ID: 1005432879

View in Genome Browser
Species Human (GRCh38)
Location 6:25776875-25776897
Sequence AGACAGCACCAAGAAGGTCA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 256}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005432879_1005432883 26 Left 1005432879 6:25776875-25776897 CCATGACCTTCTTGGTGCTGTCT 0: 1
1: 0
2: 2
3: 27
4: 256
Right 1005432883 6:25776924-25776946 AGGAGCCCTTGTTAACTTCTTGG 0: 1
1: 0
2: 1
3: 8
4: 140
1005432879_1005432882 6 Left 1005432879 6:25776875-25776897 CCATGACCTTCTTGGTGCTGTCT 0: 1
1: 0
2: 2
3: 27
4: 256
Right 1005432882 6:25776904-25776926 ATCAGCAGCTTCTGTGAATCAGG 0: 1
1: 0
2: 2
3: 25
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005432879 Original CRISPR AGACAGCACCAAGAAGGTCA TGG (reversed) Exonic
901083627 1:6597602-6597624 AGTGAGCACCAAGAAGAACAGGG - Intronic
902185634 1:14723247-14723269 AGACAGCAGGTAGAAGGTCTGGG - Intronic
905447556 1:38036897-38036919 AGACAGCACTCAGAGGGTCAGGG - Intergenic
906306212 1:44721146-44721168 AGACAGTACCCTCAAGGTCAAGG + Intronic
906760706 1:48374900-48374922 AGACAACACTAAGACTGTCAAGG + Intronic
908887571 1:68807393-68807415 AGACAGGAACTAGATGGTCATGG + Intergenic
908959150 1:69673272-69673294 AGACACCATCAAGAATGTCATGG + Intronic
911138072 1:94464382-94464404 AGACAGCTGAAAAAAGGTCAAGG - Intronic
911698158 1:100917376-100917398 CCACAGCACCAAAAAGGTCAAGG - Intronic
912457541 1:109807858-109807880 GCACAGGCCCAAGAAGGTCAGGG - Intergenic
912645946 1:111391771-111391793 AGTCAGCACCATGAAGATCCTGG - Intergenic
913448207 1:118972452-118972474 AGACAGCAGCAATAATGGCATGG + Intronic
913505102 1:119509656-119509678 AGGCAACTCCAAGAAGGTCCTGG - Intronic
914898080 1:151694918-151694940 AGAGAGCACGAGGGAGGTCATGG - Exonic
915311771 1:155008796-155008818 GGACAGCACCCAGAGGGTTAAGG + Intronic
918498418 1:185165762-185165784 GGACAGCAGCAAGGAGGCCATGG - Intronic
920916898 1:210265054-210265076 AGACATTACAAAGAAGGTGAGGG + Intergenic
921308897 1:213823696-213823718 AGCCAACACCAAGGATGTCATGG - Intergenic
922393031 1:225167219-225167241 AGACAGAACAAAGCAGGTGAAGG - Intronic
922937145 1:229431720-229431742 ACCCAGCACCATGAAGATCAAGG - Exonic
924070845 1:240276670-240276692 AGTCTGCACCATGAGGGTCATGG - Intronic
924325790 1:242892702-242892724 AGAGAGGACCAGGAAGGACACGG + Intergenic
1067003649 10:42640842-42640864 AGAGAACACCGAGAAGGGCAGGG + Intergenic
1067840724 10:49676690-49676712 AGAAAGCATTAAAAAGGTCAAGG + Intergenic
1069677799 10:70260843-70260865 AGATAACACCTAGCAGGTCATGG - Intronic
1070682085 10:78455786-78455808 AGAAAGTACCAAGACAGTCAGGG - Intergenic
1070850920 10:79560911-79560933 GGGCAGCACCTGGAAGGTCATGG + Intergenic
1070856277 10:79610363-79610385 GGGCAGCACCTGGAAGGTCACGG - Intergenic
1070971532 10:80571446-80571468 AGAGATCACCAAGAAGTTCCGGG + Exonic
1071789348 10:88938060-88938082 ACCCAGCACCATGAAGATCAAGG - Exonic
1072581790 10:96746203-96746225 AGACAGAACCAAAAAGCTCTGGG - Intergenic
1073088948 10:100916743-100916765 AAAGAGCACCATGAAGATCATGG + Exonic
1074055095 10:109916139-109916161 AGAAAGCATCAAGGAGGTAAGGG + Intronic
1075235475 10:120723839-120723861 AGGAAGCACCAAGAAGCTGATGG - Intergenic
1075784496 10:125039783-125039805 AGTCAGCACCAGCAAGGGCAGGG + Intronic
1076492674 10:130873745-130873767 AGGGAGCATCATGAAGGTCAGGG - Intergenic
1080273906 11:30481729-30481751 ACGCAGCACCAAAAAGGTCTGGG + Intronic
1081170486 11:39863798-39863820 AGACAGAAAAAAGAAGATCATGG - Intergenic
1081916141 11:46731742-46731764 AGGATGCACCAAGAAGGACATGG - Intronic
1083452132 11:62753262-62753284 AGACAGTACCAAGAAGGAGGAGG - Exonic
1084208829 11:67611596-67611618 AGACAGCAACCAGGAGGGCAGGG - Intronic
1084323102 11:68384455-68384477 GCACAGAGCCAAGAAGGTCAGGG - Intronic
1085510171 11:77084162-77084184 AGACTGGACCAACATGGTCAGGG - Intronic
1088719155 11:112576560-112576582 ATACAGCACAAAGAAGGACAGGG - Intergenic
1090142271 11:124277565-124277587 AGGGAGCCACAAGAAGGTCATGG + Intergenic
1091586739 12:1821180-1821202 AGACAGCCCCAAGAAACTCGGGG + Intronic
1091908474 12:4208989-4209011 AGACACCGCCAGGAAGGCCAGGG + Intergenic
1092921588 12:13236590-13236612 CGATAGAGCCAAGAAGGTCAAGG - Intergenic
1092925715 12:13270233-13270255 AGACAGAACGAAGAGGATCAAGG + Intergenic
1093603563 12:21061741-21061763 TGACAGCAACAGGAAGATCATGG - Intronic
1094472745 12:30818614-30818636 AGACATCACCAAGCACATCATGG + Intergenic
1099148337 12:79076323-79076345 CAACAGAAGCAAGAAGGTCACGG - Intronic
1099601837 12:84749526-84749548 AGATTGCACCAACAAGTTCAAGG + Intergenic
1101428322 12:104605953-104605975 AGAAAGAACCAAGCAGGGCAGGG - Intronic
1102019617 12:109672966-109672988 AGAGAGCCCCATGAAGGTCAGGG - Intergenic
1102314919 12:111879862-111879884 AGACAGTATCAAGTAGGTCGGGG + Intronic
1103214619 12:119192017-119192039 AGAAAGTACTCAGAAGGTCATGG + Intronic
1103219790 12:119234131-119234153 AGAGAGCACCAAGATGGTGATGG - Intergenic
1106023930 13:25939935-25939957 ACCCAGAACCAAGAAGGGCAGGG - Intronic
1106186993 13:27418350-27418372 AGCCAAAGCCAAGAAGGTCAAGG + Intergenic
1107067837 13:36235062-36235084 TAACAGCACAAAGAAGGTGAAGG + Intronic
1109416124 13:62043924-62043946 AGACAGCACTAAAGAGGCCAGGG - Intergenic
1110074670 13:71224644-71224666 AGACTGCAACAAGAGGATCAAGG + Intergenic
1111078248 13:83266751-83266773 AAACAGCACAAAGAAGGTGGTGG - Intergenic
1112183749 13:97109422-97109444 AGACAGCACCAAGCATGCCAGGG - Intergenic
1113471713 13:110551549-110551571 AGACAGCACCAGGGAAGCCAGGG + Intronic
1113821420 13:113216232-113216254 AGACAGAACAAGGAAGGCCATGG - Intronic
1114689795 14:24570649-24570671 CAACAGTACAAAGAAGGTCATGG - Intergenic
1114753176 14:25228704-25228726 GGAGAACACCAAGAAGGTCAGGG + Intergenic
1116495213 14:45551976-45551998 ATCCAGCTACAAGAAGGTCATGG - Intergenic
1118741780 14:68744908-68744930 GGACAGCCCCAAGAAAGACACGG - Intergenic
1119388421 14:74273660-74273682 AGAAATCATCAAGAACGTCAAGG - Intergenic
1120351186 14:83360945-83360967 AGAGAGAACCAAGAGAGTCAAGG + Intergenic
1121520040 14:94579875-94579897 AGACAGAACACAGCAGGTCAGGG - Intronic
1122023748 14:98859739-98859761 AGACAGCCCCAAGTGGGTTAGGG + Intergenic
1122716008 14:103697591-103697613 AGACAGCAAGAAGCAGGTCCTGG + Intronic
1126406651 15:48329566-48329588 AGAAAACACCATGAAGGGCAGGG + Intergenic
1126663275 15:51052762-51052784 GGACAGCACCAAGACATTCATGG - Intergenic
1127832852 15:62766150-62766172 AGTCATCACTGAGAAGGTCAGGG + Intronic
1127975140 15:63991442-63991464 AGACAGTAGCAACAAGGTCAGGG - Intronic
1127999798 15:64180051-64180073 CCACAGCCCCAAGAAGCTCATGG + Intronic
1128570993 15:68732722-68732744 AGTCAGCAACAAGAGGATCAGGG - Intergenic
1129029235 15:72606481-72606503 AGAGAGAAGCAAGAAAGTCAGGG - Intergenic
1129037169 15:72657525-72657547 AGAGAGAAGCAAGAAAGTCAGGG - Intronic
1129212718 15:74079701-74079723 AGAGAGAAGCAAGAAAGTCAGGG + Intronic
1129397681 15:75261385-75261407 AGAGAGAAGCAAGAAAGTCAGGG - Intronic
1129401292 15:75285662-75285684 AGAGAGAAGCAAGAAAGTCAGGG - Intronic
1129474888 15:75778356-75778378 AGAGAGAAGCAAGAAAGTCAGGG - Intergenic
1129729859 15:77924022-77924044 AGAGAGAAGCAAGAAAGTCAGGG + Intergenic
1129838657 15:78729960-78729982 AGAGAGAAGCAAGAAAGTCAGGG - Intergenic
1130170663 15:81509579-81509601 AGACAGCTCCAAGAATTTCAGGG + Intergenic
1130458371 15:84138046-84138068 AGACAGCATCAACAATGTCAAGG - Intergenic
1132287000 15:100670683-100670705 TGACTGCACCAAGCAGGCCATGG - Intergenic
1135392225 16:22103514-22103536 AGAAAACAGCAAGAAGGTAACGG + Exonic
1135618673 16:23934111-23934133 AGACAGAACCAAGCAAGTCCAGG - Intronic
1137597514 16:49734575-49734597 AGACAGCCCCCAGGAGGACAGGG - Intronic
1137609910 16:49811287-49811309 AGAGACCCCCAAGAAAGTCAAGG + Intronic
1137884614 16:52089142-52089164 AGAATGCACCAAGATGGGCACGG + Intergenic
1138375288 16:56559266-56559288 AGACAGCACAGTGAAGATCATGG - Intergenic
1140093294 16:71854347-71854369 AGACAGCAACAGAAAGGTCAGGG - Exonic
1143511140 17:7395660-7395682 AGACATCACCAATAAGGCGAAGG + Intronic
1144013303 17:11170661-11170683 AGACATCGACAAGAAGCTCAGGG + Intergenic
1146927263 17:36753563-36753585 AAACAGTATCCAGAAGGTCAGGG + Intergenic
1147686995 17:42292158-42292180 GGAGAGCACCAAGAAGATGAGGG + Intronic
1148327745 17:46793600-46793622 AGACAGGACAAAGAATTTCAGGG + Intronic
1148579354 17:48733107-48733129 AGACACCTCCAGGAAGGTAAAGG + Intergenic
1149197124 17:54134342-54134364 CAACAAGACCAAGAAGGTCAGGG + Intergenic
1149798385 17:59542973-59542995 AGACAGAGCCAAGCAGATCAAGG - Intergenic
1150263758 17:63818293-63818315 GGACAGCAGCAAGATGGACAAGG + Exonic
1150311798 17:64135098-64135120 AGGCAGCACCAAGATGGAAACGG + Intergenic
1150580442 17:66468986-66469008 AGTCAGAGCCAAGAAGGCCATGG + Intronic
1150960187 17:69904138-69904160 AGAAAGCATGAAGAATGTCATGG - Intergenic
1151149988 17:72076787-72076809 GGACAGCAGGTAGAAGGTCAGGG - Intergenic
1152911805 17:83009544-83009566 AGACGGTGGCAAGAAGGTCAGGG + Intronic
1152988814 18:343612-343634 AGAGAGAGCCTAGAAGGTCAGGG - Intronic
1153222542 18:2874491-2874513 GGACAGCACCAAGGAGGGGAGGG - Intronic
1153655837 18:7281403-7281425 AGAGAGCAGCAAGCAGGTCATGG - Intergenic
1154423487 18:14254006-14254028 AGACAGCACCAACAGGTCCATGG - Intergenic
1157211001 18:45741962-45741984 AGACAGTACCAGGAAGAGCAAGG + Intronic
1158943038 18:62423970-62423992 AGATAGTAGCAAGCAGGTCATGG + Intergenic
1160333054 18:78012926-78012948 TCACAGCACCAAGAACTTCAAGG - Intergenic
1164588313 19:29491587-29491609 GGACAGCACCAAGCCGTTCATGG + Intergenic
1166503286 19:43356191-43356213 AGCCAGCAGGAGGAAGGTCAAGG + Intronic
1166507168 19:43378570-43378592 AGCCAGCAGGAGGAAGGTCAAGG - Intergenic
1166843392 19:45712328-45712350 GGACGGCACCAAGAACGTGAAGG - Exonic
1166843619 19:45713132-45713154 GGCCAGCTCCATGAAGGTCAAGG - Exonic
1166860243 19:45806032-45806054 TTACAGGAGCAAGAAGGTCAGGG - Intronic
1167749701 19:51372228-51372250 GGACAGGACCAGGAAGCTCACGG + Exonic
1168190893 19:54738536-54738558 AGACAGCACCATGTCGCTCATGG + Exonic
1168415314 19:56164122-56164144 AGACGGAAGCAAGAAAGTCAAGG - Intergenic
926431988 2:12796778-12796800 AGACAGCGCCAAGAAGGTCCTGG + Intergenic
928364292 2:30689683-30689705 AGACAGAGCCAAGAAGGTCAGGG + Intergenic
929129503 2:38553168-38553190 TGACAGAACTAAGAAGGACAGGG + Intergenic
929251720 2:39764587-39764609 AGAGAGCACCATGAAGTTAAAGG - Intronic
929971959 2:46587793-46587815 AGACACCACCACAACGGTCAAGG + Intronic
932451800 2:71815402-71815424 AAACAGCAACAAGGAGGCCATGG + Intergenic
933321202 2:80777613-80777635 AGACATCATCAAGCAGGTCAAGG - Intergenic
934953040 2:98592325-98592347 TGACAGAACCAAGGGGGTCAAGG + Intronic
936479211 2:112869334-112869356 AGGCAGCACCAGGAAGGAAAGGG - Intergenic
936836247 2:116712714-116712736 AAACAGCAGCAAAAGGGTCATGG + Intergenic
938312934 2:130305882-130305904 GGACAGCCCCAAAAAGATCAGGG + Intergenic
939229416 2:139407303-139407325 AGACATCACCAAGAGGCACAAGG - Intergenic
942935063 2:181545747-181545769 AAACAGCACCAAAACGTTCATGG + Intronic
943599819 2:189902436-189902458 AGAAATTACCAAGAAGTTCATGG - Intronic
944310226 2:198224894-198224916 AGACAGCAACAAGAACAACAAGG - Intronic
944872025 2:203921791-203921813 AGACATTTCCAAGCAGGTCAGGG - Intergenic
948598257 2:239094254-239094276 AGGCTGCATCAAGGAGGTCAGGG + Intronic
1169304181 20:4474210-4474232 AGGCAGCTCCAAGCAGCTCAGGG - Intergenic
1170195993 20:13690042-13690064 AGACAGAACCAAGCTGGTTAAGG - Intergenic
1171164693 20:22959453-22959475 AGCCAGCCCCAAGAATTTCAGGG + Intergenic
1172162578 20:32878891-32878913 GGTCAGCACCAGCAAGGTCACGG - Intronic
1173082529 20:39882424-39882446 ACACAGTACCAAAAAGATCATGG - Intergenic
1175119487 20:56707293-56707315 AGGAAGCACCTAGAAGGTCTTGG + Intergenic
1175530881 20:59673668-59673690 AGACAGCACCAAGCAAGCCCGGG - Intronic
1178723042 21:35027109-35027131 GGAGAGCATCAAGAAGGGCAGGG + Intronic
1180616457 22:17131478-17131500 AGACAGCTCCAGGAACGCCAAGG + Intronic
1181311916 22:21949537-21949559 AGACAGCATCAGGAATGGCATGG + Intronic
1181361417 22:22340286-22340308 AGGGACCACCAAGAAGGTCCAGG + Intergenic
1181803547 22:25361968-25361990 GCACAGAGCCAAGAAGGTCAGGG + Exonic
1182777541 22:32841992-32842014 ACTGAGCACCAAGAAGGTCATGG + Intronic
1185086982 22:48746177-48746199 AGACAACACCGAGAAGGGCCAGG - Intronic
949209179 3:1477735-1477757 AGACAGCACCTGGAAGATCAGGG + Intergenic
949342487 3:3044877-3044899 AGACAGCACCTGGAAGATCAGGG + Intronic
949677788 3:6477393-6477415 AGAAAACACCAAGATAGTCATGG - Intergenic
950502690 3:13374509-13374531 AGACAGGACAAAGAGGGTGAGGG - Intronic
951610489 3:24487011-24487033 AAACAGCAGAAAGAAAGTCAAGG + Intronic
952679855 3:36078941-36078963 AGTCACCAGCAAGAAGGTAAGGG - Intergenic
953689847 3:45108414-45108436 AAACAGCATCAAGAAGGACATGG - Intronic
953833529 3:46323511-46323533 AGACTGGTCCATGAAGGTCATGG - Intergenic
955239651 3:57167391-57167413 GGACAGTACCAAGAATGTGAGGG - Intronic
955484134 3:59418477-59418499 AGAAAGCAGCAAGAAGCTAAAGG - Intergenic
955974161 3:64464527-64464549 AAACAGCAGGAAAAAGGTCAAGG + Intergenic
956405519 3:68924895-68924917 AAACATCCCCATGAAGGTCAAGG - Intronic
956584002 3:70844743-70844765 AGACAGCACCAAGCCACTCATGG - Intergenic
958403339 3:93718180-93718202 AGACATCACCAAGAAGTTTCTGG + Intergenic
959446107 3:106441667-106441689 AAACAGCACCACGAAAGACAGGG + Intergenic
959908693 3:111738695-111738717 ATACAGTACCAAGAAGATAATGG + Intronic
963077737 3:141362901-141362923 AGACTGCACCCTGTAGGTCATGG + Intronic
965364060 3:167776934-167776956 AAACTGGACCAAGTAGGTCAAGG - Intronic
967328706 3:188268445-188268467 GGACAGAACAAAGAAGGTGACGG + Intronic
967348695 3:188488125-188488147 GGACAGCAGGAAGAAGGTCAAGG - Intronic
967829232 3:193904636-193904658 AGACACCACCAGGCAGGTGATGG + Intergenic
969325289 4:6440615-6440637 AGACAGCACCAAGGCTGCCAGGG - Intronic
969519620 4:7668391-7668413 AGGCAGCTCCAAGAAGAGCAAGG + Intronic
969693631 4:8722804-8722826 AGACAGCACCTTGAGGGCCAAGG - Intergenic
971401319 4:26278124-26278146 AGGCAGCACAGAGAAGGTAAAGG - Intronic
973837078 4:54820390-54820412 AGACATCACCAAGAAGATTCTGG + Intergenic
973846842 4:54921495-54921517 TGACAGCACCAAGGGGGACAAGG - Intergenic
973916376 4:55638083-55638105 AGACACCAGGAAGAAGGTCACGG - Intergenic
978434466 4:108668446-108668468 AGGCAGCACTGAGAATGTCATGG + Intergenic
979499622 4:121424826-121424848 AGGCAGCACTGAGGAGGTCAAGG + Intergenic
982112124 4:152066341-152066363 AGACAGCATGAACAAGGACATGG - Intergenic
982764631 4:159331082-159331104 AGACAGAAACTAGAAAGTCAAGG - Intronic
984142771 4:176023552-176023574 TGACAGCACTGAGAATGTCAAGG + Intergenic
986363287 5:7003111-7003133 AGAGAGCCAAAAGAAGGTCAGGG + Intergenic
986514989 5:8551831-8551853 AGAAACCACCATGAGGGTCATGG + Intergenic
986699960 5:10396758-10396780 AGACAGGACAAAGAAAGTCAGGG + Intronic
986980893 5:13447126-13447148 TGACCGCAGCAAGAAGGCCAAGG - Intergenic
987098511 5:14571509-14571531 AGACTCAACCCAGAAGGTCATGG + Intergenic
990603572 5:57385096-57385118 AGAAAGGACCAAGAAGCACATGG - Intergenic
991633606 5:68681048-68681070 AGAAGGCACCAAGAAGGAGATGG - Intergenic
992370022 5:76134032-76134054 ATACAGCACCAGGAAGATAAAGG - Intronic
993466625 5:88254954-88254976 AGAAAGCACCAAAATGGACAAGG + Intronic
993877271 5:93322438-93322460 AGAGAGCACCTAGAAGGTGAAGG - Intergenic
994215850 5:97136256-97136278 AGACAGCATCAAGAAAGTCGGGG - Intronic
994910904 5:105905629-105905651 TGACAGCAAGAAGAAGGGCAAGG - Intergenic
995337320 5:111014570-111014592 AGAGAGAACCATGAAAGTCAAGG - Intergenic
995347411 5:111136253-111136275 AGAAAGCACGAAGAACATCAGGG + Intergenic
996618142 5:125466826-125466848 AAGCAGCACCAAGGAGGACAGGG + Intergenic
997078654 5:130711876-130711898 AGACAGCACAAAGAAGGTAGAGG + Intergenic
997747991 5:136316528-136316550 AAACAACAACAACAAGGTCAAGG - Intronic
999886043 5:155924115-155924137 AGACAATAACAAGAAGGACAAGG - Intronic
1001867951 5:175121791-175121813 AAACAGCATCAAGAAACTCAAGG + Intergenic
1001950097 5:175810330-175810352 AGACAGCAGCCAGAAGGTCTGGG - Intronic
1004084678 6:12433899-12433921 AAACAGCACTAAGTAGTTCATGG - Intergenic
1004773528 6:18815328-18815350 AGACAGCATCAAGAATTTCTGGG - Intergenic
1005056493 6:21734078-21734100 AGACAGGAAAAAGAAGTTCAGGG + Intergenic
1005432879 6:25776875-25776897 AGACAGCACCAAGAAGGTCATGG - Exonic
1006129861 6:31862660-31862682 AGACAGCAGCAGGAAGATCGCGG + Exonic
1007295872 6:40820164-40820186 AGAAAGTATCCAGAAGGTCAAGG + Intergenic
1008326244 6:50185372-50185394 TGACTCCAGCAAGAAGGTCAAGG - Intergenic
1008898272 6:56582304-56582326 GGACAGCACCAAGATGATGATGG - Intronic
1009925444 6:70115127-70115149 AGACAGTACCAAGTAGGAAAGGG - Intronic
1010285658 6:74074627-74074649 AGACAGCACCAATAAGGGGTGGG - Intergenic
1010618847 6:78048304-78048326 AGACAACACCAAAAAACTCACGG - Intergenic
1011036033 6:82976586-82976608 AGCAAACACCAAGAAGGTGACGG - Intronic
1014119462 6:117706784-117706806 AGACAGCACCATGACAGGCACGG - Intronic
1015356740 6:132286249-132286271 CGTCTGCAGCAAGAAGGTCAGGG - Intergenic
1015492270 6:133839114-133839136 AGATTGCAGCAAGAAGGGCAAGG - Intergenic
1015994854 6:138987592-138987614 TGAGAGCACCAAGAAGGTGGTGG - Exonic
1016830855 6:148431733-148431755 AAACAGCAGCCAGCAGGTCATGG + Intronic
1018051257 6:160010567-160010589 AAGCAGCAGCAAGAAGGGCAGGG - Intronic
1018355863 6:163015732-163015754 AGACACCACCAAAAAGCTCCTGG - Intronic
1019881392 7:3864600-3864622 AGACAGCCCCAAGGACGTGAGGG + Intronic
1020225824 7:6279203-6279225 AGACAGCAACGAGAAGGTGGCGG - Intergenic
1020921365 7:14269009-14269031 AGCCATCACCAAGAAGCTGAAGG + Intronic
1022468828 7:30669332-30669354 AGACAGCTCCAGGCTGGTCATGG - Intronic
1023089554 7:36604898-36604920 AGAAAGCAGCAAAGAGGTCATGG - Intronic
1023615386 7:42014502-42014524 AGACAGCAGGAAGAAGTTAAAGG - Intronic
1023905772 7:44520815-44520837 AGGCCGCTGCAAGAAGGTCAGGG + Exonic
1024358447 7:48443159-48443181 TGTCAGCACCAAGAAGAGCAAGG - Intronic
1025311441 7:57947462-57947484 AGACATCACAAAGAAGTTTATGG + Intergenic
1026280758 7:68919871-68919893 GGACAGGACCAAGGGGGTCATGG + Intergenic
1028198519 7:87934488-87934510 ACAGAGCAGCAAGAAGGGCACGG - Exonic
1029228971 7:99050400-99050422 AGACAGCACCAAGCTTTTCAGGG + Intronic
1029385023 7:100237869-100237891 AAACAACAACAAGGAGGTCAAGG - Intronic
1029651012 7:101891614-101891636 ATACAGCTCCAAGAAGGTACGGG - Intronic
1029787773 7:102809886-102809908 GGACAGAACCAAGAAGGTGGTGG - Intergenic
1029971517 7:104794260-104794282 TGACAGCACCAAGAAGTTTCAGG - Intronic
1032469749 7:132169731-132169753 AGCCAGCACCAAGCAGAACATGG - Intronic
1032536997 7:132672592-132672614 AGATGGCACCAAGAAGGGTAAGG + Intronic
1034971792 7:155423948-155423970 AGAGAGCAGCAAGAAGGCAAGGG + Intergenic
1035090002 7:156302105-156302127 AGACAGCTACAAGATGTTCATGG + Intergenic
1037422355 8:18716501-18716523 ACACAGCAGCAAGATGGCCAGGG + Intronic
1037443588 8:18942415-18942437 AGACAGGGACAAGAAGCTCAAGG + Intronic
1039021952 8:33217884-33217906 AGACAGCACACAGAAGGTCCTGG + Intergenic
1039585545 8:38704147-38704169 AGACAGCAACAGGAAAGCCACGG + Intergenic
1043070786 8:75633314-75633336 AGACAGAAAGAAGAATGTCATGG - Intergenic
1043372495 8:79611330-79611352 ACACAGGACCAGGAAGGACAGGG + Intronic
1043448231 8:80340252-80340274 AGAAAGCAGCAAGTAGGTGATGG - Intergenic
1045760616 8:105602103-105602125 TGACAGAATCAAGAAAGTCAAGG - Intronic
1046681121 8:117171355-117171377 AGTCAGCCCCAAGAATGTCGTGG - Intronic
1046891812 8:119430407-119430429 ATATAGCACCAAGAAGGGTATGG - Intergenic
1047612738 8:126537060-126537082 AAAGAGCACCAAGAAGATGAAGG - Intergenic
1048721028 8:137325205-137325227 AGACAGTACCATCATGGTCAAGG - Intergenic
1049495670 8:142931003-142931025 AGACAGAACCAATAAGTTCTGGG + Intergenic
1051130601 9:13856045-13856067 GGACATCTCCAAGGAGGTCAGGG - Intergenic
1054984900 9:71250709-71250731 AGCCAGCAGTAAGAAGGGCAGGG + Intronic
1056778946 9:89534868-89534890 GGACAGCACTAAAAAGGACATGG + Intergenic
1056861303 9:90185581-90185603 ATAAAACAACAAGAAGGTCATGG - Intergenic
1057181921 9:93035059-93035081 AGACAGCCCAAAGAAGGCCATGG + Intronic
1058742738 9:107960071-107960093 AGAAGACAGCAAGAAGGTCAAGG + Intergenic
1059195976 9:112371346-112371368 AGACAGCAAGTAGTAGGTCAAGG - Intergenic
1060040729 9:120298270-120298292 AGACAGCACCTAGAAAGAAAGGG + Intergenic
1060965720 9:127711448-127711470 GGAGAACACCCAGAAGGTCATGG + Exonic
1061052033 9:128202563-128202585 AGCCAGCAGCAAGCAGATCAGGG - Intronic
1185617125 X:1428862-1428884 AGACAGGAGGAAGAAGTTCAAGG - Intronic
1186303590 X:8228437-8228459 TGACAGCTCCAAGAATGTAAAGG + Intergenic
1191100712 X:56724395-56724417 TGACAGCACCATGGAGGCCAAGG + Intergenic
1192335966 X:70220064-70220086 AGAAAGTACCAAGAGGGACAAGG + Intergenic
1193220057 X:78913534-78913556 ATAGAGCACCAAGAATGTCTCGG - Intergenic
1196885163 X:120237454-120237476 AGACAGCATAAAGAAAGCCAAGG - Intergenic
1197897439 X:131330382-131330404 AGAGAGCACCAAAAAGCTAAGGG + Intronic
1198233058 X:134711738-134711760 TGTCAGCAGCAAGAAGGTCTGGG + Intronic
1200805085 Y:7425238-7425260 AGAAAGCACCTAGAGGCTCAGGG - Intergenic
1201223239 Y:11791242-11791264 AGAGAGGACCAGGAAGGACACGG + Intergenic