ID: 1005412828

View in Genome Browser
Species Human (GRCh38)
Location 6:25568386-25568408
Sequence GCGCCCAGCCTAGGACCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005412825_1005412828 13 Left 1005412825 6:25568350-25568372 CCTGAAGGAGTTGTAATACAGCA 0: 1
1: 0
2: 0
3: 10
4: 161
Right 1005412828 6:25568386-25568408 GCGCCCAGCCTAGGACCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005412828 Original CRISPR GCGCCCAGCCTAGGACCACA TGG Intronic
No off target data available for this crispr