ID: 1005431536

View in Genome Browser
Species Human (GRCh38)
Location 6:25763174-25763196
Sequence CATGGTAGGCCAGATGTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 111}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005431536_1005431538 -7 Left 1005431536 6:25763174-25763196 CCTACAACATCTGGCCTACCATG 0: 1
1: 0
2: 0
3: 9
4: 111
Right 1005431538 6:25763190-25763212 TACCATGCCACCCAGTCCTCTGG 0: 1
1: 0
2: 1
3: 5
4: 126
1005431536_1005431543 6 Left 1005431536 6:25763174-25763196 CCTACAACATCTGGCCTACCATG 0: 1
1: 0
2: 0
3: 9
4: 111
Right 1005431543 6:25763203-25763225 AGTCCTCTGGTGACCACTCCAGG 0: 1
1: 0
2: 1
3: 15
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005431536 Original CRISPR CATGGTAGGCCAGATGTTGT AGG (reversed) Intronic
903689713 1:25164145-25164167 AAGGGTAGGCCCAATGTTGTGGG - Intergenic
905032088 1:34891840-34891862 CATCAGAGGCCACATGTTGTAGG + Intronic
905904189 1:41605947-41605969 AATGGTAGGACAGATGTGTTAGG + Intronic
906205261 1:43983258-43983280 CCTGGCAGGTCAGACGTTGTTGG - Intronic
908067266 1:60420422-60420444 CATGGTAGGCCAGCTGCTGATGG + Intergenic
912198358 1:107426457-107426479 TATGGAAGGTCAGAGGTTGTAGG + Intronic
912493632 1:110077230-110077252 CATGGTTGGCAAGTTGGTGTAGG + Intergenic
912555797 1:110515123-110515145 CATGATAAGCCAGCTGATGTGGG - Intergenic
916568333 1:166002779-166002801 CATAGAAGATCAGATGTTGTAGG + Intergenic
920844001 1:209578204-209578226 CATGGTAAGCCTGATATGGTTGG + Intergenic
922932203 1:229398748-229398770 CATGAAAGGCCACATATTGTAGG - Intergenic
923619300 1:235565021-235565043 CATGGTAGGAAAGAAGTTGCAGG - Intronic
924780596 1:247144032-247144054 GATGGTAGGGCAGATGCTGTGGG - Intronic
1064158514 10:12923521-12923543 CATAGGAGGCCAGAGGTGGTGGG - Intronic
1067081017 10:43212204-43212226 CCTGGGATGCCAGCTGTTGTTGG + Intronic
1069994170 10:72332479-72332501 CATGGCAGGCCTGAGGGTGTGGG + Intergenic
1071288717 10:84172778-84172800 CATGGTAGGCCAGGTCATGGTGG - Intergenic
1071548021 10:86543372-86543394 CATGGTCGGCCAGGTGCAGTGGG + Intergenic
1071828332 10:89347934-89347956 CATGGAAGGCCACATGGTGGGGG - Intronic
1076703023 10:132284067-132284089 CATGGTTGGTCAGAGGCTGTGGG - Intronic
1078370214 11:10738045-10738067 GAAGCTAGGCCAGATTTTGTAGG - Intergenic
1079182278 11:18204358-18204380 CATGGTAGTCCAGCTGCTGGTGG - Intronic
1079346571 11:19657638-19657660 CAGGGTAGACCAGATGTGGAGGG + Intronic
1085645280 11:78218599-78218621 CATGGCAGGACAGCTGCTGTGGG - Exonic
1091234983 11:134015628-134015650 CATGGTGGACTGGATGTTGTTGG - Intergenic
1091648854 12:2294532-2294554 CGCGGTAGGCCTGATGTGGTGGG + Intronic
1099746589 12:86711938-86711960 CAGGGCAGGACAGATTTTGTGGG - Intronic
1099747512 12:86724468-86724490 TATGGTAGGCCAGAGGAGGTAGG - Intronic
1100555736 12:95691906-95691928 CAGGTTAGGGCAGATGTTTTGGG - Intronic
1103719741 12:122966698-122966720 CCTGGTTGGCCAGATGTGGGAGG - Intronic
1104619776 12:130302263-130302285 CAGGATAAGGCAGATGTTGTGGG + Intergenic
1110184272 13:72655205-72655227 CTTGGTAGGCCATATGGTCTCGG - Intergenic
1112814423 13:103254872-103254894 CATGATAGACCAGAGGTTGAAGG - Intergenic
1119620475 14:76128094-76128116 CATTGTAGATCACATGTTGTGGG - Intergenic
1121499800 14:94425769-94425791 CATGGAAGACCAAATGCTGTAGG - Intergenic
1121795042 14:96727754-96727776 CATGGTTGGCCAGGCGTGGTGGG + Intergenic
1122321903 14:100860482-100860504 CAGGGTACGCCAGAAGTTGAGGG + Intergenic
1123023184 14:105411671-105411693 GATGGTAGCCCAGCTGGTGTCGG + Exonic
1124122798 15:26905316-26905338 CATGGAAGCCCAGAGGTGGTGGG - Intronic
1125021397 15:34990108-34990130 CATGGTAGGGCAGAGGTGGCAGG + Intergenic
1128073831 15:64813799-64813821 CATGGTTGCCCACTTGTTGTGGG + Intergenic
1135885702 16:26305196-26305218 CATGTCAGGCCAGTTGATGTGGG - Intergenic
1136561108 16:31039811-31039833 CATTGTTGGTGAGATGTTGTGGG + Exonic
1136605950 16:31333845-31333867 CAGGGCAGGCCAGAAGTGGTAGG - Intergenic
1139884004 16:70196097-70196119 CAGGGTGGGCCAGGTGTTGTAGG + Intergenic
1140368513 16:74399399-74399421 CAGGGTGGGCCAGGTGTTATAGG - Intergenic
1141216193 16:82026350-82026372 CATCATAAGCCAGATGTTGCAGG - Intergenic
1142977407 17:3653906-3653928 CTTGGGAGATCAGATGTTGTAGG + Intronic
1145270304 17:21401256-21401278 CATGGTAGGGGAGAAGTGGTCGG + Intronic
1147129943 17:38401652-38401674 CAGGGTAGACCAGATGGTCTGGG + Exonic
1152113608 17:78371279-78371301 CTTTGTAGGCCAGATGGTCTCGG - Intergenic
1154998134 18:21660873-21660895 GATGGGAGGTCAGATATTGTTGG + Intronic
1158891346 18:61875025-61875047 CATGGTCTGCAAGATGTTGGAGG + Intronic
1159526049 18:69590866-69590888 CATGACAGAACAGATGTTGTGGG + Intronic
931960053 2:67472459-67472481 CATGCTAGGGGAGATGTGGTTGG + Intergenic
934537093 2:95143736-95143758 CATGGTGGGCCACATCTTGTGGG + Intronic
936327707 2:111520056-111520078 TATGGTAGCCCACATGTTTTAGG - Intergenic
942937701 2:181577697-181577719 CATGGGAGGCCAGGTGATGAAGG + Intronic
945148684 2:206765187-206765209 CATGGGAGGTGAGCTGTTGTCGG + Intronic
946971113 2:225092756-225092778 CCTGATAGGCCAGGTGTGGTGGG - Intergenic
947812191 2:233011510-233011532 CAAAATAGCCCAGATGTTGTGGG - Intronic
1173751480 20:45480120-45480142 CATTGATGGCCAGGTGTTGTGGG + Intronic
1175512879 20:59546119-59546141 GGTGCTTGGCCAGATGTTGTTGG - Intergenic
1177631503 21:23734878-23734900 AATGGTAGAGCAGAAGTTGTTGG + Intergenic
1178873641 21:36395859-36395881 CTGGGTAGGGCAGTTGTTGTTGG + Intronic
955341547 3:58129194-58129216 TGTGGTAGGCCAGCTGTGGTTGG + Intronic
958095606 3:88940091-88940113 CATGGTAGGACTGATTTTGTAGG - Intergenic
958096296 3:88949750-88949772 AATGGAAAGACAGATGTTGTGGG + Intergenic
962636423 3:137336498-137336520 AATTGGAGGCCAGATGTTTTAGG - Intergenic
963002163 3:140692304-140692326 TATGGTTGGTCAGATGCTGTTGG - Intronic
966788472 3:183641679-183641701 CATGCTAGTCAGGATGTTGTTGG + Intronic
967044545 3:185724693-185724715 CAAGGTAGGCCAGATTTTAAAGG + Intronic
968263713 3:197345643-197345665 CACTGTAGGCCAGTTGCTGTTGG - Intergenic
972816934 4:42656041-42656063 CATGGCAGGCAGGATGTTGAGGG + Intronic
973719590 4:53709840-53709862 CCTGGTAGGCTGGATTTTGTGGG - Intronic
973729324 4:53808474-53808496 CATGGAAGCCCATATGTAGTTGG - Intronic
975929118 4:79496502-79496524 CAGGGTAGGACAGATGTCCTGGG + Intergenic
977920893 4:102641323-102641345 CCTGGAAGGCCACATGTTGAAGG + Intronic
978285979 4:107077086-107077108 CATGTTAGGCTAGATATTGCTGG + Intronic
978960229 4:114668766-114668788 CATGGTAAGCCTGGTGTTGCTGG + Intronic
987807906 5:22794079-22794101 CATGGCAAGCCAGATGTGGGGGG - Intronic
990678295 5:58213265-58213287 CATGGCAGGCCAGAGGGTGAGGG + Intergenic
992341744 5:75831689-75831711 CACGGGAGGCAAGACGTTGTAGG + Intergenic
993947200 5:94130007-94130029 CACGCTGGGCCAGATGTTGATGG - Intergenic
996724240 5:126659990-126660012 TATGGTAGTCCACATGTTGCAGG - Intergenic
997689884 5:135821271-135821293 CATGGGAGGGCTGATGATGTAGG - Intergenic
998106188 5:139470936-139470958 CAGGGTAGCCCAGATGTTCCCGG + Intergenic
1002016913 5:176331679-176331701 TGTGGTAGGCCAGATGCAGTTGG + Intronic
1002605185 5:180378866-180378888 CATGGCAGGCCTGATGTACTTGG + Intergenic
1002939731 6:1705572-1705594 CAGGTTGGGCCAGATTTTGTAGG + Intronic
1003911174 6:10745171-10745193 CATGGAAGGAAAGATGCTGTCGG + Intergenic
1005431536 6:25763174-25763196 CATGGTAGGCCAGATGTTGTAGG - Intronic
1008689482 6:53961745-53961767 CATTGTAGGCCAAATGCTGTGGG + Intronic
1011495723 6:87935219-87935241 CCTGGTAGGCAAGATGATGTGGG + Intergenic
1016002084 6:139051883-139051905 CATGCTACCCCAGAAGTTGTTGG - Intergenic
1018944116 6:168333840-168333862 CATGCTAGGCGATATGGTGTGGG - Intergenic
1019286021 7:223532-223554 CATGGTGGGGCAGATGCCGTGGG + Intronic
1026508637 7:71008694-71008716 CATGGTAGGCTAGATCATCTAGG + Intergenic
1032484008 7:132269370-132269392 CATGGGAGGGCAGATGGTGGGGG - Intronic
1033636628 7:143218026-143218048 CATGGAGGGCCAGATGGTGTTGG + Intergenic
1035958171 8:4106034-4106056 CAAGGTAGGCCAGATTTTAGGGG + Intronic
1038058380 8:23884369-23884391 CATGTTAGGCCAGTTCTTATGGG - Intergenic
1047349597 8:124061042-124061064 CAGGGAAGGCCAGATGTTTCTGG + Intronic
1047515537 8:125551501-125551523 AATGGTAGGACAGATAATGTTGG - Intergenic
1052065959 9:24020526-24020548 CATGTTAGGCCATTTTTTGTTGG + Intergenic
1055723837 9:79206162-79206184 CATGGCAGGCCAGCAGGTGTTGG - Intergenic
1056703352 9:88930557-88930579 AATGGTGGCCCAAATGTTGTGGG - Intergenic
1059970019 9:119657749-119657771 CATTGGAGGCCAGATTATGTAGG + Intergenic
1060911831 9:127357374-127357396 CAGGGTAAGCCAGCGGTTGTGGG + Exonic
1061904756 9:133690927-133690949 CCTGTGGGGCCAGATGTTGTGGG - Intronic
1062173069 9:135146004-135146026 AATGGCAGGCCAGATGGTCTGGG - Intergenic
1062418403 9:136465969-136465991 CATGGCAGGCCAGACGGTGTCGG + Exonic
1188597521 X:31919545-31919567 CATGGTTGGCCAAGTGTGGTGGG - Intronic
1189164438 X:38846740-38846762 CAAGGTAGGCAAGATATGGTTGG + Intergenic
1190605637 X:52139446-52139468 CATGGTAGGCCTGAAGTCGGGGG - Intergenic
1192751098 X:73992128-73992150 CATTCTAGGCCAGGTGCTGTGGG - Intergenic
1196156700 X:112438257-112438279 CATGGTAGGCAAGTTGATGCTGG + Intergenic
1199903087 X:152196830-152196852 CATTGTAGGTCAGGTATTGTAGG - Intronic
1200696511 Y:6365864-6365886 CATGCTTGCCTAGATGTTGTAGG - Intergenic
1200914338 Y:8558060-8558082 CAGGATGGCCCAGATGTTGTAGG + Intergenic
1201037602 Y:9798835-9798857 CATGCTTGCCTAGATGTTGTAGG + Intergenic