ID: 1005421379

View in Genome Browser
Species Human (GRCh38)
Location 6:25654922-25654944
Sequence TTGTGTAGGTACAAGAATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 218}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005421379_1005421382 -4 Left 1005421379 6:25654922-25654944 CCTTCATTCTTGTACCTACACAA 0: 1
1: 0
2: 0
3: 10
4: 218
Right 1005421382 6:25654941-25654963 ACAAGCTACAGGTAGAGCTGAGG No data
1005421379_1005421383 15 Left 1005421379 6:25654922-25654944 CCTTCATTCTTGTACCTACACAA 0: 1
1: 0
2: 0
3: 10
4: 218
Right 1005421383 6:25654960-25654982 GAGGAAGCCTCCCCCAAGTGAGG 0: 1
1: 0
2: 2
3: 12
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005421379 Original CRISPR TTGTGTAGGTACAAGAATGA AGG (reversed) Intronic
900470694 1:2853341-2853363 TTGTTTAGGTTCAGGCATGATGG + Intergenic
901700219 1:11041321-11041343 ATGGGTAGGTAGAAGGATGATGG + Intronic
906799708 1:48725739-48725761 TTGTATGGGTGTAAGAATGATGG + Intronic
907034188 1:51201646-51201668 TTGTGTTGGTAATAGACTGAAGG - Intergenic
907299576 1:53478127-53478149 TTATTAAGGTACAAGAATGAGGG + Intergenic
908885524 1:68783923-68783945 TTCAGTAGCTACAAGGATGAAGG + Intergenic
909264773 1:73542496-73542518 TTATGTAGGTAGAAGAAAAAAGG - Intergenic
910336495 1:86138054-86138076 TTGGGTGGGTTTAAGAATGAAGG - Intronic
910405194 1:86881566-86881588 TTATGGAGGTTCAAGAAAGATGG + Intronic
910468064 1:87521882-87521904 TAGTGAAGGTACAAGATGGAAGG + Intergenic
910471385 1:87556749-87556771 CTGAGTAGGTAAAAGAGTGATGG + Intergenic
912304697 1:108555525-108555547 TATTGTAGGTATAAGATTGATGG + Intergenic
913268654 1:117070778-117070800 TTGTGTTTGTACAAGAGGGAGGG + Intronic
914927156 1:151898359-151898381 TTGTGTACCTAGAAGAATTATGG - Intronic
916579029 1:166091248-166091270 TTGGGTTGGTGCAAGAAGGATGG + Intronic
917007755 1:170434207-170434229 TTTTGTAAGTACATGAAAGAGGG - Intergenic
917745922 1:178007113-178007135 TTATATAGGAAGAAGAATGAAGG + Intergenic
918132993 1:181645489-181645511 TTATGGAGGTAGAAGAAAGATGG - Intronic
918200587 1:182262597-182262619 TTATCTAGGAACAAGCATGACGG + Intergenic
919549501 1:198966611-198966633 TTGTGTACCTACAAGGATTATGG + Intergenic
920145097 1:203853499-203853521 TTGTGAAGGAATAAGCATGATGG + Exonic
921373011 1:214444932-214444954 CTGTTTAGGTACCAGAAAGAGGG - Intronic
921820203 1:219608506-219608528 TTGTGAAGGAATAAGCATGATGG - Intergenic
922025639 1:221746137-221746159 TTCTGGAGGTACTAGAATTAAGG + Intergenic
1064976564 10:21122920-21122942 TTCTGTAGGATCAAGAATCAGGG + Intronic
1066556244 10:36617371-36617393 TTGTATCAGTACAAAAATGAAGG + Intergenic
1066989044 10:42495015-42495037 TTGTGGATTTACAGGAATGAGGG + Intergenic
1068199940 10:53770550-53770572 TCTTGTAGGTACAAGAATTCTGG + Intergenic
1069089575 10:64183269-64183291 TTGTGAAGGTACAGGGAAGAAGG + Intergenic
1069574137 10:69514955-69514977 TTAGGGAGGTCCAAGAATGATGG - Intergenic
1070762176 10:79030680-79030702 TTGTGTTGGCAAAAGAATCAGGG - Intergenic
1071983209 10:91024506-91024528 CTGTGTGGGGACAACAATGAGGG - Intergenic
1073871021 10:107864328-107864350 TTGGATATGTACAAGTATGAAGG + Intergenic
1076581011 10:131511023-131511045 TTGTGTAGGTAGGAGAGTGATGG + Intergenic
1076666314 10:132094948-132094970 TTGTGTACCTACGAGAATTATGG + Intergenic
1077634002 11:3829554-3829576 TTCAGTACTTACAAGAATGATGG - Intronic
1077966187 11:7136074-7136096 TTGTATAGCTACATGAAAGAGGG - Intergenic
1078513556 11:12004690-12004712 TTGAGTAGATATAAGAATTAAGG + Intronic
1078680815 11:13474021-13474043 TTTTGTATGTACATGAATGAAGG + Intergenic
1079848006 11:25494687-25494709 TCGTGTAGGTACAAGAGTCCAGG + Intergenic
1080517627 11:33039057-33039079 TTGTGTAGCTACAAACAGGATGG + Intergenic
1081515263 11:43822630-43822652 CTGTGTAGGGACATGGATGAAGG - Intronic
1082880620 11:58033893-58033915 TAGTGTAGCTTAAAGAATGAAGG + Intronic
1086545177 11:87959288-87959310 CTGTGTAGGTTTTAGAATGATGG - Intergenic
1087643286 11:100778580-100778602 CTGTGTGGGTACAAAAATAAGGG - Intronic
1087852844 11:103052606-103052628 TGGAGTAGATACAAGAATGAAGG - Intergenic
1088336192 11:108706731-108706753 TTGTTTAGGTACAAAGAGGATGG + Exonic
1090936511 11:131347705-131347727 TTGTGTAGGAAGAAGAGAGAAGG + Intergenic
1091485338 12:881261-881283 TTGTGAAAGGACAAGAATAATGG - Intronic
1092416475 12:8293880-8293902 TTGGGTAGGTAAAGGAAAGAGGG + Intergenic
1092924319 12:13259767-13259789 TTGGGTAGGTAAAGGAAGGAGGG + Intergenic
1093504736 12:19852248-19852270 TTGAGTGGGTGCAAGAATGTAGG - Intergenic
1094236617 12:28175338-28175360 TTCTGTAGGTACTACAGTGATGG - Intronic
1099538750 12:83878348-83878370 TGGTGTAGTTACAAAAAAGATGG + Intergenic
1099645070 12:85342602-85342624 TGGAGGAGATACAAGAATGAAGG + Intergenic
1100043208 12:90345516-90345538 ATGAGCAGGTAGAAGAATGAGGG + Intergenic
1101073869 12:101107751-101107773 TTGTGTAGGGAGATGAGTGATGG + Intronic
1101493321 12:105230346-105230368 TGGTGTACGAACAAGAATTAAGG + Intronic
1103465712 12:121140427-121140449 GTGTGGTGGGACAAGAATGACGG + Intronic
1103814552 12:123643475-123643497 TTGTGTTGGTACAAGAAAAAAGG - Intronic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1105552636 13:21411721-21411743 TAGGGTAGCTAGAAGAATGACGG + Intronic
1108205926 13:48090235-48090257 TTGTGTGGGAACAGGAATGTTGG - Intronic
1109587856 13:64432702-64432724 TTGTGTAGGTACAAAGTTTAGGG - Intergenic
1109970936 13:69768129-69768151 TTGGGTAGGTATTTGAATGATGG - Intronic
1110695827 13:78487309-78487331 TTGTGTACTTACAAGATTTACGG - Intergenic
1110844601 13:80179908-80179930 TTCTGAAGACACAAGAATGAAGG + Intergenic
1113756236 13:112812933-112812955 ATGTTTAGCTACAAGTATGAAGG - Intronic
1114764844 14:25359248-25359270 TACTGTATGTACTAGAATGATGG - Intergenic
1115244523 14:31281744-31281766 TTTTGTAGGTATAATAATTAAGG + Intergenic
1116515412 14:45799126-45799148 TTGTGTAGCCACCAGAAGGAAGG + Intergenic
1116562397 14:46397346-46397368 ATGTGTGGGGACAAGAATGTAGG - Intergenic
1118480237 14:66157577-66157599 TTATGTATATTCAAGAATGAGGG + Intergenic
1119887319 14:78153779-78153801 TGGTGTAGGACCAAGAATAATGG - Intergenic
1122654338 14:103247385-103247407 TTGTGTTGGGACAAGCAGGATGG + Intergenic
1124339414 15:28880367-28880389 TTGTGTAGATAACAGAGTGAAGG - Intergenic
1124358326 15:29015765-29015787 TTGTGGGGGGACAAGAGTGAAGG + Intronic
1128984131 15:72206986-72207008 TTGTGTAGGTACATGGGGGAAGG + Intronic
1133920314 16:10146916-10146938 TTGTGTAGGTAGTAGCAAGAGGG - Intronic
1137326723 16:47445885-47445907 CTGTGATGGTACAAGAACGAAGG + Intronic
1137955245 16:52823043-52823065 ATCTGTAGGGACAAGAATGTTGG - Intergenic
1139091875 16:63658326-63658348 ATATGTAGTTACATGAATGAGGG + Intergenic
1143869965 17:9951078-9951100 TTGTGGAGGCACAGGAAGGAAGG - Intronic
1144301963 17:13929345-13929367 TTGTGAAGATTCAAGAGTGATGG - Intergenic
1149600783 17:57891769-57891791 TTGAGTAGGGACCAGAAGGAAGG - Intronic
1152128338 17:78460862-78460884 ATGAGTATGTACATGAATGAAGG - Intronic
1155491350 18:26404924-26404946 TTGTGTACGTGCACGAATGGGGG - Intergenic
1156241177 18:35256017-35256039 TTGTGTAGGGACAAAATTAAGGG + Intronic
1157024570 18:43827622-43827644 TTGTGAAGGTAAAAGAAAGTCGG - Intergenic
1157084695 18:44567641-44567663 TTGTGTAGGTACTTGAAGTATGG - Intergenic
1157847275 18:51015687-51015709 TTGAGTAGGGACCTGAATGATGG - Intronic
1158544776 18:58386741-58386763 CTGTGTAGGTACCTGAGTGAAGG - Intronic
1159293358 18:66450597-66450619 ATCTGTGGGTACATGAATGAAGG - Intergenic
1159430045 18:68339729-68339751 GTGTGTGGCTACACGAATGAAGG + Intergenic
1159583403 18:70260565-70260587 ATGTGAAGATAAAAGAATGATGG + Intergenic
1159899849 18:74036007-74036029 TATTGAAGGTACAAGAGTGAAGG - Intergenic
1160367811 18:78343771-78343793 TTGGGTAGGTAAAAGGAAGAAGG - Intergenic
1164322632 19:24163552-24163574 TTGTGCATTTACCAGAATGAGGG - Intergenic
925447077 2:3936168-3936190 CTTTGTAGGGACATGAATGAAGG - Intergenic
925953378 2:8937118-8937140 TGCTGCAGGTACAAGAATCAGGG + Intronic
927219636 2:20695170-20695192 TTGTATAGGAACCATAATGAGGG - Intronic
928767103 2:34660289-34660311 TTGTGTGGCTACAAGAAAGAAGG + Intergenic
928827158 2:35437061-35437083 TTGGGTAGGTAAAAGAAAAAGGG + Intergenic
929248018 2:39723502-39723524 TTTAGTACTTACAAGAATGAAGG - Intergenic
930494811 2:52127617-52127639 TTGTGGAGTTTCAAGAATCATGG + Intergenic
930508205 2:52311302-52311324 TTGTGTATGTCCATGAATAAGGG - Intergenic
933073190 2:77888762-77888784 TTGTGAAGTTAGAAGAAAGATGG - Intergenic
934474335 2:94583461-94583483 TTGTGTTGGTTCATGAATCATGG + Intergenic
935870686 2:107445939-107445961 TCTTGTAAGTACAGGAATGATGG - Intergenic
936759836 2:115763747-115763769 TTGTGGAAGTGCAAGTATGAGGG - Intronic
937792967 2:125981953-125981975 GGATGTAGGTACAAGAATGGTGG - Intergenic
939668431 2:144979324-144979346 TTGGGTTTCTACAAGAATGAAGG + Intergenic
940456090 2:153902596-153902618 TTGTAGAGGGATAAGAATGAAGG + Intronic
941522041 2:166557538-166557560 TTGTGTTACTACAGGAATGAAGG - Intergenic
942308700 2:174633919-174633941 TTGTGTTAGTAAAAGAAGGAAGG + Intronic
942533117 2:176934153-176934175 TATTTTAGGGACAAGAATGAAGG + Intergenic
943865706 2:192922723-192922745 CTGTGTAGGTGCTAGAAGGAAGG - Intergenic
945211503 2:207388034-207388056 TTGTAAAAGTCCAAGAATGAAGG + Intergenic
946886970 2:224230828-224230850 TTGGGTAGGTAAAGGAATAAGGG - Intergenic
947074835 2:226331201-226331223 TTGTCTAGGTATAAGAATTAAGG + Intergenic
947315182 2:228849953-228849975 TTGTGTATCTACAACAAAGATGG - Intergenic
947828872 2:233125078-233125100 TTCTGTACGTACACGAATGGAGG - Intronic
948798165 2:240416865-240416887 TTGTGTAAGTAGAAGAATTCAGG - Intergenic
1171536810 20:25899498-25899520 TTGTGTAGGTAGACAAGTGAAGG - Intergenic
1173049700 20:39547306-39547328 TTGTGTAAGTAAAAGAAGGGGGG - Intergenic
1174582787 20:51584278-51584300 TTGGCTATGAACAAGAATGAGGG - Intergenic
1177455559 21:21332994-21333016 TTTTTCAGGTACAAGAATGTAGG - Intronic
949112580 3:280249-280271 TTTTGTATCTAAAAGAATGAGGG + Intronic
951715525 3:25640557-25640579 TTGTGTAGGCAGAAGAGGGAGGG - Intronic
955646455 3:61143092-61143114 TTGTGAAGATACAAGTTTGAGGG + Intronic
956899443 3:73699646-73699668 TTGTGGAGATATAAGAATAAAGG - Intergenic
961765330 3:129205931-129205953 TTGTGTACGTGGCAGAATGATGG + Intergenic
962083220 3:132162845-132162867 TTGTGTAAATACATGCATGATGG - Intronic
963519001 3:146341654-146341676 TAGTATAGTTAAAAGAATGAAGG + Intergenic
964109268 3:153072486-153072508 TTGTGGAGGTGCAAGAATAGAGG - Intergenic
964665860 3:159171274-159171296 TTGTTTACGTACATGAATGTAGG + Intronic
964857525 3:161162817-161162839 TGGTGTAGGCAGAAGCATGATGG + Intronic
965193478 3:165562088-165562110 TTATGAAGATAGAAGAATGATGG - Intergenic
965777811 3:172251375-172251397 TTTTGTAGATAGAAGAAGGAGGG - Exonic
966757360 3:183384038-183384060 ATGTGGAGGTTCAGGAATGAAGG - Intronic
966967798 3:185013151-185013173 TTGTGGATTTACCAGAATGAGGG - Intronic
967432207 3:189398777-189398799 ATGTTTAGGTAAAACAATGAAGG - Intergenic
968059786 3:195718685-195718707 TTGTGGAGTTTCAAGAGTGATGG + Intergenic
968909787 4:3471798-3471820 TTCTGTAGGTGCGGGAATGAGGG + Intronic
969748748 4:9094589-9094611 TTGTGTAGGTAAAGGAAAAAGGG - Intergenic
970029525 4:11658998-11659020 TTGTGTAGGTAAAGGAAAAAGGG + Intergenic
970046617 4:11861641-11861663 TTATATAGGTACAAGATAGAAGG - Intergenic
976456067 4:85247858-85247880 TTATATAGGAAGAAGAATGAAGG - Intergenic
977851898 4:101840484-101840506 TTGTGTGTTTACCAGAATGAGGG + Intronic
979744750 4:124198026-124198048 TAGTCTAGGTAGAATAATGATGG - Intergenic
980187507 4:129480621-129480643 GTGTTTAGGTATAAGAAAGAGGG - Intergenic
980450173 4:132959440-132959462 TTGTGGATTTACCAGAATGAGGG + Intergenic
980712355 4:136586104-136586126 TTGTGAAGGAAAAATAATGAAGG - Intergenic
984338063 4:178416886-178416908 TTTTGTATGTATAAGAATCAGGG + Intergenic
987296550 5:16557314-16557336 TTATGTAGGTACACCACTGATGG + Intronic
987601118 5:20072092-20072114 TTGTTGAGGCAAAAGAATGATGG - Intronic
987753626 5:22072040-22072062 TTGTGTAGGAAGTACAATGAAGG - Intronic
991319122 5:65349533-65349555 TTGTGTAGTTAAAAGAAAGTGGG + Intronic
991395560 5:66201358-66201380 ATGTAGAGGAACAAGAATGATGG - Intergenic
991507510 5:67340638-67340660 TTGTGTATATACATGAGTGAAGG - Intergenic
991976836 5:72191539-72191561 TTGTGTAGTTCCAAGGATGTAGG + Intronic
992435408 5:76751330-76751352 TTGAGTAGGAATTAGAATGAGGG - Intergenic
993325027 5:86523587-86523609 TAGTGGAGGTACAAGAAGCAGGG + Intergenic
994953511 5:106497318-106497340 TTGTGTATGGTCAAGATTGATGG - Intergenic
996002288 5:118378835-118378857 TTCTTTAGATACAATAATGAAGG + Intergenic
996008053 5:118447330-118447352 ATGAGTAAATACAAGAATGAGGG + Intergenic
996246293 5:121267583-121267605 TTAGGTTGGTACAAGCATGATGG - Intergenic
998239823 5:140430263-140430285 CTGACTAGGTACAAGAATAAAGG - Intronic
998586791 5:143435422-143435444 CTGCATAGGCACAAGAATGAGGG + Intronic
1001017535 5:168154840-168154862 TTGTGTAGATGCAAGTATGGGGG - Intronic
1001186041 5:169573870-169573892 TTTTATAGGAACAAGAAGGAGGG - Intergenic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1003894513 6:10594537-10594559 TTTTGTAGTCACAATAATGATGG + Intronic
1004063258 6:12218741-12218763 CTGTGTAGGGTCAAGAATGGAGG - Intergenic
1004318701 6:14615187-14615209 TTCTGTAGGAACAAGAAGAAAGG + Intergenic
1004918027 6:20350350-20350372 AAGTGGAGGAACAAGAATGATGG - Intergenic
1005421379 6:25654922-25654944 TTGTGTAGGTACAAGAATGAAGG - Intronic
1006468662 6:34212662-34212684 ATGTGTAGGGAAAAGAGTGAAGG - Intergenic
1006762879 6:36478888-36478910 TTGTGTACAAAGAAGAATGAAGG - Intronic
1007605062 6:43111993-43112015 TTTTATAGATACAAAAATGAAGG + Intronic
1009550368 6:65084878-65084900 TTGTGGAGGAATAAGAAAGAGGG + Intronic
1009565430 6:65306056-65306078 TTGTGAAGGAATAAGCATGATGG + Intronic
1010077389 6:71816263-71816285 CTTTGTAGGGACATGAATGAAGG - Intergenic
1011381319 6:86744822-86744844 TTGTGCAGGTACAAGAAGCATGG - Intergenic
1012350544 6:98245224-98245246 TATTTTAGGTACTAGAATGAGGG + Intergenic
1012859037 6:104537103-104537125 TAGTGCAGTTACAAGAATAATGG + Intergenic
1013830057 6:114261152-114261174 TTGGGTAGGAAAAAAAATGAGGG + Intronic
1014308039 6:119766608-119766630 TTGTGGAGGTAGAAAACTGAAGG - Intergenic
1014900446 6:126957354-126957376 TTGTGTAGCTATAAGAATGGTGG - Intergenic
1020714711 7:11657311-11657333 TTGTTTAGGTACAATTGTGAAGG + Intronic
1021039790 7:15847362-15847384 TTCTTTAGGTACAGGAATAAGGG + Intergenic
1021147588 7:17107773-17107795 TTGTGTAGTTTCAAGAGTCATGG + Intergenic
1024101672 7:46038561-46038583 TTGTGGATTTACAGGAATGAGGG - Intergenic
1029794874 7:102883144-102883166 TTCTGTAGTTATAAGAAAGAGGG - Intronic
1031262724 7:119542728-119542750 CTGTGTGGTTAAAAGAATGAAGG + Intergenic
1031762559 7:125733207-125733229 TTATGTAAGTAAAAGACTGAAGG + Intergenic
1037248803 8:16868394-16868416 TTTTGTAGGAACAAGCATAAAGG + Intergenic
1037497855 8:19457845-19457867 TTGAGTAGCTACAAAAATGTGGG + Intronic
1037744280 8:21630634-21630656 TTGTGTTGATACAAGAGTCAGGG - Intergenic
1038140178 8:24836172-24836194 TTATGTAGGTCCAAGAAAGTAGG - Intergenic
1038255528 8:25947693-25947715 TTGTGCATGTGCAAGAAAGAAGG - Intronic
1038595692 8:28883806-28883828 TTGAGTAAATACATGAATGATGG + Intronic
1039188354 8:34943187-34943209 TTGTTTAGTAAAAAGAATGATGG - Intergenic
1039249313 8:35643950-35643972 TTGTGTAGGTGTAAGTATTATGG - Intronic
1040791273 8:51232389-51232411 TTGTGTAGAGAAAAGATTGAAGG - Intergenic
1042330982 8:67580308-67580330 TTGTGTTGGTAGAAGGATTAGGG - Intronic
1042439518 8:68809864-68809886 TTGTGTAGGCATAATAAAGATGG + Intronic
1042795191 8:72654406-72654428 TTGTGGGGATACAAAAATGATGG - Intronic
1043170454 8:76959364-76959386 TTGTGAAGTTGCAAGACTGAGGG + Intergenic
1043782910 8:84359348-84359370 TTGTGAAGTGACTAGAATGAAGG + Intronic
1045986066 8:108251072-108251094 TTGTGAAGGGGCAGGAATGAAGG + Intronic
1049262010 8:141644647-141644669 TTGTGTAATTACACGAATGTTGG + Intergenic
1052731470 9:32291279-32291301 TTGTGTACCTACAAGGATTATGG + Intergenic
1055083817 9:72294005-72294027 TTGTCTAGGAACAAGATTGTTGG - Intergenic
1055164785 9:73177840-73177862 TTGTGAATGTGGAAGAATGAAGG - Intergenic
1055360089 9:75480423-75480445 TTGTAAAGCTATAAGAATGAAGG - Intergenic
1055462411 9:76531313-76531335 TTGTGTGGGTTCTAGAATCAGGG + Intergenic
1058474691 9:105320021-105320043 TTGTCTAGGGACAAGAATGGGGG - Intronic
1060421684 9:123473637-123473659 TTGTGTAGGAAGCAGTATGAGGG + Intronic
1060459774 9:123839734-123839756 TTGTATTTGCACAAGAATGAGGG - Intronic
1060917905 9:127402280-127402302 TTATGTAGCCACAAAAATGAAGG - Intronic
1188468378 X:30508644-30508666 TTGTGTAGATACCAGAAAGGGGG + Intergenic
1189573219 X:42321911-42321933 TTGTGTAGGCTCAAGAAGGTGGG + Intergenic
1193187574 X:78531037-78531059 ATGTGTAGGTTCAGGAATCAAGG + Intergenic
1193569554 X:83126152-83126174 TTGTGTAGGTAAGGAAATGAAGG - Intergenic
1194874147 X:99164924-99164946 TTGGGTAGGTAAAAGAAAAAGGG + Intergenic
1195353641 X:104017782-104017804 TTGTGGATGTACAAGAGTGCTGG + Intergenic
1199265353 X:145821220-145821242 TTGTGTAGGTGAGAGAAAGAGGG + Exonic
1199452886 X:147993418-147993440 TTGTGAGGGTAAAAGAAGGAAGG - Intronic