ID: 1005423301

View in Genome Browser
Species Human (GRCh38)
Location 6:25675158-25675180
Sequence TCCCTTTGTTGAGGGAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 24, 2: 39, 3: 37, 4: 187}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005423301 Original CRISPR TCCCTTTGTTGAGGGAGTGC TGG (reversed) Intronic
900240322 1:1614200-1614222 TCCATTTGTTTAGGGATTGGTGG - Intergenic
901637162 1:10675796-10675818 TCCCTTTGTTGGGGGTGGGGGGG - Intronic
901929495 1:12587926-12587948 TCCTGTTGTTGAGTGAGTGAGGG + Intronic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
905210810 1:36372933-36372955 TGCCTTTGTGGATGGAGAGCAGG - Intronic
905933147 1:41803791-41803813 TCCCCTTGTTGAGGGATCACGGG + Intronic
907173027 1:52489009-52489031 TTACTTTGTAGAGTGAGTGCAGG - Exonic
910636091 1:89409629-89409651 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
914762680 1:150611754-150611776 CCCCTTCCTTGAGGGTGTGCTGG - Intronic
914927950 1:151905650-151905672 TCCTTTTGTTGAGGGAGTGCTGG - Intronic
915054964 1:153119856-153119878 TCCCTGTGTTGAAAGAGTGCTGG + Intergenic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
916032379 1:160889091-160889113 TCCCATTGTTGAGGGAGAAGAGG - Intergenic
916527883 1:165628825-165628847 TCCCTATGTGGAGGGAGTGCTGG + Intergenic
919167123 1:193909663-193909685 TTCTTTTGGTCAGGGAGTGCTGG - Intergenic
920305464 1:205015544-205015566 TCCCCTTGTGCAGGGAGAGCTGG - Intronic
924920313 1:248622018-248622040 TCCGTTTCTTGATGGGGTGCGGG + Intergenic
1062989253 10:1800160-1800182 TCCCATTGAGGAGGGAGTGAGGG + Intergenic
1067771231 10:49127710-49127732 TCCCTTTGTTGTGGGGTTGGGGG + Intergenic
1067991730 10:51221773-51221795 AGCCTTTGTTGAGGCACTGCTGG - Intronic
1068389132 10:56370462-56370484 TCCTAATGTTAAGGGAGTGCTGG - Intergenic
1068892128 10:62159019-62159041 GTCCTTTGTTGAGGGATGGCTGG - Intergenic
1069449098 10:68501841-68501863 TACTTTTGTAGAGGGAGTGAGGG - Intronic
1070024263 10:72616873-72616895 TCCCTTAATTGAGGGAGTCTGGG - Intronic
1070503908 10:77096455-77096477 TGGCTTTTTTGAGGGAGTGTGGG - Intronic
1073204063 10:101759472-101759494 TCCCTTGGCTGAGCGGGTGCAGG + Intergenic
1073390776 10:103174572-103174594 TTCTTTTTTTGAGGGAGTGCTGG - Intronic
1073803894 10:107074199-107074221 GCCCGGTGTTGGGGGAGTGCAGG - Intronic
1074448201 10:113537771-113537793 TGCCTGGGTTGAGGGAGGGCAGG - Intergenic
1075161635 10:120029578-120029600 TCTCTCTGTTGAGGCAGGGCAGG - Intergenic
1075444196 10:122502561-122502583 TCCCTCTGTTGAGAGACTTCTGG + Intronic
1076836001 10:133021220-133021242 GCCCTGGGTTGAGGGAGGGCTGG + Intergenic
1077001109 11:322757-322779 TCCCTGTGTTAAGGGAGTGCTGG + Intronic
1079816964 11:25073398-25073420 TCCCTGTGTGGAGGAAGTGCTGG + Intronic
1080964342 11:37196561-37196583 ACCCTTTGTGGAGGCAGTGAGGG - Intergenic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1081731061 11:45371986-45372008 TCTAGTTGTTGAGGAAGTGCTGG - Intergenic
1082960885 11:58917796-58917818 TCCCTTTGTGGAGGGAATGCTGG + Intronic
1087032212 11:93717008-93717030 TCCCTATGTTGAAGGAGTGCTGG + Intronic
1087465620 11:98500971-98500993 CCCCTTTGTAGAGAGGGTGCTGG + Intergenic
1087871257 11:103295458-103295480 TCCCTAAGTTGAGGGAGTGCTGG - Intronic
1090865818 11:130699576-130699598 TCCCTTTGTTGTGGGTCTGATGG + Intronic
1091108109 11:132942090-132942112 TCCCTTTAATGAGGCAGTTCTGG - Intronic
1091353598 11:134916698-134916720 TCCCTTTCTTGAGGAAGTCGAGG + Intergenic
1091705678 12:2691505-2691527 TCCTTTTGGTGAGGGCGCGCGGG - Intronic
1092355503 12:7791600-7791622 TCCCTTTGTTATGTGACTGCAGG + Intronic
1092640001 12:10495153-10495175 TCCCTTTTTTTGGGGGGTGCTGG - Intergenic
1093032967 12:14305624-14305646 TCCCTTTGTTGTTTTAGTGCTGG + Intergenic
1094202787 12:27810344-27810366 GGGCTTTGGTGAGGGAGTGCAGG + Intergenic
1094348151 12:29494392-29494414 TACCTGTGTTGAGAGAGTGTTGG + Intronic
1095536055 12:43248984-43249006 TCCATTTGTTAAGAGAGTGATGG - Intergenic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097489084 12:60241847-60241869 TCTCTTTCTTCAGGAAGTGCTGG - Intergenic
1098122482 12:67256595-67256617 TCCCTTGGTGGAGGGAGCACAGG - Intergenic
1098405580 12:70122983-70123005 TCCCTCTGTGGATGGGGTGCTGG - Intergenic
1099799190 12:87435728-87435750 TTACTTTGTTGAGTGAGTGCTGG - Intergenic
1103380153 12:120487940-120487962 TCCCTATGTTGAGGGAGTACTGG + Intronic
1104630546 12:130397758-130397780 TCTCTGTCTCGAGGGAGTGCGGG + Exonic
1104722585 12:131053205-131053227 TCACTGTGATGACGGAGTGCAGG + Intronic
1105005947 12:132720708-132720730 TGCCATTATTGAGGGAGAGCCGG - Exonic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1108337790 13:49463826-49463848 TCTCTATGTTGAGGGAGTGCTGG + Intronic
1108938005 13:55910277-55910299 TCCCATTGATATGGGAGTGCTGG - Intergenic
1109156248 13:58913640-58913662 TCCCTTTGTTCAGAGAAAGCAGG - Intergenic
1109404146 13:61875595-61875617 TCGCTATGTTGAGGGAATGCTGG + Intergenic
1109487402 13:63045043-63045065 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1109997975 13:70154684-70154706 TCTCTTTGTTGAGGGATTGCTGG - Intergenic
1113987242 13:114328036-114328058 TGCCTCACTTGAGGGAGTGCTGG + Intergenic
1114895921 14:26991305-26991327 TTCCTTTCTGGAAGGAGTGCAGG + Intergenic
1115632613 14:35260406-35260428 TCCTTATGTTGAGGGAGTACTGG - Intronic
1116395984 14:44449209-44449231 TCCTTATGTTGAGGGAGTGTTGG + Intergenic
1117477966 14:56116914-56116936 TCCCTTTAGTGAAGGAGTGCTGG + Intergenic
1118693907 14:68365004-68365026 TAGCTTTGGTGAGGGAGTGAAGG + Intronic
1119234101 14:73005266-73005288 TCCCTTTGATGAGGGAAGGAAGG + Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1122299262 14:100722814-100722836 TCCCTGTGTTGAGGGCTTACAGG - Intergenic
1122647539 14:103205378-103205400 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123218635 14:106836579-106836601 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123220007 14:106845812-106845834 TCCTTATGCTGAGGGAGTGCTGG + Intergenic
1123986246 15:25648909-25648931 TCCATTTCTTGAGGGCCTGCAGG - Intergenic
1127627332 15:60793011-60793033 TCTCTCTTTTGAGGGAGTGGTGG - Intronic
1128600568 15:68992161-68992183 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1129556211 15:76512548-76512570 TCCCATTGTGGAGGGTCTGCAGG - Intronic
1129981769 15:79878709-79878731 TCCCTATGTGGAGGGAGTGGTGG + Intronic
1135636483 16:24080099-24080121 TCACTTTGGTGGGGGAGTGAAGG + Intronic
1136878742 16:33885410-33885432 TCCCTTTGTTGGGGAGGTGGGGG + Intergenic
1137575140 16:49594384-49594406 TCCCTCTGTTGAGAGAGGCCTGG - Intronic
1139043460 16:63028980-63029002 TCCCTTAGTGGAAGGAATGCTGG - Intergenic
1139736212 16:68991113-68991135 TCCCTCTGTTGAGGCTGTGTTGG + Intronic
1140218678 16:73028125-73028147 TCCTTTTTTTGGGGGAGTGTGGG + Intronic
1141764939 16:86052020-86052042 TGCTTGTGTTGAGGGTGTGCAGG + Intergenic
1142534457 17:604856-604878 TCCCTTTGTTGAGTGGATGAGGG - Intronic
1143131269 17:4678994-4679016 TCCCTCTGTTGAGGGTGTTGAGG - Intronic
1143272046 17:5683073-5683095 TCTCTTTGTGGAAAGAGTGCTGG - Intergenic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1145361109 17:22213165-22213187 TCCCAATGTTGAGGGAGTGCTGG - Intergenic
1146387349 17:32389070-32389092 TCCCTCTCTTGAGGGGGAGCTGG - Intergenic
1148335478 17:46838047-46838069 CCCCTGTGTTGAGGGGGTGGAGG + Intronic
1151923513 17:77175701-77175723 TCCCTGTGTTGAGGGAGTGCTGG + Intronic
1152302521 17:79503673-79503695 TCCCTTGGTTGTGGGGCTGCAGG - Intronic
1203165616 17_GL000205v2_random:90264-90286 TCCCTGTGTTGGGGGAGTGTTGG + Intergenic
1153834706 18:8953561-8953583 TACCTTTGTTGAAGGATTCCAGG - Intergenic
1155732701 18:29180717-29180739 TCCGTATGTTGAGGGAATGCTGG + Intergenic
1155823518 18:30408708-30408730 TCCCTATGTTTAGGAAGTGCTGG - Intergenic
1156497610 18:37536419-37536441 TCCCTTTTAGGAGGGAGTGGGGG - Intronic
1157358154 18:46954084-46954106 TCCCTTTCTTCAGGTAGTCCAGG + Intronic
1159054777 18:63452762-63452784 TCCCTATGTTGAAGGAGTGCTGG - Intergenic
1160786263 19:901384-901406 TCCCCGTGTGGAGGGAGTGAGGG + Intronic
1163319853 19:16568250-16568272 TCCCTTTGCTGAGGGAGGAGAGG - Intronic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1163424716 19:17235164-17235186 GCCCTTTGGTGAGGGAGTAGGGG + Intronic
1163680956 19:18682306-18682328 TCCCTCTCTTGAGGGAGGGAGGG + Intergenic
1164044060 19:21519279-21519301 TCCCTATGTTGAGGGAATGCTGG - Intronic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164778017 19:30869491-30869513 CCCTTTTGTTGCAGGAGTGCAGG - Intergenic
1165046493 19:33108768-33108790 TCCCATTGGTGAGGGCTTGCTGG + Intronic
1165638722 19:37365635-37365657 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1166246812 19:41534199-41534221 TCCCTACATTGAAGGAGTGCTGG + Intergenic
1167254819 19:48420948-48420970 ACCGTTTGTTGAGGGACTGGTGG + Intronic
1167496281 19:49820597-49820619 TCTCTATGTTGAGGGAGTGCTGG + Intronic
926046079 2:9710673-9710695 TCGCTTTGTTGCCGAAGTGCTGG + Intergenic
927132717 2:20073982-20074004 TCCCTATGTTGAGGGAGGGCTGG - Intergenic
927524549 2:23725344-23725366 TTCCTTTGTTGATGAAGTCCAGG - Intergenic
932272683 2:70424657-70424679 TCCCTTTGCTGAGCATGTGCTGG + Intergenic
932651349 2:73561334-73561356 TCCCTGTGTTGAAGGAGTGCTGG + Intronic
933083890 2:78030079-78030101 TCCTTATGTTGTGGGAGTGCTGG + Intergenic
933532744 2:83531092-83531114 TCCCTCTGTAGAGGGAGTGCTGG - Intergenic
935855173 2:107265924-107265946 ACCTTTTGTTGAAGGAGGGCAGG + Intergenic
937935525 2:127240953-127240975 TCACTTTGTTGAGTGAGCCCAGG - Intergenic
938251684 2:129820777-129820799 TCCCTGTGTTGAGGGAGTCCTGG + Intergenic
941842493 2:170101432-170101454 TACTTTTATTTAGGGAGTGCTGG - Intergenic
943652099 2:190468401-190468423 TCCCTTTGTTGATTCAGTGTTGG + Intronic
944278912 2:197871888-197871910 TCCCTTTGTAGAGGGTGTAAAGG - Intronic
945115970 2:206408529-206408551 TTCCATTGTTGAGAGAGGGCAGG - Intergenic
945683785 2:212944628-212944650 TCCATTTGTTCAGTGAGTACCGG - Intergenic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
949052890 2:241906714-241906736 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1168954531 20:1825860-1825882 TAGCTTTGTAGAGGGAGGGCAGG + Intergenic
1171333781 20:24364530-24364552 TAGCTTTGTTGAGGGAGGGAGGG + Intergenic
1173679081 20:44863619-44863641 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
1175039414 20:56032861-56032883 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1176406138 21:6368815-6368837 TCCCTGTGTTGGGGGAGTGTTGG - Intergenic
1176687636 21:9865287-9865309 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
1177016624 21:15797569-15797591 TTCCTTTGGTGTGGGTGTGCTGG - Intronic
1178677204 21:34641340-34641362 TTTCTATGTTGAGGGAGTGCTGG - Intergenic
1179776915 21:43670567-43670589 TGCCTCTGTAGAGGGAGAGCAGG + Intronic
1180894164 22:19316210-19316232 TCCTTATGTGGAGGGAGTGCTGG - Intergenic
1182144240 22:27987377-27987399 TCCCTTTGGTGTGGGGGTGGTGG - Intronic
1183293197 22:37015321-37015343 TCCCTTCTTGGAGGGAGTGAGGG - Intronic
1183716257 22:39535249-39535271 ACTCTTTGTTAAGGGATTGCTGG - Intergenic
950206148 3:11082692-11082714 TCCCTTTGTTGAGAGATCTCAGG - Intergenic
950216336 3:11162345-11162367 TCTCCTTGGTGGGGGAGTGCGGG + Intronic
951087259 3:18528006-18528028 TCCCCTTGCTGTGGGACTGCTGG + Intergenic
951526294 3:23656233-23656255 CCCCTTAGGTGGGGGAGTGCGGG + Intergenic
952107110 3:30083634-30083656 TCCTTCTGGTGAGGCAGTGCTGG - Intergenic
953079513 3:39602743-39602765 TGGCTTTGTTGAGGGTGAGCAGG - Intergenic
955056465 3:55459976-55459998 GCCCTTTGTTGGGTGGGTGCTGG + Intergenic
955433015 3:58870089-58870111 TCCCCTTGTAGAGGGAGGGAGGG - Intronic
957239067 3:77635007-77635029 TCCCTTCGATGAGGCAATGCTGG - Exonic
958487660 3:94732327-94732349 TCCATTTGATGATGGAATGCTGG + Intergenic
959247276 3:103888167-103888189 TCACTTTGTTATGGGAGTCCTGG + Intergenic
959961255 3:112302004-112302026 TCCCTGTGTTGAGGGGGTGCTGG - Intergenic
959962002 3:112308059-112308081 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
959962313 3:112312426-112312448 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
961305156 3:125953783-125953805 TCCCTCTGCTGAAGGAGGGCGGG + Intergenic
961317765 3:126052264-126052286 ACCCTATGTGGAGGGTGTGCAGG - Intronic
964691648 3:159456301-159456323 TCTCTATGTTGAGGGAATGATGG + Intronic
965390362 3:168096000-168096022 TCCCTTCGGGGAGGCAGTGCCGG + Intergenic
965850194 3:173013860-173013882 TCCCTAGGTTGAGGGAGTGCTGG + Intronic
966559002 3:181297858-181297880 TGCCTGTGTGGAGGGAGGGCAGG - Intergenic
970521045 4:16884064-16884086 TCCCTTTGTGGAGGGTGGACTGG - Intronic
971278853 4:25224407-25224429 TCCTTATGTTGAGGGAGTGCTGG + Intronic
972651754 4:41024631-41024653 TCCCTATGTTGAAGGAGGGCTGG - Intronic
974989277 4:69064290-69064312 TCCCTATGTTGAAGGAGTTTTGG - Intronic
975048777 4:69832919-69832941 TCTCTATATTGAGGGAGTGCTGG + Intronic
976135427 4:81931057-81931079 TCCATTGGTTGAGGCAGGGCAGG - Intronic
977919031 4:102623904-102623926 TTCATTTGTTGAGGGAATGCTGG - Intergenic
978533346 4:109736183-109736205 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
979679420 4:123443528-123443550 TCTCTTTTTTGAGGGGGTGGAGG - Intergenic
980350988 4:131683103-131683125 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
980484462 4:133437814-133437836 TGCCTTTGTGGAGGGTCTGCTGG - Intergenic
980822972 4:138040145-138040167 TCCATCTGATGATGGAGTGCTGG + Intergenic
981181801 4:141754962-141754984 TCCCTTTCTGAAGGGAGTTCTGG + Intergenic
982819281 4:159926446-159926468 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
984611139 4:181839554-181839576 TAGCCTTGTTGAGGGTGTGCAGG + Intergenic
984655748 4:182316586-182316608 TTCCTTTTTTGTGGGAGTGGGGG - Intronic
987369746 5:17182059-17182081 TTTCTTTGTTGAGTGAGTGAAGG - Intronic
987714867 5:21554904-21554926 TCCATGTGTTGAAGGAGTGCTGG + Intergenic
989758360 5:44983678-44983700 TTCTTATGTTCAGGGAGTGCTGG + Intergenic
992759559 5:79939455-79939477 TCCATATCTTGAGGGATTGCAGG - Intergenic
992793468 5:80234513-80234535 GCCCTTTGTGGTGGGAGTGGTGG - Intronic
993516411 5:88841249-88841271 TCCCAAAGTTCAGGGAGTGCAGG - Intronic
993923206 5:93832544-93832566 TTCCTTAGCTGTGGGAGTGCTGG + Intronic
995662351 5:114499533-114499555 GGCGTTTGTTTAGGGAGTGCTGG + Intergenic
996339035 5:122415822-122415844 TCCCTTTCTTGAGGAAATGTAGG - Intronic
1000645336 5:163754637-163754659 TCAGTTTGTGGAGGGAGTGTAGG - Intergenic
1001076146 5:168629452-168629474 TCACTTTGTTGTGGGACTGTGGG - Intergenic
1003213976 6:4091954-4091976 TCGCTATGTTGAGGGAGTGCTGG - Intronic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1003758626 6:9150230-9150252 TCCATTTGATGATGGAATGCTGG - Intergenic
1004603193 6:17170418-17170440 TCCCTGTGCTGAGGGAGTGAAGG + Intergenic
1005423301 6:25675158-25675180 TCCCTTTGTTGAGGGAGTGCTGG - Intronic
1006175300 6:32117734-32117756 CTTCTTTGTTGTGGGAGTGCTGG - Intronic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1007623042 6:43226393-43226415 CCCCTGTGTTGAGGGAAAGCTGG + Exonic
1011504960 6:88031282-88031304 TCCTTATTTTGAGAGAGTGCTGG - Intergenic
1012187476 6:96237314-96237336 TCCCTGTGTTGAGGGAAGGTGGG - Intergenic
1012990380 6:105919830-105919852 TCACTTTGTTTATGGCGTGCTGG + Intergenic
1013254035 6:108365858-108365880 TCTCTTTTTTGAGGGGGTGTGGG + Intronic
1015806968 6:137119458-137119480 TCCCAAGGTTGAGGGAGTGCTGG - Intergenic
1016551418 6:145284221-145284243 TCAGTTTGTCCAGGGAGTGCTGG + Intergenic
1017267686 6:152469079-152469101 GCCCTTTTTTGGGGGAGTGTGGG + Intronic
1018838355 6:167501649-167501671 TCACTATGTTGAGGGAGAGAAGG + Intergenic
1019897345 7:3992505-3992527 TCCCTGCATTGAGAGAGTGCAGG + Intronic
1021106129 7:16641781-16641803 TCCTTTTTTTGAGGGGGGGCTGG - Intronic
1021372048 7:19861284-19861306 TCCATTTGATGATGGAGTTCTGG + Intergenic
1022674064 7:32481929-32481951 TCCGTATGTTGAGGGAATGCTGG - Intergenic
1022814905 7:33904869-33904891 TCCCTTTCTTGGGGGAGCCCCGG - Intergenic
1024265225 7:47601229-47601251 TCCCTTTGCTGAAGGTCTGCAGG - Intergenic
1024325995 7:48109648-48109670 TCCCTTTGTTGAAGCTGTCCAGG + Intergenic
1024423614 7:49199979-49200001 TCTGTATGTTGAGGGAGTGCTGG - Intergenic
1026087704 7:67275995-67276017 TCCCTTTTTTTGGGGAGTGAAGG + Intergenic
1026748406 7:73030685-73030707 TCCCTTTTTTTGGGGAGTGAAGG - Intergenic
1026752054 7:73058830-73058852 TCCCTTTTTTTGGGGAGTGAAGG - Intergenic
1026755704 7:73086957-73086979 TCCCTTTTTTTGGGGAGTGAAGG - Intergenic
1027034608 7:74916000-74916022 TCCCTTTATTTGGGGAGTGAAGG - Intergenic
1027091697 7:75306433-75306455 TCCCTTTTTTTGGGGAGTGAAGG + Intergenic
1027095340 7:75334399-75334421 TCCCTTTTTTTGGGGAGTGAAGG + Intergenic
1027274497 7:76544228-76544250 TCCCTTTTTTTGGGGAGTGAAGG - Intergenic
1027324000 7:77033280-77033302 TCCCTTTTTTTGGGGAGTGAAGG - Intergenic
1029395448 7:100305129-100305151 TCCCTTTTTTTGGGGAGTGAAGG + Intergenic
1029720193 7:102358685-102358707 TCCCTTTTTTTGGGGAGTGAAGG - Intergenic
1032420450 7:131774991-131775013 TCTCTTTGCTGAGGAAATGCAGG + Intergenic
1032670497 7:134077950-134077972 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1033106294 7:138528335-138528357 TCCCCATGTTGGGGGAGTGCTGG + Intronic
1033714805 7:143989221-143989243 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
1034267073 7:149786232-149786254 TCCAATGGTTGAGGGAGGGCAGG - Intergenic
1034609337 7:152351579-152351601 TCCCTTTGTTGTGGGAAGTCAGG + Intronic
1034793005 7:153988536-153988558 ACCCTTTTTTGAGGGAGAGAGGG + Intronic
1035407186 7:158606882-158606904 TCCCTTTTGTGAGGCAGGGCTGG + Intergenic
1039193729 8:35006468-35006490 TCTTTTTGTTGAGACAGTGCTGG + Intergenic
1039500578 8:38013574-38013596 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1039948731 8:42152118-42152140 GCCCTTTGCTGAGGTGGTGCGGG - Intergenic
1040063497 8:43125013-43125035 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1041144600 8:54860664-54860686 GTTCTTTGTTGAGGGACTGCAGG + Intergenic
1041400856 8:57443210-57443232 TCCCTATGTTGCCAGAGTGCTGG + Intergenic
1041507350 8:58614285-58614307 TCCCTATGTTAAAGGAGTGCTGG - Intronic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1046658656 8:116924768-116924790 TCCCTGTGTTGAGGGAGTGCTGG + Intergenic
1047398826 8:124528798-124528820 TCCTTATGTTGAGGGAGTGCTGG - Intronic
1049524110 8:143112258-143112280 TCCATTTGTGGAGGGAACGCAGG + Intergenic
1049544608 8:143224192-143224214 TCCATTTGTGGAGGGAACGCAGG - Intergenic
1049581043 8:143411162-143411184 TCCCCTTGTTAAGTGAGGGCAGG + Intergenic
1052188008 9:25622067-25622089 TTCCTTTGTTAAGAGAGTGGAGG + Intergenic
1053186349 9:36019858-36019880 TCAATTTGTGGAGGGAATGCAGG + Intergenic
1053414928 9:37941500-37941522 TCCCTCTGTTGGGGGAGTCATGG + Intronic
1053781720 9:41616612-41616634 TCCCTATGTTGAGGGAGCGCTGG + Intergenic
1054169668 9:61826766-61826788 TCCCTATGTTGAGGGAGCCCTGG + Intergenic
1054667870 9:67754049-67754071 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
1055323362 9:75103640-75103662 TCCCTCTGTTGCTAGAGTGCTGG + Intronic
1055438871 9:76319640-76319662 TCCTTTTCTTGAGGGAGTCAGGG + Intronic
1055568239 9:77590346-77590368 TCACATTCTTGAGGGAGTACAGG + Intronic
1056578648 9:87874182-87874204 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1057083857 9:92191094-92191116 TCCTTTTGTTGCTGGAGTGGTGG - Intergenic
1057414048 9:94845728-94845750 GCCATTTGTTGAGGGAGGGCTGG + Intronic
1058453391 9:105117279-105117301 TCTCCTTGTTGAGTGAATGCAGG - Intergenic
1058840444 9:108902362-108902384 TCCCTTTGTTGGGAGTGTGATGG - Intronic
1060097519 9:120805362-120805384 TCCTGATGTTGAGGGAGTGCTGG + Intergenic
1061875434 9:133541195-133541217 ACCCTTTGTTGAGGACCTGCTGG + Intronic
1062188744 9:135234701-135234723 GCCCTTTGTTGAGGCAGCCCTGG - Intergenic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1187302693 X:18066291-18066313 TCCCTTAATTGAGGCAGTTCAGG - Intergenic
1190307732 X:49095107-49095129 TCCCTTTGCAGAGGGAAAGCTGG - Intronic
1190535046 X:51417646-51417668 TCCTTACGTTGAGGGAGTGCTGG + Intergenic
1191645369 X:63474910-63474932 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1192824502 X:74681346-74681368 TCCATTTGGTGATTGAGTGCTGG - Intergenic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1193809109 X:86030676-86030698 TCCCTCTGTAGAGGGAGTCATGG + Intronic
1197360224 X:125492637-125492659 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
1199240317 X:145540824-145540846 TCCATTTGATGATGCAGTGCTGG - Intergenic
1199440077 X:147857822-147857844 TCCCAATGTTGAGGGAGACCCGG - Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1201264905 Y:12196680-12196702 TCTGTATGCTGAGGGAGTGCTGG - Intergenic
1201428291 Y:13878603-13878625 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1202237472 Y:22728550-22728572 TCCCTGCGTTGAGGGTGTGCTGG - Intergenic