ID: 1005436845 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:25821228-25821250 |
Sequence | GAGAGAAAAAAGAAGAATGG AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 2836 | |||
Summary | {0: 1, 1: 0, 2: 29, 3: 270, 4: 2536} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1005436845_1005436848 | 9 | Left | 1005436845 | 6:25821228-25821250 | CCTCCATTCTTCTTTTTTCTCTC | 0: 1 1: 0 2: 29 3: 270 4: 2536 |
||
Right | 1005436848 | 6:25821260-25821282 | TCACTGTCACCCTATAGCTGTGG | 0: 1 1: 0 2: 2 3: 8 4: 108 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1005436845 | Original CRISPR | GAGAGAAAAAAGAAGAATGG AGG (reversed) | Intronic | ||
Too many off-targets to display for this crispr |