ID: 1005436845

View in Genome Browser
Species Human (GRCh38)
Location 6:25821228-25821250
Sequence GAGAGAAAAAAGAAGAATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2836
Summary {0: 1, 1: 0, 2: 29, 3: 270, 4: 2536}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005436845_1005436848 9 Left 1005436845 6:25821228-25821250 CCTCCATTCTTCTTTTTTCTCTC 0: 1
1: 0
2: 29
3: 270
4: 2536
Right 1005436848 6:25821260-25821282 TCACTGTCACCCTATAGCTGTGG 0: 1
1: 0
2: 2
3: 8
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005436845 Original CRISPR GAGAGAAAAAAGAAGAATGG AGG (reversed) Intronic
Too many off-targets to display for this crispr