ID: 1005412825

View in Genome Browser
Species Human (GRCh38)
Location 6:25568350-25568372
Sequence TGCTGTATTACAACTCCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 161}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005412825_1005412828 13 Left 1005412825 6:25568350-25568372 CCTGAAGGAGTTGTAATACAGCA 0: 1
1: 0
2: 0
3: 10
4: 161
Right 1005412828 6:25568386-25568408 GCGCCCAGCCTAGGACCACATGG No data
1005412825_1005412827 4 Left 1005412825 6:25568350-25568372 CCTGAAGGAGTTGTAATACAGCA 0: 1
1: 0
2: 0
3: 10
4: 161
Right 1005412827 6:25568377-25568399 TAAGGATCAGCGCCCAGCCTAGG 0: 1
1: 0
2: 0
3: 7
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005412825 Original CRISPR TGCTGTATTACAACTCCTTC AGG (reversed) Intronic
901779123 1:11581181-11581203 TGCTGCAATACAATACCTTCAGG - Intergenic
906586930 1:46986181-46986203 TGCTGTTTTTCAGCTCCATCAGG - Intergenic
910805595 1:91187506-91187528 TGCTGTTTTTCATCTCCATCAGG + Intergenic
912239672 1:107892441-107892463 TGCATTTGTACAACTCCTTCAGG - Intronic
914381973 1:147124616-147124638 TGCTGAAATACAACACCTCCTGG + Intergenic
914935702 1:151977937-151977959 TGGGTTATTACTACTCCTTCGGG - Intergenic
917059286 1:171018716-171018738 TGCTGTTTTTCAGCTCCATCAGG - Intronic
920707768 1:208267007-208267029 TGCTCTATTTCATCTCCTTCTGG + Intergenic
924378082 1:243434210-243434232 TTCTGTATTACAAGTCATACGGG - Intronic
924391282 1:243561931-243561953 TGCAGGCTTACAACTGCTTCAGG + Intronic
1063503687 10:6578189-6578211 TGCTGTCTCACTTCTCCTTCAGG - Intronic
1065765600 10:29026651-29026673 TTGTGTATTACAACTGCTACTGG - Intergenic
1067700249 10:48566507-48566529 TGATGTATCTCAACTCCTTAGGG - Intronic
1068211976 10:53932219-53932241 TGCAGTATCATCACTCCTTCAGG + Intronic
1068667485 10:59692679-59692701 ATCAGTATTACAACTGCTTCTGG - Intronic
1070344787 10:75531200-75531222 TGCTGTATTATACCTCCCTGTGG - Intronic
1072358816 10:94639176-94639198 TGCTGTTTTTCAGCTCCATCAGG + Intergenic
1073039192 10:100588504-100588526 TTGTGTATTTCAACTCCTTTGGG - Intergenic
1078069610 11:8099793-8099815 TGCTGTTTTTCACTTCCTTCTGG - Intronic
1079908259 11:26276571-26276593 TGCTGAAGTATAACTCCTTAGGG - Intergenic
1080463567 11:32476339-32476361 TGCTGTATTACATCTTCCTTAGG + Intergenic
1081221733 11:40470696-40470718 TGCTGTATTTCAGCTCCATGAGG - Intronic
1082876182 11:57991520-57991542 TGCTGTTTTTCAGCTCCATCAGG + Intergenic
1085069577 11:73531063-73531085 TCCTCCATTAGAACTCCTTCTGG - Intronic
1085579467 11:77637740-77637762 TGCTGTGCTCCAACTCCCTCAGG - Exonic
1085668590 11:78439811-78439833 TTCTATATTAGCACTCCTTCAGG - Intronic
1088004976 11:104928387-104928409 TGCTGTTTTTCAGCTCCATCAGG - Intergenic
1089426879 11:118384775-118384797 TACTGAATTACAACTCATTAGGG - Intronic
1090073373 11:123562985-123563007 TGCAGTATTACAACTCTGTCTGG + Intronic
1092528819 12:9327457-9327479 AGCTGTTTTGCCACTCCTTCTGG - Intergenic
1094680388 12:32662055-32662077 CGCTGTCTAACAACTCCTTAAGG + Intergenic
1095598557 12:43988461-43988483 TGCTTTATTTCTTCTCCTTCAGG + Intronic
1098243779 12:68494795-68494817 TGCTGGATTATAACTGCTTGAGG - Intergenic
1105668325 13:22585695-22585717 TGCTGTTTTTCAGCTCCATCAGG + Intergenic
1106435579 13:29720684-29720706 AGCTGTAGTGCAACGCCTTCTGG - Intergenic
1106484719 13:30161961-30161983 TACAGTATTAAAACTCCATCTGG + Intergenic
1109948540 13:69470038-69470060 TGGTTTATTACAATTTCTTCAGG - Intergenic
1114187114 14:20411134-20411156 TACTGAAATACAACTCCTTAAGG + Intronic
1117121220 14:52569603-52569625 TGCTGTTTTTCAGCTCCATCAGG - Intronic
1119018327 14:71083679-71083701 TGCTGTTTTTCAGCTCCATCAGG + Intronic
1119902262 14:78271607-78271629 TGCTGTACTCAAACACCTTCAGG - Intronic
1122679458 14:103446802-103446824 TGCTAAATTACAACACCTCCTGG - Intronic
1123712812 15:23002072-23002094 TGCTGAAATTCAACTCTTTCAGG - Intronic
1123982155 15:25614043-25614065 TGCTGGATGACACCTCCTACTGG + Intergenic
1126470616 15:49006577-49006599 TGCTGTTTTTCAGCTCCATCAGG + Intronic
1127230287 15:56984600-56984622 TGCTGTTTTACTAATTCTTCTGG + Intronic
1128397229 15:67240440-67240462 TGATGTATTACAGCTCCACCAGG - Intronic
1129356893 15:74997293-74997315 TGCTGTATCACACTTCCTCCAGG - Exonic
1136469797 16:30472638-30472660 TGCGGTTTCACAACTCCTGCAGG + Exonic
1144371909 17:14599072-14599094 TGCTGTTTTTCAGCTCCATCAGG - Intergenic
1149031478 17:52087635-52087657 TGTTGTAATACAACTCATTCCGG - Intronic
1149377810 17:56063578-56063600 TGCTGTTTTTCAGCTCCATCAGG + Intergenic
1158297534 18:56015383-56015405 TGCTGTTTTTCAGCTCCATCAGG + Intergenic
1160392323 18:78543540-78543562 TGCTCCATTGCAACTGCTTCTGG + Intergenic
1162606848 19:11715595-11715617 TGCTGTGTCACAATTCCTTGAGG - Intergenic
1162674986 19:12292367-12292389 TTCTGAATTCCAACTCTTTCTGG + Intronic
1163480523 19:17553421-17553443 TGCTGTCTTGCAGCTGCTTCCGG + Exonic
1165337826 19:35184642-35184664 TGCTGATTTACTACTCCTTGAGG - Intergenic
1165343500 19:35228537-35228559 TCCTGTATTGCAACTCCTCGGGG - Exonic
925245168 2:2376258-2376280 TGCTGTTTTTCAGCTCCATCAGG + Intergenic
926483302 2:13426620-13426642 TGCTGTTTTTCAGCTCCATCAGG + Intergenic
929352300 2:40972138-40972160 TGCTATTTTACAACTGCTTGTGG + Intergenic
930096201 2:47569101-47569123 TGCTGTGTCAATACTCCTTCAGG - Intronic
930182380 2:48374565-48374587 TGCTGCAATACAAATCCTTCTGG - Intronic
935903927 2:107822832-107822854 TGCTGTCTGAAATCTCCTTCTGG - Intergenic
938300395 2:130207157-130207179 TGCTCTCTTACAAGTCCTTTGGG + Intergenic
938456333 2:131467320-131467342 TGCTCTCTTACAAGTCCTTTGGG - Intronic
941276733 2:163498977-163498999 TGCTGTTTTTCAGCTCCATCAGG - Intergenic
941478187 2:165973075-165973097 TGCTGTTTTTCAACTCCATCAGG - Intergenic
942148768 2:173053898-173053920 TGCGGTATTACACCTGCCTCTGG + Intergenic
942894169 2:181031388-181031410 TGCTGTATTACTATACCTTGAGG + Intronic
943260509 2:185654501-185654523 TGCTGTAATACAGATCCTACAGG + Intergenic
943910447 2:193559827-193559849 TCCTTTATTAAAACTTCTTCTGG + Intergenic
947131553 2:226932228-226932250 TGCTGTATTACACTTCATCCTGG + Intronic
1169556751 20:6759526-6759548 TGCTGTATTAGAATTCCTCTTGG + Intergenic
1169916586 20:10689640-10689662 TGCTGTTTTCAAAGTCCTTCTGG + Intergenic
1170366695 20:15606079-15606101 TGCTCTATTGCAAATGCTTCTGG + Intronic
1170509199 20:17059427-17059449 TGCTGTGTCACAAATCCTGCAGG - Intergenic
1170980868 20:21211616-21211638 TGCTTTATTACATCTCATGCTGG - Intronic
1171513256 20:25705531-25705553 TGCTGTTTTTCAGCTCCATCAGG + Intergenic
1177606242 21:23381162-23381184 TTCTGTATTTCTTCTCCTTCTGG - Intergenic
1177874169 21:26610866-26610888 TGCAGTGTTACATCTCCATCAGG + Intergenic
1183827425 22:40399397-40399419 TGCTCTATTACGCCTCCTGCTGG - Intronic
951213064 3:19996888-19996910 TGCTGTATTACAAGTCGTCACGG - Intronic
951213089 3:19997214-19997236 TGCTGTATTACAAGTCGTCACGG - Intronic
956558640 3:70549678-70549700 TGCTGTGTATTAACTCCTTCTGG + Intergenic
956873273 3:73438973-73438995 TGCTCAATTCCATCTCCTTCAGG + Intronic
957494822 3:80978746-80978768 TTGTGTATTAAAATTCCTTCTGG - Intergenic
958503613 3:94945727-94945749 TGCTGTTTTTCAGCTCCATCAGG + Intergenic
958726437 3:97910959-97910981 TGCTGGATCACATCTCCTTAAGG + Intronic
961080493 3:124023170-124023192 TGCTGCATGACACGTCCTTCAGG + Intergenic
962666189 3:137655509-137655531 TGCTGTTTTTCAGCTCCATCAGG - Intergenic
963745008 3:149117096-149117118 TTCAGTAACACAACTCCTTCTGG - Intergenic
964968847 3:162534445-162534467 TGCTGTATATCAATGCCTTCAGG + Intergenic
965167755 3:165218343-165218365 TGGAGTGTTACAACTTCTTCAGG - Intergenic
967143266 3:186582341-186582363 TGCTGAATTAAAACTCATTAAGG - Intronic
968003604 3:195224582-195224604 AGCTGTATTTCACCTCCTGCTGG + Intronic
969702466 4:8775121-8775143 AAATGTATTACAACTCCTGCAGG - Intergenic
970655263 4:18224140-18224162 TGCTGTTTTTCAGCTCCATCAGG + Intergenic
971583543 4:28375122-28375144 TGTTTTATAACAACTCCTTTTGG + Intronic
974224843 4:59027150-59027172 TATTGTATTACAACTTCTTTAGG - Intergenic
974499850 4:62685141-62685163 TGCTGTTTTTCAGCTCCATCAGG - Intergenic
974682832 4:65185557-65185579 AGCTGAATTACAACTCTTTTTGG - Intergenic
976678387 4:87728013-87728035 TGCTTTATAACAACTCACTCTGG + Intergenic
977462113 4:97338166-97338188 TGCTGTTTTTCAGCTCCATCAGG - Intronic
977506817 4:97912480-97912502 TGTTGTATTTCAGCTCCATCAGG - Intronic
980693430 4:136326175-136326197 TTCTGTATTCCAATTCCTTTAGG + Intergenic
981296816 4:143141676-143141698 TGCTGTTTTTCAGCTCCATCAGG - Intergenic
981359842 4:143833530-143833552 TGATATTTTACAACTTCTTCAGG + Intergenic
981370607 4:143954609-143954631 TGATATTTTACAACTTCTTCAGG + Intergenic
981380376 4:144064529-144064551 TGATATTTTACAACTTCTTCAGG + Intergenic
981859707 4:149340381-149340403 TGCTGTTTTTCAGCTCCGTCAGG + Intergenic
984493814 4:180469698-180469720 TGCTGTGTTTCAGCTCCATCAGG - Intergenic
984544520 4:181085536-181085558 TTCTGTGTAACAAATCCTTCAGG - Intergenic
986079951 5:4380299-4380321 TGCCGTATTATCATTCCTTCAGG - Intergenic
986556264 5:9012689-9012711 TACTTTATTAAAACTCCTTGTGG - Intergenic
986648087 5:9938072-9938094 TGCTGTATTTCAGCTCCATCAGG - Intergenic
986955300 5:13143233-13143255 AGCTTTATAACAACCCCTTCTGG - Intergenic
988267072 5:28965961-28965983 TGCTGTATTCCAGCTCATGCTGG + Intergenic
993460011 5:88171980-88172002 TGCTGTTTTTCAGCTCCGTCAGG + Intergenic
994078064 5:95675684-95675706 TGCATTATTAAAACTACTTCCGG + Intronic
994233390 5:97335229-97335251 TGCTGTTTTTCAGCTCCGTCAGG + Intergenic
999239901 5:150121347-150121369 TGCTATCTTATATCTCCTTCTGG + Intronic
999269788 5:150290018-150290040 TGCTCTATTCCACCTCCTCCAGG - Intronic
1000459393 5:161495734-161495756 TGCAGTAGTACATCTCCTTTTGG - Intronic
1000660662 5:163934137-163934159 TGTTGTTTTTCAACTCCATCAGG - Intergenic
1003806305 6:9729073-9729095 TGCTGCATTACAGCTCACTCGGG - Intronic
1004528675 6:16433548-16433570 TGCTTTATCACAACTTCCTCTGG - Intronic
1005412825 6:25568350-25568372 TGCTGTATTACAACTCCTTCAGG - Intronic
1005707140 6:28466902-28466924 TGCTTTCTAACAACTCCTTGAGG + Intergenic
1005780888 6:29190845-29190867 TGCTGTTTTTCAGCTCCATCAGG + Intergenic
1010282845 6:74040645-74040667 TGCTGTTTTTCAGCTCCATCAGG + Intergenic
1011113153 6:83860232-83860254 TGATGTGGTACAACTCCTTCAGG - Intronic
1012063210 6:94512860-94512882 TGCTGTTTTTCAGCTCCATCAGG - Intergenic
1012082929 6:94784265-94784287 TGCTGTTTTTCAGCTCCATCAGG + Intergenic
1013605344 6:111742364-111742386 TGATGTATTACAATTTCTTAAGG - Intronic
1014195415 6:118552513-118552535 TACTATATATCAACTCCTTCAGG - Intronic
1018932324 6:168249252-168249274 TGCTGTTTTTCAGCTCCATCAGG - Intergenic
1019656267 7:2197787-2197809 TGCTGTCTGACACCTCCTTCTGG + Intronic
1020250235 7:6461701-6461723 TTCTGCATTACAACGTCTTCTGG - Exonic
1020358129 7:7300144-7300166 TGCTGTTTTTCAGCTCCATCAGG + Intergenic
1020525411 7:9252138-9252160 TGCTGTTTTTCAGCTCCATCAGG - Intergenic
1022266277 7:28757967-28757989 TGCTGTAATACTACTGCTACTGG - Intronic
1023569661 7:41558839-41558861 TGCTGTAGTACATTTCCTTTCGG + Intergenic
1024185756 7:46946447-46946469 TGCAGTCTTACAATTCCTTAAGG - Intergenic
1025003909 7:55340855-55340877 TTCTGTATTAAATCTCCTTCCGG + Intergenic
1029004595 7:97195156-97195178 TGCTGTTTTTCAGCTCCATCAGG - Intergenic
1030957837 7:115877267-115877289 TTCTCAATTAAAACTCCTTCAGG - Intergenic
1031902564 7:127427587-127427609 TGCTGTTTTTCAGCTCCATCGGG + Intronic
1035816069 8:2542400-2542422 TGCTGTACTCACACTCCTTCTGG + Intergenic
1036035068 8:5009564-5009586 TGCTGTCTTTCCTCTCCTTCTGG + Intergenic
1036166190 8:6435999-6436021 TGCTGTACTGCAACTGCTTAAGG - Intronic
1036795930 8:11756922-11756944 TGCTTCATTCCAGCTCCTTCAGG + Exonic
1039351413 8:36767704-36767726 TCCTGTATTAAATTTCCTTCTGG + Intergenic
1040355135 8:46609716-46609738 TGCTGTTTTTCAGCTCCATCAGG - Intergenic
1043996220 8:86820614-86820636 TGATGTATTGCATCTGCTTCAGG + Intergenic
1044961150 8:97531490-97531512 TGCTGTTTTTCAGCTCCATCAGG - Intergenic
1046758222 8:117993201-117993223 TGCTCTATTTCATCTCCTGCTGG + Intronic
1047348330 8:124049735-124049757 TGCTGTATTTGAACTGCTGCAGG + Exonic
1047918856 8:129612155-129612177 TGATGTATAACTAATCCTTCTGG + Intergenic
1050234241 9:3561720-3561742 TGCTGTTTTTCAGCTCCATCAGG + Intergenic
1053428884 9:38028834-38028856 TGCTGTATTTCATTTCTTTCTGG - Intronic
1056196143 9:84230676-84230698 TGCTGACCTACAACTCCCTCAGG - Intergenic
1188159066 X:26778201-26778223 TGTTGGATTGCAACTCTTTCTGG + Intergenic
1190680031 X:52818746-52818768 TACTGTCATACAACTCCTACAGG + Intergenic
1191206844 X:57843388-57843410 TGCTGTTTTTCAGCTCCATCAGG - Intergenic
1193645853 X:84067437-84067459 TGCTGTTTTTCAGCTCCATCAGG - Intronic
1193780664 X:85698021-85698043 TGCTGTTTTTCAGCTCCATCAGG + Intergenic
1194158668 X:90423742-90423764 TGCTGTTTTTCAACTCCATCAGG - Intergenic
1195474121 X:105264635-105264657 TGTTGTATGACCACTCCTTATGG + Intronic
1195983255 X:110602056-110602078 TGCTGTTTTTCAGCTCCATCAGG - Intergenic
1196322996 X:114365579-114365601 TGCTGTTTTACAAGTCCTCTTGG - Intergenic