ID: 1005432879

View in Genome Browser
Species Human (GRCh38)
Location 6:25776875-25776897
Sequence AGACAGCACCAAGAAGGTCA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 256}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005432879_1005432883 26 Left 1005432879 6:25776875-25776897 CCATGACCTTCTTGGTGCTGTCT 0: 1
1: 0
2: 2
3: 27
4: 256
Right 1005432883 6:25776924-25776946 AGGAGCCCTTGTTAACTTCTTGG 0: 1
1: 0
2: 1
3: 8
4: 140
1005432879_1005432882 6 Left 1005432879 6:25776875-25776897 CCATGACCTTCTTGGTGCTGTCT 0: 1
1: 0
2: 2
3: 27
4: 256
Right 1005432882 6:25776904-25776926 ATCAGCAGCTTCTGTGAATCAGG 0: 1
1: 0
2: 2
3: 25
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005432879 Original CRISPR AGACAGCACCAAGAAGGTCA TGG (reversed) Exonic