
1111879061 13:93932296-93932318 TTAAGCAGCTGTGTTACCATCGG - Intronic
1114852225 14:26394961-26394983 TTAACCAGAGTTGAAAACACAGG - Intergenic
1115371903 14:32625819-32625841 TTAAGCACCCTTTAAACCAAAGG + Intronic
1118252214 14:64172502-64172524 ATAAGAATCTTTGAAACCATTGG - Intronic
1126548703 15:49903365-49903387 TTACGCAGCTTGGAAAAAACAGG - Intronic
1129801195 15:78415838-78415860 TTCAGCAGCGCTGAAAACACTGG - Intergenic
1133334082 16:4995399-4995421 TTTAGCAGCCTGGGAACCACAGG - Intronic
1135825370 16:25722638-25722660 TTATACAGCCTTGAAAACACAGG + Intronic
1139235870 16:65338361-65338383 TTAAGCTGCTTTAAAAATACAGG + Intergenic
1139844604 16:69911308-69911330 TTAAGCAGTGTTCAGACCACAGG + Intronic
1143161272 17:4873019-4873041 TTCAGCAGCTCGGAAACCACTGG - Intronic
1144175810 17:12706276-12706298 TTAAACAGCCTTGAAATCACAGG - Intronic
1146470209 17:33118244-33118266 TCAAGTAGCTCTGAAATCACAGG + Intronic
1153117069 18:1671394-1671416 TATAGCAGCTTTGAAAATACAGG - Intergenic
1153358993 18:4172541-4172563 TTGATCAGCTTTGAAATAACTGG - Intronic
1153412291 18:4807405-4807427 TTGAGCAGCATTCAAATCACAGG + Intergenic
1155081311 18:22412722-22412744 TTAAGCAGCTGAGCAGCCACAGG - Intergenic
1155987916 18:32250134-32250156 TTCTGCAGCTTAGAAAACACAGG - Intronic
1158043633 18:53128543-53128565 TTATGGTGCTTTGAAAACACTGG - Intronic
1158166971 18:54551115-54551137 TTAAGAAGATTTTAAACTACTGG + Intergenic
1161613896 19:5259181-5259203 TCAAGCATATTTAAAACCACAGG + Intronic
1163423620 19:17228740-17228762 TTAAGCAGCTTGAAGGCCACAGG + Intronic
925961387 2:9020338-9020360 TTTAGCCTCCTTGAAACCACAGG + Intergenic
927630951 2:24773643-24773665 TAAAACAGCTTTGAAAAGACAGG + Intergenic
928255643 2:29719980-29720002 TTAAGTAGCTTTGAAGTGACAGG + Intronic
932114479 2:69033909-69033931 TTAAGCTCCTTAGAAAACACAGG - Intronic
935299306 2:101680021-101680043 TGATGCAGCTTTACAACCACTGG - Intergenic
939157332 2:138541063-138541085 TGAAGCAGCTTTGCAACCCAGGG + Intronic
941197039 2:162465820-162465842 TTAAGCAGCTATGGATCCAAAGG + Intronic
942663088 2:178287250-178287272 TTAAGCAGATTTCAGGCCACAGG + Intronic
942979022 2:182056306-182056328 ATAAGCAGGTTGGAAACCATGGG - Intronic
944410102 2:199432074-199432096 TCAGGCTGCTTTGAAAGCACTGG + Intronic
944499256 2:200341583-200341605 TAAGGCTGTTTTGAAACCACAGG + Intronic
945964287 2:216169544-216169566 TTAAGCAGCTAAAAAAGCACTGG - Intronic
946526542 2:220526668-220526690 TTCATCAGCTATGGAACCACTGG + Intergenic
1169835635 20:9874605-9874627 CAAAGCACCTTTGAAACTACTGG + Intergenic
1174086953 20:48016155-48016177 TTAAGCAACATTCCAACCACAGG - Intergenic
1175099192 20:56566196-56566218 CTAAGCAGCTTTGGAAGCATTGG - Intergenic
1175417346 20:58810683-58810705 TTCACCGGTTTTGAAACCACAGG - Intergenic
1179969554 21:44826887-44826909 AAAAGTAGCTTTCAAACCACTGG + Intergenic
949157215 3:843473-843495 ATAACCAGTTTTGAAACAACTGG - Intergenic
949421725 3:3873051-3873073 TTTAGCAGCATGGAAACCATTGG - Intronic
951107597 3:18763076-18763098 TTAAGCTTCTTTGAAATCATAGG + Intergenic
954666331 3:52254890-52254912 GGAGGCAGCTTTGCAACCACAGG + Exonic
958008199 3:87840739-87840761 TTATTCAGCTTTAAAAACACAGG + Intergenic
959156805 3:102676635-102676657 TTATGCACTTCTGAAACCACAGG + Intergenic
961620877 3:128223619-128223641 TTAAGTAACGTTGACACCACTGG + Intronic
964173236 3:153795497-153795519 TTAATCACCTTTAAAACCCCAGG + Intergenic
971838268 4:31797801-31797823 TTAAAAATCTTTGAAACAACTGG - Intergenic
973264633 4:48198971-48198993 TAAAGCATCTTTGAAGCCAATGG + Intronic
974084951 4:57250033-57250055 TTAAAAAGTTTTGAAGCCACTGG + Intergenic
974119341 4:57619992-57620014 TTAAGAAGTCTGGAAACCACAGG - Intergenic
974976941 4:68904045-68904067 GTATGCAGGTTTGACACCACTGG + Intergenic
977581858 4:98733995-98734017 TTAAACAGCTTTGAAATAAAAGG - Intergenic
979204330 4:118018629-118018651 TTAAGCTGCTAAGAAACCAAAGG - Intergenic
979634101 4:122937760-122937782 TGGAGCAGGTTTGAAACCAAAGG - Intronic
980503512 4:133685834-133685856 TTAAGCAGCCAGGAAACAACAGG - Intergenic
980631073 4:135434339-135434361 TTTAGCAGCTTTGAAAAAAAAGG + Intergenic
982519841 4:156401603-156401625 ATCAGCAGCTTTGCCACCACTGG + Intergenic
982996485 4:162354548-162354570 TTAGGCAGCATTGAATCTACTGG - Intergenic
984820387 4:183876579-183876601 CTCAGCACCTTTCAAACCACTGG - Intronic
984921515 4:184768332-184768354 TTCAGCAGTCTTGGAACCACGGG + Exonic
990076721 5:51854631-51854653 TTAAGTAGCGTTGAAACAACAGG + Intergenic
990282114 5:54262234-54262256 TAAAGCATCATTGAAACCAGAGG - Intronic
993236376 5:85315345-85315367 TTAAGCAGCTGTGAATACACTGG + Intergenic
993777650 5:92021050-92021072 ATAATAAGCTTTGAAAACACTGG + Intergenic
995741637 5:115362096-115362118 TTAAGCTTCTTTGAAATCAGTGG + Intergenic
996416556 5:123217003-123217025 CTAAGGAGCTTTGAGATCACTGG - Intergenic
997155623 5:131553252-131553274 CTAAACAAATTTGAAACCACTGG + Intronic
1000251897 5:159503617-159503639 TTAAGCAACTTTGAACCATCTGG + Intergenic
1000883240 5:166720987-166721009 TGAAGCAAGTGTGAAACCACAGG - Intergenic
1000920049 5:167127687-167127709 GTAAGCAGCTCTGAGACCAGAGG - Intergenic
1001033430 5:168279419-168279441 TTGAGCAGCTTTATAACCAAAGG - Intergenic
1001406075 5:171478583-171478605 TCAAGCAGCTTCCAACCCACTGG - Intergenic
1005410452 6:25539677-25539699 TTAAGCAGCTTTGAAACCACAGG - Intronic
1005528986 6:26682735-26682757 TTGAGGAGCTGTGAAACCAAGGG + Intergenic
1005529391 6:26687511-26687533 TTGAGGAGCTGTGAAACCAAGGG + Intergenic
1005530996 6:26705631-26705653 TCAAGGAGCTGTGAAACCAAGGG + Intergenic
1005539800 6:26796005-26796027 TCAAGGAGCTGTGAAACCAAGGG - Intergenic
1005541405 6:26814135-26814157 TTGAGGAGCTGTGAAACCAAGGG - Intergenic
1005541810 6:26818911-26818933 TTGAGGAGCTGTGAAACCAAGGG - Intergenic
1007942147 6:45791483-45791505 TTAAGCAGCCTGGAAAAAACAGG - Intergenic
1008318990 6:50083490-50083512 TTAAAGAGCTTTGAAATCAATGG - Intergenic
1009010618 6:57838146-57838168 TCAAGGAGCTGTGAAACCAAGGG - Intergenic
1009012208 6:57856197-57856219 TTGAGGAGCTGTGAAACCAAGGG - Intergenic
1009012616 6:57860968-57860990 TTGAGGAGCTGTGAAACCAAGGG - Intergenic
1009013387 6:57870154-57870176 TCAAGGAGCTGTGAAACCAAGGG - Intergenic
1012385631 6:98678871-98678893 TTAAGCAGACTAGGAACCACTGG - Intergenic
1013270231 6:108538247-108538269 TTAAGAAGCTTAGAAATCTCTGG + Intergenic
1013571435 6:111430237-111430259 TCAAGAAGCTTTGAATCAACTGG + Intronic
1015239413 6:131006928-131006950 TTAAGCAGCTTGGATCCCATGGG + Intronic
1016751275 6:147632969-147632991 TTAAGCACCTTTGATGCCACAGG + Intronic
1017097014 6:150813429-150813451 CTCAGCAGCTTGGAAACTACTGG + Intronic
1017554514 6:155548427-155548449 ATAAACATCCTTGAAACCACAGG + Intergenic
1017615452 6:156242385-156242407 TTAAGCCGCTGTTAAGCCACTGG + Intergenic
1017976103 6:159358758-159358780 TGAAGCAGTTTGGAAATCACTGG + Intergenic
1021291887 7:18855599-18855621 TTAAGAAGTGGTGAAACCACAGG - Intronic
1022121375 7:27311658-27311680 TTTACCAGCTTTGAGACCTCAGG - Intergenic
1024083043 7:45872148-45872170 TTGATCACTTTTGAAACCACAGG + Intergenic
1024172988 7:46809637-46809659 TTAACTAACTTTGAAACCTCAGG + Intergenic
1027002153 7:74660925-74660947 GTAAGCAGCATTGCTACCACCGG - Intronic
1027902773 7:84138670-84138692 TTAAGCACATTTGAAAGCAGTGG - Intronic
1028525168 7:91776176-91776198 TTAAGCTGATTTCAAATCACAGG + Intronic
1028646625 7:93104990-93105012 TAAAGCAGATTTTAAAACACTGG - Exonic
1029029818 7:97455680-97455702 TTAACCAGCTATGAAATCCCTGG - Intergenic
1029956407 7:104644823-104644845 TTGAGGAGCTTTTAAACTACAGG + Intronic
1031211289 7:118830539-118830561 TAAGGCAGAATTGAAACCACTGG + Intergenic
1033952622 7:146803907-146803929 TGAAGCACCTTTGAAATCAAAGG - Intronic
1035905342 8:3503761-3503783 TTAGGCCATTTTGAAACCACAGG - Intronic
1036680730 8:10871306-10871328 TTTAGGAGCTTTGAAATCACTGG - Intergenic
1038019334 8:23539601-23539623 TTAACCAGCTTGGAAACCTTGGG + Intronic
1038632370 8:29258253-29258275 TTAAGCAGCTGTGAATCAACAGG - Intronic
1039681927 8:39748859-39748881 TATAGCAGGATTGAAACCACAGG - Intronic
1040352697 8:46584630-46584652 ATAAGCAGCTTTTTCACCACCGG - Intergenic
1041394933 8:57380519-57380541 TTCAGCAGATTTGAACTCACTGG - Intergenic
1042610699 8:70597262-70597284 TTAAGAAGCTTGGAAAACACTGG + Intronic
1043403779 8:79910236-79910258 CTATGAAACTTTGAAACCACAGG - Intergenic
1047543680 8:125795554-125795576 TTGAGCAGCTTTGAAGACCCTGG + Intergenic
1049920739 9:361619-361641 TTAAGCTGCTTTTATACCAGGGG - Intronic
1050233119 9:3549657-3549679 TTTAGGAGCTTTTTAACCACTGG - Intergenic
1050819371 9:9858364-9858386 TGAAGCAGGTTTGAAGTCACAGG - Intronic
1052740465 9:32387298-32387320 TAAACCAGCTCTGAAACCACTGG - Intronic
1054982121 9:71219065-71219087 TTACACAGCCATGAAACCACCGG - Intronic
1055887657 9:81083261-81083283 TGAAGCAGCGTGGAAAGCACTGG - Intergenic
1056377998 9:86033128-86033150 TTTAGGAGCTTTTAAACCAGGGG - Intronic
1056714734 9:89020096-89020118 TTAAGCTGCTGTGAAACCTTGGG - Intronic
1057416481 9:94868218-94868240 TAAAGCAGCTTGGAGGCCACAGG + Intronic
1058827450 9:108787705-108787727 ATGAGCAGTTTTGAAAGCACCGG + Intergenic
1061149894 9:128822716-128822738 TGAAGCAGCAGTGAAACCAGGGG - Exonic
1061429536 9:130522576-130522598 TGAAGCAGCTGTGAAACAAGAGG + Intergenic
1189206480 X:39243596-39243618 TTTAGTGGCTTTGAAATCACTGG - Intergenic
1190421413 X:50288268-50288290 TTAAGCAGCTTTTAAAACAGCGG - Intronic
1192966182 X:76179610-76179632 TGAACCAGCCTTGCAACCACAGG + Intergenic
1193773112 X:85611112-85611134 TTAACAAGGTTTCAAACCACAGG + Intergenic
1194139403 X:90191297-90191319 TTAAGCCTCTTTTAATCCACAGG - Intergenic
1195570108 X:106391406-106391428 ATAGGCAGCTTTGAACCCATAGG - Intergenic
1200485147 Y:3760231-3760253 TTAAGCCTCTTTTAATCCACAGG - Intergenic