ID: 1005423129

View in Genome Browser
Species Human (GRCh38)
Location 6:25673307-25673329
Sequence CTGGAGGGTCTGGTTTAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 160}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005423129_1005423141 6 Left 1005423129 6:25673307-25673329 CCCCCTTAAACCAGACCCTCCAG 0: 1
1: 0
2: 1
3: 8
4: 160
Right 1005423141 6:25673336-25673358 ATCAGAAAGGGTGCAGTATGTGG No data
1005423129_1005423142 10 Left 1005423129 6:25673307-25673329 CCCCCTTAAACCAGACCCTCCAG 0: 1
1: 0
2: 1
3: 8
4: 160
Right 1005423142 6:25673340-25673362 GAAAGGGTGCAGTATGTGGCTGG 0: 1
1: 0
2: 0
3: 17
4: 207
1005423129_1005423138 -7 Left 1005423129 6:25673307-25673329 CCCCCTTAAACCAGACCCTCCAG 0: 1
1: 0
2: 1
3: 8
4: 160
Right 1005423138 6:25673323-25673345 CCTCCAGGGCAGAATCAGAAAGG 0: 1
1: 0
2: 0
3: 25
4: 209
1005423129_1005423139 -6 Left 1005423129 6:25673307-25673329 CCCCCTTAAACCAGACCCTCCAG 0: 1
1: 0
2: 1
3: 8
4: 160
Right 1005423139 6:25673324-25673346 CTCCAGGGCAGAATCAGAAAGGG 0: 1
1: 0
2: 1
3: 23
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005423129 Original CRISPR CTGGAGGGTCTGGTTTAAGG GGG (reversed) Intronic
900313615 1:2046610-2046632 CTGCAGGGTCTGGCTGAGGGTGG - Intergenic
902917225 1:19646020-19646042 CAGGAGGGTCTGCGGTAAGGAGG + Intronic
904310112 1:29623676-29623698 CTGCAGGGTATGGTTTAGAGGGG + Intergenic
904454130 1:30636694-30636716 ATATAGGGTCTGGTTTATGGAGG + Intergenic
904465873 1:30707273-30707295 ATGGAGAGTCTGCTGTAAGGCGG - Intergenic
907406528 1:54257006-54257028 GTGGAGGGGCAGGTTTAACGTGG - Intronic
909654289 1:78013295-78013317 CTGGAGGATCTTGTTTGAGGCGG - Exonic
911101979 1:94102487-94102509 ACGGAGGGGCAGGTTTAAGGGGG - Intronic
915259568 1:154666819-154666841 TTAGAGGGTCTGGGTTAAAGTGG - Intergenic
916744465 1:167674179-167674201 GTGAAGGGTCTGGCTTGAGGGGG - Intronic
917130944 1:171741863-171741885 CGGGAGGGGCTGGTGTGAGGAGG - Intronic
917135465 1:171784527-171784549 CTGGAGGGGCTGGCTTACAGGGG + Intronic
918201733 1:182273863-182273885 CTGGAAGATATGGTTGAAGGTGG - Intergenic
919751343 1:201040066-201040088 CTGCAGGCTCTGGTTCGAGGGGG - Exonic
920366036 1:205448858-205448880 AAGGAGGGTCTGGGTAAAGGAGG + Intronic
922131694 1:222786708-222786730 CTGGAGAGTAGGTTTTAAGGAGG - Intergenic
1067552615 10:47246225-47246247 CTGAAGGGTGTGGTGTAAGTGGG - Intergenic
1068057565 10:52029893-52029915 CAGGAAGGTCAGGTTTAAGCTGG - Intronic
1072488576 10:95880373-95880395 CTCCAGGGTCTGGTTCATGGAGG + Intronic
1073584632 10:104697875-104697897 GTGAGGGGTCTGGTTTAATGAGG + Intronic
1076471928 10:130725039-130725061 CTGGAGGGGGTGGGATAAGGTGG - Intergenic
1076820002 10:132933568-132933590 CTGGTGGGTCTGTTTTTGGGAGG - Intronic
1076908697 10:133376962-133376984 CTGGAAGGCCTGGTGCAAGGAGG - Intergenic
1077134021 11:989785-989807 GTGGATGGTGGGGTTTAAGGGGG + Intronic
1079031807 11:16991786-16991808 CTGGAGGGACTGTTTAATGGTGG - Intronic
1083406118 11:62458431-62458453 CGGGAGAGTCTGGTGTAAGCTGG + Intronic
1083533347 11:63445797-63445819 CTGGAGGATCTGCTTCAAGATGG + Intergenic
1084340819 11:68499299-68499321 CTGGAGGATCTGTTCTAAGGTGG + Intronic
1084350009 11:68589968-68589990 CTGCAGGGTCTGGTGTGAGGTGG - Intronic
1084432700 11:69120361-69120383 CTGGTGGGGCTGGTGTGAGGAGG + Intergenic
1086415574 11:86586117-86586139 CTAAAGGGGGTGGTTTAAGGTGG + Intronic
1088826408 11:113497946-113497968 CTGGAGGATCTGCTTTGAAGGGG - Intergenic
1089453868 11:118614487-118614509 CTGGTGTGACTGGTTTAGGGTGG + Intronic
1089689669 11:120179442-120179464 GGGGAGGGTCTGATTTAATGAGG - Intronic
1090238029 11:125164088-125164110 CCGGGGTGTCTGGTTCAAGGTGG - Intergenic
1090443037 11:126740001-126740023 CTGGAGGGTAGGGTGTATGGAGG + Intronic
1091091265 11:132773291-132773313 ATGGAGGGTTTGATTTGAGGAGG + Intronic
1097880242 12:64680195-64680217 CGGGAGGGTCTTTTTTAAAGGGG + Intronic
1101001771 12:100364100-100364122 CTGGATGGTGTGGTATATGGTGG + Intronic
1106076269 13:26464018-26464040 CTGGAAGGTGTGGTTCAAGAAGG - Intergenic
1106404211 13:29459627-29459649 CTGGAGGGTCTGGAGTGAGAGGG + Intronic
1107374923 13:39793989-39794011 CTGGAAGGTATGGTTGAATGAGG - Intergenic
1110552637 13:76826107-76826129 CTGAATGGTCTGCTTTAAGCGGG + Intergenic
1110717822 13:78727909-78727931 CTAGAGGGTCTCATATAAGGAGG - Intergenic
1112723927 13:102280337-102280359 CTGGAGAGACTGTTTTAAGTGGG + Intronic
1113869711 13:113551761-113551783 CTGGAAGGTCTGGATGAAAGAGG - Intronic
1115925675 14:38430882-38430904 CTGGAGGGTTTGCTGCAAGGAGG - Intergenic
1116409488 14:44604816-44604838 CTGGAGGATCTACTTTCAGGTGG + Intergenic
1119675714 14:76552047-76552069 CTGGAGTGTCTGGGTTGTGGTGG - Intergenic
1121016945 14:90554618-90554640 CTGGAGGGGCTGGTTTGCTGTGG + Intronic
1126818796 15:52480713-52480735 TTGGAGAGTGTGGTATAAGGAGG + Intronic
1128040112 15:64564436-64564458 CTGCTGGGTCTTATTTAAGGTGG + Intronic
1128231051 15:66035557-66035579 TTGGAGGGTGTGGTTCATGGTGG - Intronic
1128849123 15:70933727-70933749 CTTGGGGTTCTGGTTTAGGGTGG + Intronic
1130077638 15:80703364-80703386 GTGAAGTGTCTTGTTTAAGGGGG - Intronic
1130960074 15:88653330-88653352 CTGGAGGGTCTTAGTCAAGGAGG + Intronic
1131527865 15:93166960-93166982 CTGGGAGCTCTGGTTGAAGGTGG - Intergenic
1136242409 16:28952170-28952192 CTGGAGGGTAGAGTTTCAGGAGG - Exonic
1137595030 16:49717783-49717805 CTGGAGGGAGTGGTTCAGGGAGG - Intronic
1139062058 16:63264127-63264149 CTGGAGGCCCTGGTGGAAGGGGG + Intergenic
1146789575 17:35743688-35743710 CTGGAGGGTTTGGGGTTAGGTGG - Intronic
1148548192 17:48532589-48532611 CAGGTGGGACAGGTTTAAGGAGG + Intergenic
1149228586 17:54505142-54505164 CCGAGGGGTCTGTTTTAAGGTGG - Intergenic
1150100059 17:62415484-62415506 CTGGAGTGTCAAGTTTAAAGTGG - Intronic
1150221511 17:63498005-63498027 TTGGAGGGCCTGCTTCAAGGAGG + Intronic
1150241461 17:63636934-63636956 CTGGACGGGCTGGTCTAGGGGGG + Intronic
1150819744 17:68425653-68425675 CTGGAGGGGATGGTTTCAGAGGG - Intronic
1152989166 18:347106-347128 CTGGAGGGTTTTGTTTACAGTGG + Exonic
1153750780 18:8228114-8228136 GTGGAGGGTGTTGTTTCAGGAGG + Intronic
1154198850 18:12285374-12285396 CTGGAGTGCCTGGGTTATGGGGG + Intergenic
1160316575 18:77853566-77853588 CTGAGTGGTCTGGTTTAAGAAGG - Intergenic
1160343851 18:78113178-78113200 ATGTAGGGCCTGGTTTAAGGAGG - Intergenic
1160755484 19:754939-754961 GAGGAGGGTCTGGTTTGGGGTGG + Intronic
1160941220 19:1621332-1621354 CTGCAGAGGCTGGTTTCAGGGGG - Intronic
1161216537 19:3097449-3097471 CAGGAGGGTCTCGTTTATGTGGG + Intronic
1165681314 19:37778780-37778802 GTGGAGGGTATTGTGTAAGGAGG - Intronic
1167611404 19:50509516-50509538 GTGGAGAGTCTGGTTTGAGGGGG + Intronic
1167709410 19:51100689-51100711 CTGGAGGCTCTGGGGCAAGGGGG - Intronic
925123578 2:1438033-1438055 CTGGAGGGCCTGGGTGGAGGAGG + Intronic
925905873 2:8539501-8539523 TGGGAGGGTCTGGTTAGAGGAGG - Intergenic
930110389 2:47674144-47674166 CTTTAGGGTGTGGTCTAAGGTGG - Intergenic
931151179 2:59575130-59575152 CTGGAGGGTTAGGGTTAGGGAGG + Intergenic
931697149 2:64879813-64879835 CTGGAGGGACTGGCCTTAGGTGG + Intergenic
936519855 2:113204851-113204873 CTGGAGGGTCGGGGTGAGGGGGG + Intronic
936881866 2:117262737-117262759 CTGGAGAGTCTGGTTTACTAAGG - Intergenic
937013127 2:118579588-118579610 CTGGAGAGTTTGGTTGAAGGGGG + Intergenic
940561578 2:155304038-155304060 CTGGAGGGGCTGGGTAGAGGTGG - Intergenic
944915820 2:204359194-204359216 CTGCAGGGTCTGTTTCTAGGGGG + Intergenic
944948712 2:204721406-204721428 CTGGAGGGGCTCTTTTAAAGTGG + Intronic
946277698 2:218643497-218643519 CAGGAGGGACTGGGTCAAGGTGG + Exonic
947593690 2:231398351-231398373 CTTGAGGGTCAGGTTGAAGAAGG - Exonic
1171396185 20:24835296-24835318 CTGGAGGGGCTGGCATAAGCTGG + Intergenic
1172358672 20:34297200-34297222 GTGGAGGGTCGGGTTTAATTGGG - Intronic
1173663709 20:44751132-44751154 CTGGAGGGTCGGCTCTGAGGTGG - Exonic
1175998348 20:62821263-62821285 CTGGAGAGTCTGGTCTAAATGGG + Intronic
1176170098 20:63692890-63692912 CTGCAGGGCCTGGGTGAAGGTGG - Exonic
1176236599 20:64056451-64056473 CTGGAGGGTCTGATGGAAAGGGG + Intronic
1178682755 21:34686834-34686856 GTGGATGGTCTGGTCTGAGGGGG - Intronic
1179481325 21:41680552-41680574 CGGGAGGCCCTGGTTAAAGGAGG - Intergenic
1179556676 21:42182988-42183010 CTGGAGGGTCAGGAGTGAGGTGG - Intergenic
1183718179 22:39546541-39546563 CTGGAGGGTCAGGATGCAGGGGG + Intergenic
1184102602 22:42348696-42348718 AGGGAGGGCCTGGTGTAAGGGGG + Intergenic
1185234677 22:49704988-49705010 CTGGCGGGGCTGGTCTAGGGTGG + Intergenic
1185328036 22:50237130-50237152 CTGCAAGGGCTGGGTTAAGGCGG - Intronic
949918575 3:8984172-8984194 CTGGAGGGAGTGGGTGAAGGGGG + Exonic
949961431 3:9315351-9315373 CTAGAGTGATTGGTTTAAGGAGG - Intronic
954114403 3:48457579-48457601 CTGGAGGATCTATTTCAAGGTGG + Intronic
954760588 3:52870891-52870913 CTGGAAGGTCTGGGGGAAGGCGG + Intronic
956183001 3:66534717-66534739 ATGGTGGGTGTAGTTTAAGGAGG + Intergenic
967939272 3:194753879-194753901 CTGGTGGCTCTGGGTTAAGAAGG + Intergenic
968403147 4:316154-316176 TGGGAGGGGCTGGGTTAAGGTGG - Intergenic
970137669 4:12943708-12943730 TTTGAGGGTCTGGATTAGGGTGG + Intergenic
974172435 4:58283033-58283055 TGGGAGGGTCTGGTTTAAACAGG + Intergenic
974386171 4:61202949-61202971 CTGGAAAATCTGGTTTGAGGAGG + Intronic
975556690 4:75672809-75672831 CTGGAGGGGATGTTTTAGGGTGG - Intronic
976074786 4:81285249-81285271 CTGGAGGGGGTGGTTATAGGAGG - Intergenic
976105590 4:81613719-81613741 CTGAAGTGTTTGGTTTAAAGGGG - Intronic
976943054 4:90730001-90730023 CTGGAAGGTATGCTTTTAGGAGG - Intronic
977556903 4:98496029-98496051 CAGTAGGATCTGGTTTATGGAGG - Intronic
978761450 4:112358825-112358847 CTGCAGGGCCTGGGTGAAGGTGG - Intronic
987246568 5:16054952-16054974 CTGGAGGGTCGTTATTAAGGTGG + Intergenic
987284251 5:16440204-16440226 CTGAAGGGCCTGGGTTAAGAAGG - Intergenic
989245437 5:39249151-39249173 CTGGAGTGTAAGGTTTAAGGGGG + Intronic
991262418 5:64681225-64681247 CAGCAGGGTCTGTTTAAAGGTGG - Intergenic
993637320 5:90360300-90360322 TTGGGGGATCTGGTTTAAGGTGG + Intergenic
998017681 5:138745596-138745618 CTGGAGGGTCTGGGTGGAGCAGG + Intronic
999291442 5:150428917-150428939 CTGGTGGGGCTGGTTTCTGGTGG + Intergenic
999424839 5:151478265-151478287 CATGAGGGTCTGGTTTAAGGTGG + Intronic
1001196310 5:169676395-169676417 GAGGAGGGGCTGGTTTAGGGAGG - Intronic
1001398123 5:171431154-171431176 CTGGATGCTCTGGTGTGAGGTGG + Intronic
1001633046 5:173190831-173190853 CTGGAGGGAATGGATTCAGGTGG + Intergenic
1003425879 6:5997854-5997876 GAGGAGGGTCTGCTTGAAGGTGG + Intergenic
1005423129 6:25673307-25673329 CTGGAGGGTCTGGTTTAAGGGGG - Intronic
1007526763 6:42502779-42502801 CTGAAGGCTCTAGTTTCAGGTGG - Intergenic
1007745250 6:44039541-44039563 GTGAAGGGTCTGGTTGAAGATGG - Intergenic
1007767645 6:44170399-44170421 CTGGAGGGTCTGCTCCTAGGAGG + Intronic
1010378679 6:75203374-75203396 CAGGAGGGTCAGGTTTCAGCTGG - Intronic
1013784645 6:113765788-113765810 CTGGAGGATCTGTTTTATGATGG - Intergenic
1017805205 6:157939874-157939896 CTGGAGGGTTTGGGAGAAGGCGG + Intronic
1018792263 6:167157598-167157620 CTGGAGGCTCAGGTAGAAGGCGG + Exonic
1021302937 7:18994477-18994499 CTAGAGTGTCTGGGATAAGGAGG - Intronic
1022046927 7:26629034-26629056 CTGGAGCATCTGTTGTAAGGTGG + Intergenic
1022443941 7:30454925-30454947 CTCGATGGTCTGGTTTATAGAGG - Intronic
1023194655 7:37622007-37622029 CAGGAGGATCAGGTTTGAGGAGG - Intergenic
1024897884 7:54281445-54281467 CTGGAGGGTTTGGGGTAACGTGG - Intergenic
1031157756 7:118130109-118130131 TTGGAGAGTCTAGTTTATGGTGG - Intergenic
1031224197 7:119013799-119013821 CTGCAGAGTATGTTTTAAGGAGG + Intergenic
1031779040 7:125939559-125939581 CTGGAGGGTCTGGAGGATGGTGG - Intergenic
1031976308 7:128095675-128095697 CGGGAAGGGCTTGTTTAAGGGGG + Intergenic
1032029192 7:128468317-128468339 CTGGAGTGTCAAGTTTAAAGTGG - Intergenic
1035917383 8:3639554-3639576 CTGGATGGTCTGGTTGAGGCAGG - Intronic
1036535377 8:9645178-9645200 CAGAAGGATCTGGTCTAAGGAGG + Intronic
1039004094 8:33014344-33014366 TTAGAGGGTCTGGTATAGGGAGG - Intergenic
1040871706 8:52106430-52106452 TTGAGGGGTCTGGCTTAAGGAGG + Intergenic
1045427240 8:102079239-102079261 CTGCAGTGTCTGGTCTAAGTTGG - Intronic
1046820684 8:118631282-118631304 CTGGAGGATCTGCTCCAAGGTGG + Intergenic
1048161352 8:132024682-132024704 CTTGAGGCTTTGGTTAAAGGAGG + Exonic
1051904004 9:22074371-22074393 CTGCAGGACTTGGTTTAAGGGGG + Intergenic
1052352417 9:27470949-27470971 CTGGCGGCTCTGGTAGAAGGTGG + Intronic
1059471349 9:114506649-114506671 CTGGAGGATTTGGTTTGTGGTGG + Intergenic
1060044415 9:120328398-120328420 CTGGAAGGACTGGGTTAAAGGGG - Intergenic
1061025742 9:128048194-128048216 CTGGAAGGTGTGGTTTCAGTGGG + Intergenic
1061485969 9:130920686-130920708 CTGGCCTATCTGGTTTAAGGAGG - Intronic
1062704117 9:137925339-137925361 CTGAATGGTCTGTTTAAAGGAGG + Intronic
1189636177 X:43012145-43012167 CTGGAGAGTGGGGATTAAGGTGG + Intergenic
1194018426 X:88656822-88656844 CTGGATGGTCTGGTCTCAGTGGG - Intergenic
1196007840 X:110854332-110854354 CTGGTGTGTCTGGTGTAAGCAGG + Intergenic
1196118413 X:112022063-112022085 CTAAAGGGTCTGGTTTCAGCAGG + Intronic
1197252899 X:124233572-124233594 CTGGAGGGGCTGTGTTGAGGCGG - Intronic
1200149642 X:153944860-153944882 CCGGAGGGTCTGGGATGAGGGGG + Intergenic