ID: 1005421375

View in Genome Browser
Species Human (GRCh38)
Location 6:25654878-25654900
Sequence TGGTCTGACCAGAGGAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 277}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005421375_1005421380 29 Left 1005421375 6:25654878-25654900 CCTTCTTTCCTCTGGTCAGACCA 0: 1
1: 0
2: 3
3: 28
4: 277
Right 1005421380 6:25654930-25654952 CTTGTACCTACACAAGCTACAGG 0: 1
1: 0
2: 0
3: 2
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005421375 Original CRISPR TGGTCTGACCAGAGGAAAGA AGG (reversed) Intronic
901971645 1:12913328-12913350 GGCTCTGACCAGTGAAAAGATGG + Intronic
902013522 1:13288412-13288434 GGCTCTGACCAGTGAAAAGATGG - Intergenic
903304275 1:22401601-22401623 TGGTAAGACCAGAGGAAAGAAGG - Intergenic
903548725 1:24143009-24143031 AGGTCTGACCACAGGGTAGATGG + Intronic
904593963 1:31631469-31631491 AGTTCTGAACAGAGGAAGGAAGG - Intronic
905835472 1:41116565-41116587 TGTTCTAAACAGAGAAAAGAAGG - Intronic
906728211 1:48059331-48059353 TGGACTGGTCAGAGGACAGAGGG - Intergenic
907371942 1:54009491-54009513 AGGCCTGAGCAGAGGAGAGAAGG - Intronic
908474068 1:64471076-64471098 GGGTCTGTGCAGAGGACAGAGGG - Intronic
911111605 1:94193810-94193832 AAGTGTTACCAGAGGAAAGATGG + Intronic
911820658 1:102415680-102415702 TTGTCTTACAAGAGGAAAGAAGG + Intergenic
912645328 1:111386786-111386808 TGATCTGACCAGAATAAAGTTGG + Intergenic
913561678 1:120027302-120027324 TGGTCTGACATGGGGAAAGAAGG - Intronic
913636446 1:120766295-120766317 TGGTCTGACATGGGGAAAGAAGG + Intergenic
913999089 1:143677355-143677377 TGGGATGAACAGAGAAAAGAAGG + Intergenic
914194011 1:145435024-145435046 TGGGATGAACAGAGAAAAGAAGG + Intergenic
914282266 1:146186704-146186726 TGGTCTGACATGGGGAGAGAAGG - Intronic
914475343 1:148017921-148017943 TGGGATGAACAGAGAAAAGAAGG + Intergenic
914543291 1:148637418-148637440 TGGTCTGACATGGGGAGAGAAGG - Intronic
914623330 1:149433594-149433616 TGGTCTGACATGGGGAGAGAAGG + Intergenic
915949192 1:160176601-160176623 TGGTGCGCCCAGAGGAATGAGGG + Exonic
916881405 1:169022767-169022789 TGGTGTGAGCAAAGCAAAGAGGG - Intergenic
917456538 1:175190913-175190935 TGTTTTGAACAAAGGAAAGAGGG - Intronic
919334828 1:196219190-196219212 GGTTCTGAACAGTGGAAAGAAGG - Intergenic
921303568 1:213773051-213773073 TGATCTCACCAGAGGACTGAAGG - Intergenic
1062820682 10:532329-532351 GGGTCTGTCCAGGGGAGAGAGGG - Intronic
1063196267 10:3746809-3746831 TGTTCTGTCCAGAGGACACACGG - Intergenic
1064347691 10:14547992-14548014 TGGTCTGAAGAGAGGGAAGTGGG - Intronic
1064774531 10:18760970-18760992 TGGGCTCACCAGTGGAATGAGGG - Intergenic
1064879000 10:20029041-20029063 TGGTCTGATCATAGGAAAAAGGG - Intronic
1066055952 10:31680203-31680225 GTGTATGACCAGAGGGAAGAGGG + Intergenic
1066094884 10:32062627-32062649 AGGTGGGACCTGAGGAAAGACGG - Intergenic
1066195573 10:33096294-33096316 GGATCTGCCCAGATGAAAGAGGG - Intergenic
1067303662 10:45037701-45037723 GGGGCTTACCAGAGGGAAGAGGG + Intergenic
1068008278 10:51416302-51416324 TGCTATGACCAAAGGAAAAAGGG - Intronic
1071172600 10:82884833-82884855 TGGTCTGACCAATGAAAAGATGG + Intronic
1072643137 10:97229155-97229177 TGGTCTGAAGGGAAGAAAGAGGG - Exonic
1075571349 10:123548621-123548643 TGGTGTGGCCAGAAGAAACAAGG - Intergenic
1076276706 10:129205648-129205670 TGTACTGACCACAGGAAAGGCGG - Intergenic
1077289319 11:1781645-1781667 TGGTCTCAGCAGTGGAAGGACGG - Intergenic
1077517829 11:3012564-3012586 GTGTCTGACCTGAGGAAAGCAGG - Intronic
1077921240 11:6643249-6643271 TGTAGTCACCAGAGGAAAGAGGG + Intronic
1080384967 11:31805670-31805692 GGGTCTGGGCAGAGGAAAGCAGG + Intronic
1082054379 11:47801072-47801094 TGGAGTGACCAGAGGAAAGAGGG + Intronic
1083729643 11:64645856-64645878 TGGTTTCAAGAGAGGAAAGAGGG - Intronic
1084410533 11:69003830-69003852 GGGGCTGACCAGAGGCAAAAGGG + Intergenic
1085174999 11:74478219-74478241 TGGTGTGACCAGAGACAAGCAGG - Intergenic
1085416682 11:76322984-76323006 TGTTCAGTTCAGAGGAAAGAGGG - Intergenic
1085698934 11:78729278-78729300 TGATCTGAGAAGAGGAAGGAAGG + Intronic
1085967641 11:81548093-81548115 TGTTATGACCTGAGGAAGGATGG - Intergenic
1088316576 11:108513027-108513049 TGGTCTGTCCTGGGGAAAGATGG + Exonic
1088925230 11:114295150-114295172 TGGTCTGGCCAGTGGCAACAAGG + Intronic
1089752360 11:120660755-120660777 TGGACTGATCACAGGAAAGAAGG - Intronic
1089982073 11:122780756-122780778 TGGTGTGAGCAGAGGACAGTGGG + Intronic
1090986898 11:131775551-131775573 TGGTGTCAACAGAGGGAAGAGGG - Intronic
1091780663 12:3212809-3212831 TGTTCTGATCAGAAGACAGATGG - Intronic
1092411503 12:8256694-8256716 TGGCCTGGCCAGAGGACCGAGGG + Intergenic
1094224122 12:28026622-28026644 TGGATTGACCCCAGGAAAGATGG + Intergenic
1095269060 12:40194898-40194920 TAGTCTGAACAGATGAAATAAGG - Intergenic
1096673743 12:53215213-53215235 GGGAGTGGCCAGAGGAAAGAGGG + Intronic
1097276469 12:57816866-57816888 TGGTCTGGCCTGCGGACAGATGG + Intronic
1099757474 12:86871841-86871863 TGGTCTGATCAGTTGACAGAGGG - Intergenic
1100473342 12:94913348-94913370 AGGTCTAACCTGAGGACAGAGGG - Intronic
1100972337 12:100083852-100083874 TGGTCTGAGCAAAGGATACAGGG + Intronic
1101614667 12:106324831-106324853 TGGTGAGACCAGGAGAAAGAAGG + Intronic
1102546978 12:113664381-113664403 AGGTCTGAGCAGAAGAAAGAAGG + Intergenic
1103035496 12:117653147-117653169 TGGTCTGTGCAGAAGACAGATGG + Intronic
1103845378 12:123898639-123898661 TGCACTGAGCTGAGGAAAGAGGG - Exonic
1105819923 13:24071097-24071119 TAGTATGACCAGAGGAACTAGGG + Intronic
1106382647 13:29255210-29255232 TGTTCTGAGCAGAGCAGAGACGG + Intronic
1107975432 13:45683861-45683883 TGGGAGGACCAGAGGACAGAAGG - Intergenic
1108199322 13:48027231-48027253 GGGATAGACCAGAGGAAAGAGGG + Intergenic
1108529117 13:51312374-51312396 TGGGATGAACAAAGGAAAGAAGG - Intergenic
1109972683 13:69789801-69789823 TGGAGTGACCAAAGCAAAGAAGG + Intronic
1110267875 13:73558887-73558909 TGGTGTGTGCTGAGGAAAGAGGG - Intergenic
1112502674 13:99955098-99955120 TGGTGAGACCTGAGGAAAGGTGG + Intergenic
1113396081 13:109948950-109948972 TGGTCTGTGCAGAAGACAGATGG + Intergenic
1114825207 14:26069138-26069160 TGTTCTGAACAGAGAAAACAAGG - Intergenic
1115617908 14:35113754-35113776 TGGTCTGGCTAGAGGCAACAAGG - Intronic
1117066414 14:52016467-52016489 AGGTCTGAGCAGTGGAAAAATGG - Intronic
1118172896 14:63406596-63406618 TGGTATGACCAAAGGAGTGATGG - Intronic
1118333528 14:64832754-64832776 TGGTGTGATGAGAGGGAAGAAGG - Intronic
1119614466 14:76089745-76089767 TGGTCAGCCCAGAGGAAGCAAGG + Intergenic
1120312626 14:82850235-82850257 TGGGGTGAGTAGAGGAAAGAGGG + Intergenic
1121388355 14:93551493-93551515 TGGTCTGGCCAGTGGCAACAAGG + Intronic
1121448339 14:93992539-93992561 TGCTCTGACCAGAGGGAACCAGG - Intergenic
1121562962 14:94887841-94887863 TGGCCTCACCAGGGGAAGGAAGG - Intergenic
1121813689 14:96913169-96913191 GCGTCTGCCCATAGGAAAGAAGG - Intronic
1121918152 14:97855042-97855064 GGGCCTGAACAGAGCAAAGAGGG + Intergenic
1123901802 15:24884512-24884534 TGGTCTGTGCAGAGCAAGGATGG - Intronic
1124900256 15:33816049-33816071 TGGTCAGACTTGAAGAAAGATGG + Intronic
1126767229 15:52020635-52020657 TGATCTGACCAGAAGAATGTAGG + Intronic
1128065625 15:64762877-64762899 TGGTGTGAACAGAGAAGAGAAGG + Intronic
1128336433 15:66788733-66788755 TGATCTGAGCAAAGGAGAGATGG + Intergenic
1128679196 15:69635505-69635527 TGGATTGACCAGTGGAAGGATGG + Intergenic
1129416009 15:75380710-75380732 TAGTCTGACCAGCGCTAAGATGG + Exonic
1132281910 15:100625221-100625243 TGTTCTAACCAGTGGAATGAGGG + Intronic
1132464220 16:70342-70364 ACGTCTGGCCAGAGGACAGATGG + Intronic
1133389374 16:5396962-5396984 TGGTCTGACTACAGGAAGGCTGG - Intergenic
1133755333 16:8758406-8758428 TGGTCTCAGCAGAGAGAAGAGGG + Intronic
1135762607 16:25149100-25149122 TGGGCTGGCCAGAGGCAACAAGG + Intronic
1137760423 16:50935769-50935791 TCCTCTCACCAGAGGAGAGAGGG + Intergenic
1138451631 16:57096724-57096746 GGGTCCAACCAAAGGAAAGAGGG + Intronic
1138908694 16:61369590-61369612 TGATCTCAGCAGAGGAAAGGAGG - Intergenic
1139325903 16:66152382-66152404 TGTTCTGCCAAGAGGAGAGAGGG + Intergenic
1140992920 16:80231740-80231762 TGGTTCGACCAGAGGAAAAAAGG + Intergenic
1141584513 16:85024679-85024701 TGGTCTGGCCAGAACAAGGAGGG - Intergenic
1143456993 17:7074690-7074712 TGGACTGCCCAGAGGCATGAGGG + Exonic
1144061863 17:11590146-11590168 TGCTCATACCAAAGGAAAGAGGG + Intergenic
1144833612 17:18145088-18145110 TGGTCAGAACAGAGTCAAGAGGG + Intronic
1148781395 17:50123989-50124011 TGGCATGACCAGGGGAGAGAGGG + Intronic
1149964592 17:61149248-61149270 TGATCTTACCAGCGGAAAGCAGG - Intronic
1150091978 17:62334484-62334506 TGGTTTGAAAAGAGGAACGAAGG + Intergenic
1150201759 17:63364305-63364327 TGGTCTGACAGGGTGAAAGATGG - Intronic
1151694672 17:75708182-75708204 AGGGCTGCCCAGAGGAAAGCGGG - Intergenic
1152807603 17:82363879-82363901 TGGTGGGAACAGAGGATAGAAGG + Intergenic
1152896168 17:82912655-82912677 TGGTCTGAGCAGAGGAGAGCAGG + Intronic
1155402003 18:25449053-25449075 GGGGCTGAACAGAGGAAAAATGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156303752 18:35857793-35857815 TGGTCTGAGCAGAAGACAGATGG + Intergenic
1156494697 18:37518089-37518111 TGGCCTGGACAGAGGAAAGAGGG - Intronic
1156525089 18:37759445-37759467 TGGTATTACCCGAGGAAGGAGGG - Intergenic
1156745265 18:40383298-40383320 TGATGTCACCAGAGAAAAGATGG - Intergenic
1156836902 18:41565898-41565920 TGGCCTGACCAGAGTAATGTAGG + Intergenic
1157371362 18:47115283-47115305 AGGTATTACAAGAGGAAAGATGG - Exonic
1157567388 18:48688856-48688878 TGTTCTGTAGAGAGGAAAGAGGG + Intronic
1157737410 18:50062404-50062426 TGGTCTGTTCAGAAGAAAGAAGG + Intronic
1159485895 18:69056906-69056928 GGGGCTGAGAAGAGGAAAGATGG - Intergenic
1159559219 18:69976257-69976279 TGGCCTGTGCAGAAGAAAGACGG - Intergenic
1163289976 19:16372896-16372918 TTGGCTGCCCAGAGGACAGAAGG + Intronic
1163933806 19:20423816-20423838 TGGTCTGACCCCAGGCAATAGGG - Intergenic
1165162951 19:33828725-33828747 TGGCCTGAGCAAAGGAAGGATGG + Intergenic
1165991754 19:39819270-39819292 TAGTCTGCACAGAGGAAGGAGGG - Intergenic
1167305755 19:48708435-48708457 TGTTGAGATCAGAGGAAAGAAGG + Intergenic
1168431074 19:56281220-56281242 TAGGCTGACCAGAAGAAGGAAGG + Intronic
1168539460 19:57198288-57198310 TGGCCTGAGCAGAAGACAGACGG - Intronic
926214243 2:10894411-10894433 TGGTCTGGCCAGTGGTAACAGGG - Intergenic
926810497 2:16751578-16751600 TGGCCTGTGCAGAAGAAAGATGG - Intergenic
928050310 2:27986915-27986937 TGGGATGAGCAGAGGAAAAAAGG + Intronic
931489495 2:62728075-62728097 TAGTCTGGCCAGAGGCAACAAGG + Intronic
931769826 2:65487867-65487889 TGTTCTGACCTGAGGAAAGGTGG + Intergenic
932188746 2:69720842-69720864 TGGTATGGCCAGAGTACAGAGGG + Intronic
932279337 2:70476211-70476233 TGGTTTGAAGAGATGAAAGAAGG - Intronic
932631163 2:73344644-73344666 TGGTGGGACAAGAGGCAAGAGGG - Intergenic
933286627 2:80391239-80391261 TGGTGTGAACAGAGTGAAGAGGG - Intronic
933808465 2:86017209-86017231 AGGGCAGACCAGAGGTAAGATGG + Intergenic
933922942 2:87066776-87066798 AGGTTTGACTAGAGGCAAGAAGG - Intergenic
934534083 2:95118467-95118489 TGGCATGGCCAGAGGGAAGATGG - Intronic
935156935 2:100491709-100491731 TGGTCTGACCAGAGGGCAGAGGG + Intergenic
935568960 2:104638919-104638941 TGGTCTGAGCAGAAGATAAATGG + Intergenic
935684942 2:105674876-105674898 TGGGCTGACCAGTGCAAACAGGG + Intergenic
936284967 2:111174772-111174794 TGGTGGGACCAGAGAAAGGAAGG + Intergenic
937149422 2:119675430-119675452 TGGCCCTACCAGAGGGAAGAGGG + Intergenic
938841419 2:135168585-135168607 TGGGCTCCCCAGAGGAAAGAAGG + Exonic
939456167 2:142438775-142438797 TGGTATGAACAGAGGAAATCAGG - Intergenic
940781279 2:157936775-157936797 TGGCATGACCTAAGGAAAGAAGG - Intronic
944055823 2:195520992-195521014 TGGTCTGGCCAGCGGCAAAAAGG - Intergenic
944663007 2:201936819-201936841 TTGTCAGAACAGAGGGAAGAGGG + Intergenic
945062675 2:205923009-205923031 TGGACAGAGCTGAGGAAAGATGG + Intergenic
946816589 2:223584471-223584493 TGATATGACCAGAAGAAAGGTGG + Intergenic
947206327 2:227664458-227664480 TGGTCTAAGGAGAGGACAGAAGG - Intergenic
948277125 2:236717487-236717509 TGGTCTGACCACGGAAAACATGG + Intergenic
1168826480 20:817964-817986 TGGTCTGAGCAGAGCAGAGGGGG - Intergenic
1172694649 20:36814013-36814035 TGATCTGACCAGAGGTCAGAGGG - Intronic
1173565072 20:44032655-44032677 GGCTCTGAGCAGAGGAGAGAGGG + Intronic
1173981425 20:47226991-47227013 TGTTCTGAACAGAGGAAAGGGGG + Intronic
1174391769 20:50222176-50222198 GGTTCTAAACAGAGGAAAGATGG - Intergenic
1175339269 20:58217720-58217742 TGGTTTGCTCAAAGGAAAGAAGG + Intergenic
1175817485 20:61891051-61891073 GGGTCTCACCAGCGGAAGGAGGG + Intronic
1177942152 21:27424388-27424410 TGGTCTGGCCAGTGGCAACAAGG + Intergenic
1181923073 22:26335753-26335775 TGCTCTGACCAGAGGCAGGCAGG + Intronic
1182586394 22:31346323-31346345 TGTTCGGAGCGGAGGAAAGATGG + Intergenic
1182970349 22:34567937-34567959 TGGACTGAGCAGATGAAATATGG + Intergenic
1184248471 22:43247519-43247541 TGGTCTGACCCAAGGAAGGTGGG - Intronic
1184972180 22:48031829-48031851 TGGAATGGCCAGAGGAAAGTGGG - Intergenic
1185394481 22:50579678-50579700 AGGGCAGAGCAGAGGAAAGAGGG - Intronic
951122470 3:18944656-18944678 TGGTCTGTGCAGAAGACAGATGG + Intergenic
951303257 3:21024706-21024728 CATTCTGACCAGAGGAGAGATGG - Intergenic
952388425 3:32859936-32859958 TGGTATGACCTGAGGAAGAAGGG - Intronic
952886555 3:38015986-38016008 TGGTCAGACTAGACCAAAGAGGG + Intronic
953412072 3:42696303-42696325 TGGTGTGAGAAGAGGAGAGACGG - Intronic
954407803 3:50355242-50355264 TGCTCTGAGGAGAGGGAAGAAGG - Exonic
954697437 3:52435282-52435304 GGGTGTGCCCAGAGGCAAGAGGG - Exonic
956306758 3:67834712-67834734 TGGTCTGTGCAGAAGACAGATGG + Intergenic
958025296 3:88042036-88042058 TGGCCTGTGCAGAGGACAGATGG - Intergenic
959585674 3:108022959-108022981 TGGTCTGACCAGTAGCAACAAGG - Intergenic
961404553 3:126668885-126668907 TGGTCTGATCAGAGGCCAGTGGG + Intergenic
961507819 3:127382938-127382960 TGGTGTGGCCAGTGGAAGGAGGG + Intergenic
962417837 3:135200063-135200085 TGCTCTGACTGGAGGAGAGATGG - Intronic
963281644 3:143390212-143390234 TGGGCTGATCAGACTAAAGAAGG + Intronic
964526298 3:157618490-157618512 TGACCTGTCCTGAGGAAAGAGGG - Intronic
964733621 3:159893693-159893715 TGGTGTGACCATCGGAAACAGGG + Intronic
966856338 3:184196472-184196494 TGGTCTGGCCAGGAGAAACAGGG - Intronic
967109877 3:186283879-186283901 GAGTCAGACCAGAGGAAGGAAGG - Intronic
968999548 4:3969250-3969272 TGGCCTGGCCAGAGGACCGAGGG + Intergenic
969407278 4:7001924-7001946 CGGTCTGAGCTGTGGAAAGACGG + Intronic
970705958 4:18802817-18802839 TGCTCTGAATGGAGGAAAGATGG + Intergenic
971979399 4:33733766-33733788 TGGCCTGAGCAGAAGACAGATGG - Intergenic
972085119 4:35206199-35206221 TGGCCTGTACAGAAGAAAGAGGG + Intergenic
973339775 4:48992394-48992416 AGCTCTGACCAGGGGAAAGAAGG - Intronic
973664834 4:53148566-53148588 TGATCTGACCAGAGGATGGCTGG + Intronic
974178100 4:58350060-58350082 TGGTCTGATGAAAGGAAAAATGG - Intergenic
974236937 4:59193501-59193523 TGGTATGCCCAGAGGGTAGAAGG + Intergenic
976753249 4:88471853-88471875 AGGACTGACCACAGGAAGGAAGG - Intronic
976828850 4:89290306-89290328 TGGCCTGAGCAGAGGAATGCAGG - Intronic
978665210 4:111173914-111173936 TGGCCTGAACAGAAGAAAGATGG + Intergenic
979731960 4:124035013-124035035 TGGTCTTACCAGAATCAAGATGG - Intergenic
983507788 4:168573720-168573742 TGAACAGACCATAGGAAAGAGGG - Intronic
985341543 4:188959900-188959922 TACTCTGCCCAGAGGAAAGAGGG + Intergenic
985617517 5:932579-932601 TGGTCTGCCCAGAGGAAGCATGG + Intergenic
986135306 5:4971564-4971586 TGGTGTGACCTGTGGAAAGTTGG + Intergenic
987192564 5:15493258-15493280 TGGTCAGAACAGAAGGAAGAGGG - Intergenic
989988900 5:50737773-50737795 TGGTCTTACCAAAGTAAAGGTGG - Intronic
990050643 5:51495113-51495135 TGGCCTGAGCAGAGGACATAGGG + Intergenic
991946030 5:71899226-71899248 TGGTCTGTGCAGAAGACAGATGG + Intergenic
992109968 5:73483786-73483808 TGGTCTGTGCAGAAGACAGACGG - Intergenic
994973151 5:106769266-106769288 TGGTCTGTCTAGAGGAGAGATGG - Intergenic
995602513 5:113813270-113813292 TGGACAGAGGAGAGGAAAGAAGG - Intergenic
996949421 5:129108242-129108264 GGGCCTTATCAGAGGAAAGAAGG + Intronic
999226914 5:150033290-150033312 TGGTCTGCCTTGGGGAAAGAGGG + Intronic
1003148078 6:3525842-3525864 TGGGCTGCCCAGAGGACAGGAGG - Intergenic
1003231391 6:4256832-4256854 GAGTTTGAACAGAGGAAAGACGG + Intergenic
1003515439 6:6814363-6814385 TGGTCTCTCCAGAGGAAAATGGG - Intergenic
1004090369 6:12494524-12494546 TGGTATGGCGAGAGGAAGGAGGG - Intergenic
1004447559 6:15714225-15714247 TGGTCTCTCCATTGGAAAGAAGG + Intergenic
1004659330 6:17696271-17696293 GAGTCTGACAAGAGGAAAAACGG + Intronic
1004660296 6:17704345-17704367 TGGTCTGAATAGAGGTTAGAAGG - Intronic
1005421375 6:25654878-25654900 TGGTCTGACCAGAGGAAAGAAGG - Intronic
1006331972 6:33398128-33398150 AGGCCTGACCAGATGGAAGATGG + Exonic
1007416712 6:41695247-41695269 TGGCCTGACCAGAGGAGACCGGG - Intronic
1007530199 6:42535352-42535374 AGGTCTGAGAAGAGGAAAGAAGG - Intergenic
1007935459 6:45728344-45728366 TGTTCTGGGCAGAGGAAAGGAGG + Intergenic
1008334086 6:50279310-50279332 TGTTTTGACCAGAGGTAAGCAGG - Intergenic
1008401132 6:51064437-51064459 TAGTTTGAACAGAGGAAAGGTGG - Intergenic
1009885858 6:69623090-69623112 TGGTCTGACCAGAAGCAATAAGG - Intergenic
1010025752 6:71214359-71214381 TAGTCTGAAAAGATGAAAGAAGG + Intergenic
1011528453 6:88292991-88293013 TGATGTCACCAGAGGAAGGAAGG + Intergenic
1011753117 6:90473103-90473125 TGGGCTGAGCAGAAGGAAGAGGG - Intergenic
1012436059 6:99216166-99216188 AGGACTGGCCAGAGGCAAGAGGG - Intergenic
1013849773 6:114500001-114500023 TGGTCTTAGCAGAGGAAAAAAGG + Intergenic
1014310900 6:119800081-119800103 TGCTTTGAACAGAGCAAAGAAGG - Intergenic
1014601639 6:123420036-123420058 TGGTCAAACCACAGGAAAAAGGG + Intronic
1017589372 6:155961993-155962015 TGGTCTGAGGAGAAGAAGGATGG + Intergenic
1017913351 6:158813945-158813967 TCTTCTGCCCAGTGGAAAGAAGG - Intronic
1018107445 6:160502708-160502730 TGGCCTGTGCAGAGGACAGATGG - Intergenic
1018142090 6:160848333-160848355 TGGTCCGGCCAGATAAAAGATGG + Intergenic
1019523624 7:1471221-1471243 TGGTCTGACCGGGGGAAAGGTGG + Exonic
1022826521 7:34020003-34020025 TGGATACACCAGAGGAAAGAAGG + Intronic
1022847615 7:34226809-34226831 TGGACTGCTCAGAAGAAAGATGG - Intergenic
1023541596 7:41272085-41272107 TGTCCTGACCAGAGAAAATAGGG + Intergenic
1023878820 7:44307236-44307258 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023878830 7:44307276-44307298 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1024038932 7:45534300-45534322 TTGACTGTCCAGTGGAAAGATGG + Intergenic
1024172168 7:46800846-46800868 TGATCTGATAAGAGGGAAGATGG - Intergenic
1024316880 7:48028312-48028334 TGTTCTCACTAGAGGAAACAGGG + Intronic
1025155048 7:56597503-56597525 TGGACTGCCCAGAGGAGAGCTGG + Intergenic
1028484120 7:91339763-91339785 TAGTCTTCCCAAAGGAAAGAAGG - Intergenic
1029504067 7:100951512-100951534 GGGTGTGACCAGAGGAGGGAAGG + Intronic
1030277342 7:107735205-107735227 TGGCCTGTGCAGAAGAAAGATGG + Intergenic
1031339016 7:120575772-120575794 TGGTTTGACCAGAAGTAAGCTGG + Intronic
1031484023 7:122307141-122307163 TTGTCTGAGCAGGGGAAAGGAGG - Intronic
1032380961 7:131480179-131480201 TTCACTGACCAGAGGAAAGCTGG - Intronic
1033003725 7:137537075-137537097 TGGCATAACAAGAGGAAAGAAGG + Intronic
1034818068 7:154191504-154191526 TGGTCTGCACAGAGGGAAAAGGG - Intronic
1036562548 8:9908821-9908843 TGGTCCCACCAAAGGAAGGAAGG + Intergenic
1038387417 8:27161995-27162017 AGGGCTGAAGAGAGGAAAGATGG + Intergenic
1039204888 8:35141250-35141272 TGGTTTGGGCAGTGGAAAGATGG - Intergenic
1039839694 8:41284916-41284938 GTGTCTGACCTGAGGGAAGAAGG - Intronic
1041397615 8:57407516-57407538 TGTTCTGACCCGTGGAAAGGGGG - Intergenic
1041565001 8:59267062-59267084 TGTTCTGATCAGAGAAAAGGCGG + Intergenic
1041871605 8:62640614-62640636 GGGTCAGGGCAGAGGAAAGAAGG - Intronic
1042236104 8:66614158-66614180 TGGTCTCTCCAGAGGGAAGAAGG - Intronic
1043019291 8:74981372-74981394 AGGTCTGTCCAGAGGCAACAAGG + Intergenic
1043827697 8:84949006-84949028 TGGTATGGCCAGAGGCTAGACGG - Intergenic
1046337299 8:112806984-112807006 TGGTCTGGCCAGAGGCAACAGGG - Intronic
1047221705 8:122923962-122923984 TGCTCTGTCCTGATGAAAGATGG + Intronic
1047648157 8:126890654-126890676 TTGTGTGACCACAGGAAAGCTGG - Intergenic
1047743064 8:127822710-127822732 TGGGCTGGCCAGAGATAAGAAGG + Intergenic
1048436511 8:134423465-134423487 AGGTTTGAACAGAGGTAAGAGGG - Intergenic
1048861410 8:138726938-138726960 TGGGGTGACCAGAGGGAGGAAGG + Intronic
1049486737 8:142868818-142868840 TGGACTGAGCAGAAGATAGATGG - Intronic
1049855947 8:144861983-144862005 TTGTCTGACTGGATGAAAGAGGG + Intergenic
1051566069 9:18499549-18499571 TGGGCAGACCACAGGAAAAATGG + Intronic
1052421582 9:28249894-28249916 TTGTTTGACCAAAGGAAAAATGG - Intronic
1053010873 9:34632385-34632407 ATGTCTGATCAGAGGAAACATGG + Intergenic
1054934687 9:70674109-70674131 CTGTCTGCCCACAGGAAAGAGGG + Intronic
1055173772 9:73292490-73292512 TGTTATAACCAGAGGCAAGAGGG + Intergenic
1055570830 9:77615372-77615394 TGACCTGATCAGAAGAAAGAAGG - Intronic
1057894092 9:98892891-98892913 TGGGCTGAACAGAGACAAGACGG + Intergenic
1058072009 9:100610704-100610726 TGGTGTGACCATAGGAGTGATGG + Intergenic
1058259372 9:102810604-102810626 TGGCCTGTGCAGAAGAAAGATGG - Intergenic
1058470798 9:105276782-105276804 TGGTCTGAGAAGTGGAAGGAAGG + Intronic
1060116675 9:120946946-120946968 AGGTGTGACGGGAGGAAAGAAGG - Intergenic
1060389306 9:123266201-123266223 TGGTTTGACGAGTGGACAGAAGG - Intronic
1061223851 9:129268863-129268885 GGGTCTGACCAGTGGAATGTGGG + Intergenic
1061366929 9:130177027-130177049 TGGGCTGACCAAAGGCAACAGGG - Intronic
1185910202 X:3973986-3974008 TAGTCAGAACAGAGGAAAAAGGG + Intergenic
1187140464 X:16588253-16588275 TGGTCTGGCCAGCGGCAACAAGG + Exonic
1187279610 X:17847814-17847836 TTGGCTGACTAGAGGAAAGCAGG + Intronic
1193212371 X:78822277-78822299 TGTTCTGACAGTAGGAAAGAAGG + Intergenic
1194104848 X:89756503-89756525 TGCTCATACCAAAGGAAAGAGGG - Intergenic
1194489580 X:94530250-94530272 TGGTATGACCCAAGGAGAGAAGG + Intergenic
1194574184 X:95591775-95591797 TTGTCTGATCAAAGGAAACATGG + Intergenic
1195255686 X:103087588-103087610 TACTTTTACCAGAGGAAAGATGG + Intronic
1195351005 X:103997050-103997072 TGGACTGAACAGGGCAAAGATGG + Intergenic
1195798151 X:108676263-108676285 TGAAATGACCAGAGGAGAGAAGG + Intronic
1198701182 X:139399380-139399402 TGGTCTGTGCAGAAGACAGATGG + Intergenic
1199565766 X:149214251-149214273 TTTTCTAACCAGAGGCAAGAAGG - Intergenic
1202067999 Y:20960515-20960537 GGATCTTGCCAGAGGAAAGAAGG + Intergenic