ID: 1005436964

View in Genome Browser
Species Human (GRCh38)
Location 6:25822961-25822983
Sequence CAGTGGTGGGGGAGGGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1913
Summary {0: 1, 1: 1, 2: 11, 3: 194, 4: 1706}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005436964 Original CRISPR CAGTGGTGGGGGAGGGCAGG AGG (reversed) Intronic
900002933 1:24929-24951 CTGTGGTGGGGGCGTGCCGGTGG - Intergenic
900022654 1:195454-195476 CTGTGGTGGGGGCGTGCCGGTGG - Intergenic
900096228 1:941208-941230 CTGCCGTGGAGGAGGGCAGGTGG - Exonic
900117098 1:1033560-1033582 CAGCGGTGGGGCTGGGCCGGGGG - Intronic
900122002 1:1052216-1052238 CAGTGGTGGGGGTTGGCTGTGGG - Intronic
900191941 1:1355751-1355773 CCCTGGTGGGGGAGGGGAGTCGG + Exonic
900331643 1:2137763-2137785 CACTGGTGGTGGTGGGGAGGGGG - Intronic
900339029 1:2179117-2179139 CAGTGCAGGGGCAAGGCAGGTGG - Intronic
900531855 1:3157825-3157847 CGGTGCTGGGGGAGGCCAGATGG - Intronic
900696764 1:4016980-4017002 GAGAGTTGGGGGAGGGGAGGAGG + Intergenic
900696773 1:4017004-4017026 GAGAGTTGGGGGAGGGGAGGAGG + Intergenic
900696782 1:4017028-4017050 GAGAGTTGGGGGAGGGGAGGAGG + Intergenic
900696791 1:4017052-4017074 GAGAGTTGGGGGAGGGGAGGAGG + Intergenic
900721140 1:4176566-4176588 GAAGGGTGGGGGAGGGCAGGTGG - Intergenic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
900929729 1:5729016-5729038 CAGGGGTGGGGATGGGGAGGCGG - Intergenic
900940217 1:5793614-5793636 CAGTGGTGGTGGTGGCCAGATGG + Intergenic
900991546 1:6100468-6100490 CAATGGTGCCAGAGGGCAGGTGG + Exonic
901101841 1:6725173-6725195 CTGTAGTGGAGGAGCGCAGGTGG + Intergenic
901117872 1:6863318-6863340 CAGGGGTTGGGGAGGGAATGGGG - Intronic
901239236 1:7683451-7683473 CGGAGGTGGGAGAGGGTAGGTGG - Intronic
901323001 1:8350644-8350666 GAGTGGTGGCGGGGGGCGGGGGG - Intergenic
901448138 1:9320395-9320417 CACACGTGGGGCAGGGCAGGGGG - Intronic
901494155 1:9611900-9611922 CTGAGGTGCGGGAGGGGAGGGGG + Intronic
901560429 1:10066040-10066062 AAGGAGTGGGGGAGGGAAGGAGG - Intronic
901653248 1:10755116-10755138 CAGTGGTGTGGGTGGGAACGTGG + Intronic
901671483 1:10858592-10858614 AAGTGGGGGGTGAGGGCATGTGG - Intergenic
901849516 1:12006718-12006740 AGGTGGGGGCGGAGGGCAGGTGG + Intronic
901930708 1:12595084-12595106 CAGAGGGAGGGGAGGGGAGGCGG + Intronic
902332729 1:15738451-15738473 CAGGGCTGGGGGATGGCTGGAGG + Intronic
902468396 1:16631678-16631700 CAGTGGTGGGCCAGGGAGGGAGG - Intergenic
902468464 1:16631915-16631937 CACTGGTGGGGGTGGACAGTTGG + Intergenic
902549159 1:17208941-17208963 CAGTGGTGGGGAAGGCTTGGGGG - Intronic
902552740 1:17229065-17229087 CAGACTTGGGGGAGGGCTGGAGG - Intronic
903025773 1:20429078-20429100 TGGTGGTGGGGGAGGGCTGATGG - Intergenic
903134926 1:21303069-21303091 CAGTGGTGGGGCTGGGTAGATGG - Intronic
903154731 1:21435980-21436002 CAGTGGTGGGCCAGGGAGGGAGG + Intergenic
903182358 1:21611396-21611418 AGGTGGAGGGGGAGGACAGGTGG + Intronic
903213668 1:21831748-21831770 CAGTGGTGTGGGATGGCGGATGG + Exonic
903220863 1:21869006-21869028 CAGGGGTGGGGGTGGGAGGGCGG + Intronic
903280063 1:22245250-22245272 CAGTGCAGGAGGAAGGCAGGGGG + Intergenic
903284395 1:22267925-22267947 CAGGGGAGGGGGGGCGCAGGGGG + Intergenic
903358245 1:22761309-22761331 CAGTGGTCGCGGAGAGCGGGAGG + Intronic
903368283 1:22818260-22818282 CTGAGGTGAGGGAGGGCTGGAGG - Intronic
903588776 1:24438459-24438481 CAGGGACGGGAGAGGGCAGGAGG - Intronic
903625977 1:24730353-24730375 GAGGGGAGGGGGAGGGGAGGGGG + Intergenic
903789997 1:25886243-25886265 CAGTGGGAGGGAAGGGCAGAGGG + Intronic
903859683 1:26357214-26357236 CAGGGGTGGGGAGGGCCAGGAGG - Intergenic
903867330 1:26409425-26409447 TAGTGGTGGGGGAGGGGAACTGG + Intergenic
903928807 1:26850441-26850463 GAGTTGTGGGTGAGGGCAGTGGG + Intronic
904110670 1:28123616-28123638 CAGTGGAGGGGGTGGTGAGGAGG + Intergenic
904197144 1:28794412-28794434 CAGTGGCAGGCTAGGGCAGGGGG - Intergenic
904310789 1:29628299-29628321 CAGTGTTGGAGGAGAGCATGGGG + Intergenic
904327500 1:29736863-29736885 CAGTGGAGGGGGAGGGCTCAGGG - Intergenic
904355070 1:29933566-29933588 CAGGGATGGGTCAGGGCAGGTGG + Intergenic
904455710 1:30646901-30646923 CAGGGCTGTGGGAGGGGAGGTGG + Intergenic
904686853 1:32266752-32266774 AAGGGGAGGGGGAGGGGAGGAGG - Intronic
904912983 1:33949334-33949356 CAGTGGCTGGGGAGGGCAGATGG + Intronic
905013228 1:34760768-34760790 CAGGGCTGGGCCAGGGCAGGAGG - Intronic
905043380 1:34977832-34977854 CAGGGATGGGGGCGGGGAGGGGG - Intergenic
905203222 1:36327853-36327875 CAGGGGGTGGGGAGGGCATGTGG - Exonic
905336381 1:37247552-37247574 GAGTGCTGGGGGATGGCGGGAGG + Intergenic
905371775 1:37486346-37486368 GGGGGGTGGGGGAGGGCAGGTGG - Intergenic
905443044 1:38006425-38006447 AAGAGGTGGGGGAGGGAGGGAGG + Intergenic
905464081 1:38139699-38139721 CAGTGCTGGGGGAGTACAGGGGG - Intergenic
905687991 1:39922464-39922486 CAGAGGTGGGGGTCGGCAGCCGG + Intergenic
905876326 1:41434112-41434134 CTGTGGTGGGTGTGGGCACGAGG - Intergenic
906109914 1:43315754-43315776 CTGTGGTGGGGGAGGGTAATGGG + Intronic
906305993 1:44719552-44719574 CAGTGGTCTGGGAAGGCAGAGGG - Intronic
906326594 1:44850041-44850063 CAGGGGTGGTGGAGGGAAGGTGG + Intergenic
906403237 1:45521266-45521288 CAGTGCTGGGGAGGGACAGGGGG - Intronic
906461799 1:46040249-46040271 CAATTGTTGGGGAGGGTAGGGGG - Exonic
906491360 1:46271309-46271331 CAGTTGTTGGGAAGGGCAGGAGG - Intronic
906641868 1:47445796-47445818 CCGGGGTGGGGGTGGGGAGGTGG - Intergenic
906882633 1:49608916-49608938 CTGTGGTGGGGGAGGGGTGATGG - Intronic
906929488 1:50155325-50155347 CAGTGGTGGGAGAGGGTGTGGGG - Intronic
907048619 1:51315109-51315131 CACAGGTGGGGCTGGGCAGGTGG - Intronic
907190126 1:52641306-52641328 AATTGGTATGGGAGGGCAGGAGG + Intronic
907301682 1:53490805-53490827 CAGGGTTGGGGGAGGGCAAGAGG - Intergenic
907407107 1:54260395-54260417 CAGTGGTCAGGGAGGGCAGGAGG + Intronic
907515964 1:54993657-54993679 CAGTGGGGGGTGGGGGGAGGGGG - Intergenic
907573277 1:55503654-55503676 CAGAGGTGGGGGAGAGAAAGAGG - Intergenic
907633297 1:56106573-56106595 CAGTTGATGGTGAGGGCAGGTGG + Intergenic
907859525 1:58338286-58338308 GAGAGGTGAGGGAGAGCAGGAGG - Intronic
907904427 1:58771461-58771483 CTGTGGTGGGGGGAGGGAGGAGG + Intergenic
907998609 1:59657829-59657851 TAGGGATGGTGGAGGGCAGGTGG + Intronic
908277852 1:62494657-62494679 CAGTTGGTGGGGGGGGCAGGAGG + Intronic
908419145 1:63942748-63942770 CAGCGGTGGGGAAGAGTAGGAGG - Intronic
909256396 1:73429058-73429080 GTGTGGTGGGGGGGGGCTGGGGG - Intergenic
910217257 1:84855001-84855023 TGGTGGTGAGGGAGAGCAGGTGG + Intronic
910315106 1:85873675-85873697 CTGTCGTGGGGTAGGGGAGGGGG + Intronic
910509536 1:87988171-87988193 CGGTGGAGGGGAAGGGCAGGGGG - Intergenic
910649294 1:89547798-89547820 TAGTGGGCGGGGAGGGGAGGGGG + Intronic
910727729 1:90356187-90356209 AAGTGGTGGAGGGGGGCAGCGGG + Intergenic
911082659 1:93949212-93949234 CAGAGGAGGGAGAGGGCAAGGGG + Intergenic
911705393 1:101005907-101005929 CGGTAGTGGGGGAGGTGAGGGGG + Intronic
911820337 1:102411303-102411325 CAGGGGAGGGGGAGGGGAGGAGG + Intergenic
912542297 1:110426099-110426121 CTGGGTTGGGGGATGGCAGGGGG + Intergenic
912596405 1:110881248-110881270 TGAAGGTGGGGGAGGGCAGGAGG - Intronic
912687659 1:111779699-111779721 CAGGGGTGGGGGTGGGGGGGCGG + Intronic
912699350 1:111864986-111865008 GGGTGGTGGGGGTGGGCAGCAGG + Intronic
912776834 1:112510721-112510743 CAGTGTTGGGGAAGGCAAGGAGG + Intronic
912799239 1:112710972-112710994 TAGAGGTGGGAGAGGGGAGGAGG - Intronic
912903818 1:113682001-113682023 GTGGGGTGGGGTAGGGCAGGAGG - Intronic
912935950 1:114003686-114003708 CATAGGCGGGGGAAGGCAGGAGG - Intergenic
913533193 1:119747713-119747735 CAGGGGAGGAGGAGGGGAGGAGG - Intergenic
913601182 1:120422393-120422415 CAGGGGTGGAGGAGAGGAGGAGG - Intergenic
913608871 1:120491755-120491777 CAGAGGGAGGGGAGGACAGGGGG - Intergenic
913993052 1:143633277-143633299 CAGGGGTGGAGGAGAGGAGGAGG + Intergenic
914085862 1:144454208-144454230 CAGGGGTGGAGGAGAGGAGGAGG + Intronic
914191759 1:145418188-145418210 CAGGGGTGGAGGAGAGGAGGAGG + Intergenic
914204958 1:145518696-145518718 CAGAGGGAGGGGAGGACAGGGGG + Intergenic
914362368 1:146945949-146945971 CAGGGGTGGAGGAGAGGAGGAGG - Intronic
914484080 1:148091878-148091900 CAGAGGGAGGGGAGGACAGGGGG + Intergenic
914489306 1:148141134-148141156 CAGGGGTGGAGGAGAGGAGGAGG + Intronic
914582322 1:149030083-149030105 CAGAGGGAGGGGAGGACAGGGGG + Intronic
914589684 1:149096189-149096211 CAGGGGTGGAGGAGAGGAGGAGG + Intronic
914866052 1:151430026-151430048 AAGTGGGGGTGGGGGGCAGGGGG + Intronic
915031484 1:152883632-152883654 CAGTGGTGGGGGTGAGGAAGGGG - Intronic
915106973 1:153540803-153540825 CAGCGGGCAGGGAGGGCAGGGGG + Intronic
915148193 1:153808110-153808132 AAGTGGTGGGAGAGGGAGGGGGG - Exonic
915255851 1:154627919-154627941 ACGTGGTGGGGGAGGGTGGGGGG - Intronic
915602204 1:156929494-156929516 CAGAGGTGGTGGAGGGAAGAAGG + Intronic
915653067 1:157333778-157333800 GAGTGATGGGGGTGGGCGGGTGG - Intergenic
915684498 1:157617705-157617727 GAGTGATGGGGGTGGGCTGGGGG + Intergenic
915799443 1:158773667-158773689 ATGTGGTGGGGGAGGGAAGATGG - Intergenic
916169967 1:161994485-161994507 TTGGAGTGGGGGAGGGCAGGTGG - Intronic
916210525 1:162356416-162356438 CAGAGGCAGTGGAGGGCAGGAGG + Intronic
916574615 1:166056404-166056426 AGGTGGTGGGGACGGGCAGGAGG + Intergenic
916778508 1:167996308-167996330 CAATAATGGGGTAGGGCAGGTGG - Intronic
917125326 1:171682546-171682568 GAGGGGAGGGGGAGGGAAGGTGG - Intergenic
917125330 1:171682557-171682579 GAGGGGAGGGGGAGGGGAGGGGG - Intergenic
917448304 1:175125529-175125551 AAGAGGTGGGGGAGGGAAGAGGG - Intronic
917533935 1:175861049-175861071 CAGTGATGGGGGCTGGCTGGTGG + Intergenic
917547142 1:175982862-175982884 CAGAGGTGGGGGATGGGAGTGGG + Intronic
917581956 1:176388026-176388048 CTGTTGTGGGGTAGGGGAGGGGG - Intergenic
917689084 1:177449040-177449062 GGGTGGTGGGGGTAGGCAGGAGG - Intergenic
917762877 1:178182846-178182868 CTGGGGTGGGGGTGGGTAGGTGG + Intronic
917806451 1:178618155-178618177 CAGAGGTGGGTGGGGGCTGGAGG + Intergenic
917909359 1:179626058-179626080 CTGTTGTGGGGTGGGGCAGGGGG + Intronic
918004244 1:180526769-180526791 CAGTGGTGTGGGAGAGAAGGGGG + Intergenic
918006826 1:180549007-180549029 GATTGGGGGAGGAGGGCAGGAGG - Intergenic
918110350 1:181450235-181450257 CAATGTTGGGGGAGGGCACCTGG - Intronic
918474275 1:184906136-184906158 CAGTGGTGGGGGTGGGGTGAGGG + Intronic
918855334 1:189747465-189747487 CTGTTGTTGGGGAGGGGAGGGGG + Intergenic
919754085 1:201055820-201055842 CTTTGGTGGTGGAGGCCAGGAGG - Intronic
919854946 1:201698794-201698816 CAGGAGTGGGAGTGGGCAGGTGG + Intronic
920215396 1:204358928-204358950 CAGTGGAAGGGGAGGGAAGCGGG - Intronic
920536377 1:206739350-206739372 CAGGGGTGTGGGATGGCAGTAGG - Intergenic
920607055 1:207399047-207399069 CAGTGGTGGGGGTGGGGTTGGGG + Intergenic
920673434 1:208022543-208022565 AAGTTGTGGGGAAAGGCAGGTGG + Exonic
920795308 1:209131111-209131133 CAGCGGTGGTGGCGGGCGGGGGG + Intergenic
920849998 1:209622353-209622375 GAGTGGGTGGGGAGGGCAGACGG + Intronic
921477554 1:215629360-215629382 AAGTGGTGGGGCAAGGCAGACGG + Intronic
921602883 1:217125149-217125171 CACTGGGGAGGGAGGGCAGTGGG + Intronic
922050837 1:221989348-221989370 CAGATGAGGTGGAGGGCAGGTGG - Intergenic
922173746 1:223178710-223178732 GCATGGTGGGGGAGGGGAGGGGG + Intergenic
922423657 1:225475328-225475350 CTGCGGTGGACGAGGGCAGGTGG + Intergenic
922503020 1:226110552-226110574 CAGTGGTGGCGGGGGTCGGGGGG - Intergenic
922717374 1:227884606-227884628 GAGAGGCGGGGCAGGGCAGGGGG + Intergenic
922866595 1:228866017-228866039 CAGGGATGGTGGGGGGCAGGGGG + Intergenic
923035900 1:230285011-230285033 CACTGGTGGTGGAAGGCAGAGGG + Intergenic
923092650 1:230751850-230751872 GTGGGGTGGGGGAGGGGAGGGGG + Intronic
923134407 1:231105407-231105429 CAGTGGCGGGGGTGGGGAGTGGG + Intergenic
923237655 1:232049762-232049784 CAGAGGTTGTGGGGGGCAGGTGG + Intergenic
923296993 1:232603655-232603677 CAGAGGTGTGGGAGAGCTGGGGG + Intergenic
923602086 1:235412182-235412204 GAGGGGAGGGGGAGGGGAGGGGG - Intronic
923745191 1:236693587-236693609 CCGTGGTGTGGGAGAGGAGGAGG - Intronic
923959218 1:239057793-239057815 TTGTGGTGGGGGTGGCCAGGAGG - Intergenic
924436552 1:244048600-244048622 CGGGGGAGGGGGAGGGGAGGGGG - Intergenic
924664620 1:246058325-246058347 AGGTGGGGGAGGAGGGCAGGAGG + Intronic
924946063 1:248847746-248847768 CAGCGGTGGGGTGGGGCAGCAGG - Exonic
1062832886 10:617653-617675 CAGGGGTGGGGGTGGGGGGGTGG - Intronic
1062923360 10:1296587-1296609 AAACGTTGGGGGAGGGCAGGGGG + Intronic
1063303146 10:4871693-4871715 CAGTTGTGGGGGTGGGGTGGGGG + Intergenic
1063375352 10:5551296-5551318 GAGAGGTGAAGGAGGGCAGGAGG + Intergenic
1063410427 10:5832953-5832975 CACTGGTGGGATGGGGCAGGGGG - Intronic
1063595983 10:7435988-7436010 GGGGGGTGGGGGAGGGCAGCAGG + Intergenic
1063624501 10:7676568-7676590 CAGTGGTGGGGGAATGGGGGAGG - Intergenic
1063808121 10:9671079-9671101 TAGTGGTGGGGGAGGCTGGGCGG + Intergenic
1063812480 10:9728488-9728510 GTGTGTCGGGGGAGGGCAGGGGG - Intergenic
1063881809 10:10539445-10539467 CAGAGGTGGGGGTGGGGTGGCGG - Intergenic
1064059666 10:12127551-12127573 GGGGGGTGGGGGGGGGCAGGGGG - Intergenic
1064131477 10:12713680-12713702 CAGATGTGGGGAAGGGCAGGTGG + Intronic
1064178804 10:13098128-13098150 CAGTGGTGGGGTCGGGGTGGGGG - Intronic
1064476229 10:15691688-15691710 CAGAGGCTGGGGAGGGCAGAAGG + Intronic
1064575102 10:16737016-16737038 GGATGGTGGGGGAGGGGAGGGGG + Intronic
1066011952 10:31202391-31202413 CAGGGGTGGGGCAGAGCAGGAGG - Intergenic
1066682521 10:37947857-37947879 CAGTGGAGGGGCTGGGCTGGAGG + Intergenic
1066746668 10:38608182-38608204 CACTGGTGGGGGAGGGGTGGGGG + Intergenic
1066757185 10:38722864-38722886 CAGTGGTGGGGCTGGGGAGTAGG - Intergenic
1067095321 10:43295636-43295658 CAGTGGAGGGGGCGGTCATGAGG + Intergenic
1067218505 10:44323709-44323731 CAGTGGTGGTGGAAGGAAAGAGG + Intergenic
1067336804 10:45373547-45373569 CAGTGGTCGCGGGAGGCAGGCGG - Intergenic
1067343013 10:45419497-45419519 CGGGGCTGGGGGAGGGCCGGTGG - Intronic
1067456918 10:46425616-46425638 GAGGGCTGGGGGAGGGCCGGGGG - Intergenic
1067560637 10:47302014-47302036 AAGTGGAGGAGGAGGGCATGGGG - Intronic
1067568795 10:47356999-47357021 CAGTGATGGAGGAGGCCCGGGGG - Intronic
1067630286 10:47959023-47959045 GAGGGCTGGGGGAGGGCCGGGGG + Intergenic
1067777590 10:49174702-49174724 CAGTGGTGGGGGGTGGTATGAGG + Intronic
1067854874 10:49783571-49783593 GAGGGGAGGGGGAGGGAAGGGGG + Intergenic
1068183317 10:53551060-53551082 CAGAAGTGGGGGAGGGGGGGAGG - Intergenic
1068493540 10:57755296-57755318 CGGGGGTGGGAGAGGACAGGAGG + Intergenic
1068585426 10:58792841-58792863 CAGGGGAGGGGGAGGGAAGGGGG - Intronic
1068710684 10:60130207-60130229 CAGAGCTGGGGGAGGGGAGTGGG - Intronic
1068805190 10:61187191-61187213 CAGGTGTGGAGAAGGGCAGGGGG + Intergenic
1068878047 10:62018604-62018626 CAGTGGTGGGGGCGGGGGAGGGG - Intronic
1069035967 10:63646214-63646236 CGGCGGGTGGGGAGGGCAGGGGG + Intergenic
1069224751 10:65929022-65929044 CTGTTGTGGGTGAGGGGAGGGGG - Intronic
1069613837 10:69793429-69793451 CAGTGGTGGGGGCGGGCAGAGGG + Intergenic
1069785704 10:70986531-70986553 GAGTGATGGGGGAGGGGAGAAGG + Intergenic
1069883152 10:71606739-71606761 CAGGGGTGAGGGTGGGAAGGTGG + Intronic
1069919859 10:71810025-71810047 CAGTGATGTTGGAGAGCAGGTGG - Exonic
1069962456 10:72087152-72087174 CAGGGGTGAGGCAGGGCGGGCGG - Intronic
1070158336 10:73850416-73850438 CTGCGGTGGGGGGGGGCGGGCGG - Intronic
1070169209 10:73920094-73920116 CTGAGGTGGGAGAGGGCAGAGGG - Intronic
1070761081 10:79024809-79024831 GAGTGGTGGGGGAGGGGACCTGG + Intergenic
1070780588 10:79135424-79135446 CTCTGTTGGGGGAGGCCAGGAGG + Intronic
1070856196 10:79609935-79609957 CAGTGCAGGGTGGGGGCAGGTGG - Intergenic
1071017484 10:81015070-81015092 CAGAGGGGAGGGAGGGAAGGAGG + Intergenic
1071204198 10:83255019-83255041 GAAGGGTGGGGGAGGGGAGGGGG - Intergenic
1071275351 10:84049103-84049125 CAGTGGGGGTGGAGGGTAGAAGG + Intergenic
1071292654 10:84198600-84198622 CTGTGGTGGTGGAGAGCAGGTGG - Intronic
1071463621 10:85920753-85920775 CTGTGGGCGGGGAGGGAAGGGGG + Intronic
1071569688 10:86690228-86690250 CACTGGGAGGGGAGGGAAGGAGG - Intronic
1072066049 10:91872685-91872707 GAGGGGAGGGGGAGGGAAGGGGG + Intergenic
1072349800 10:94545727-94545749 CAGCGGGGCGGGAGGGCGGGTGG + Intronic
1072390200 10:94976604-94976626 TAGTGTGGGGGGAGGGGAGGTGG - Intronic
1072764893 10:98087348-98087370 CAGTAGTGGGGCAGGGCAGAGGG + Intergenic
1072809968 10:98453850-98453872 AGGTTGTGGGGGAGGGGAGGAGG + Intergenic
1072824622 10:98594295-98594317 TTGTGGTGGGGAAGGGGAGGCGG - Intronic
1073073861 10:100811130-100811152 GAGAGGTGGGGGAGGGAAGATGG + Intronic
1073119433 10:101112554-101112576 CTGAGGTGGAGGTGGGCAGGAGG + Intronic
1073199376 10:101722561-101722583 CTTTGGTGGGGCAAGGCAGGAGG - Intergenic
1073470691 10:103720441-103720463 CAGTGGGGGAGGTGGGCAGCAGG - Intronic
1073843808 10:107528970-107528992 CTGTGGTGGGGAGGGGGAGGGGG + Intergenic
1073961744 10:108939070-108939092 AGGTGGTGGGGAAGGGCTGGAGG + Intergenic
1074151037 10:110759994-110760016 CAGTGGTGGTGGGGGGCACAGGG + Intronic
1074192861 10:111152667-111152689 GAGCGGTGTGGGAGGGCAGCAGG + Intergenic
1074270908 10:111952612-111952634 CACTGGGGTGGGAGGGCTGGTGG - Intergenic
1074276256 10:112005403-112005425 CCCTGGTGGGGGATGCCAGGAGG + Intergenic
1074290410 10:112133848-112133870 CAGTGGTGGGAGAGTGGAGAGGG - Intergenic
1074627724 10:115211758-115211780 CTGTTGTGGGTGAGGGGAGGGGG - Intronic
1074738800 10:116464527-116464549 CACTGCTGTGGTAGGGCAGGTGG + Intronic
1074744128 10:116514642-116514664 CTGTGATGGGGGAGGGAAGTGGG + Intergenic
1074775793 10:116767349-116767371 CACTGGTGGGGGAGGGGTGCAGG - Intergenic
1075048765 10:119166327-119166349 CTGTGCTGGGGAAGGGCAGGTGG - Intergenic
1075180513 10:120206936-120206958 CAGTGGAGCTGGAGGGAAGGAGG - Intergenic
1075628913 10:123987759-123987781 GGATGGTGGGGGTGGGCAGGAGG + Intergenic
1075783684 10:125033693-125033715 CAGTGCTTGGGGTGGGCAGGGGG - Intronic
1075786460 10:125053420-125053442 CTGTGTTGGGGGATGCCAGGAGG - Intronic
1076019919 10:127064380-127064402 CATTGAAGAGGGAGGGCAGGAGG + Intronic
1076035511 10:127196172-127196194 CGGTGGAGGGGGCGGGCAGCAGG - Intronic
1076170431 10:128314889-128314911 TAATGGTGGGGGAGGGGAGGGGG - Intergenic
1076178643 10:128388045-128388067 CAGTGGAGGTGGGAGGCAGGAGG + Intergenic
1076405944 10:130212666-130212688 CAGTGGGAGGGGAGGGGAAGGGG - Intergenic
1076445205 10:130509579-130509601 CAGAGCTGGGAGAGGGCAGAGGG + Intergenic
1076520286 10:131076917-131076939 CAGTGATGGGGGAAGACAGAGGG + Intergenic
1076595830 10:131623685-131623707 CAGAGGTGGGGGAGAGGTGGGGG + Intergenic
1076616552 10:131759045-131759067 CAGGGCTGGGGGAGGGTGGGCGG - Intergenic
1076732353 10:132445041-132445063 CAGTTGTGGGGGTGGGGGGGAGG + Intronic
1076765482 10:132630777-132630799 CGGTGGTGGGGGCCGGGAGGCGG + Intronic
1076994137 11:290082-290104 CAGGGGTGAGGCAGGCCAGGTGG - Intronic
1077079767 11:720044-720066 AGGTGCTGGGGGTGGGCAGGTGG - Exonic
1077082376 11:729791-729813 CAGCTGTGGGGGAGGACAGAAGG - Intergenic
1077095371 11:796930-796952 CAGGGGTGGGGGGGGCTAGGAGG - Intronic
1077160208 11:1109243-1109265 CTCTGGTGAGGGAGGGCAGCAGG - Intergenic
1077172941 11:1176468-1176490 GAGTGATGGGGCAGGGCACGGGG - Intronic
1077173948 11:1180417-1180439 CAGAGGCGGGGTTGGGCAGGTGG - Intronic
1077185774 11:1234750-1234772 CAGCGGGCAGGGAGGGCAGGGGG + Intronic
1077185783 11:1234766-1234788 CAGGGGGCGGGGAGGGCAGGGGG + Intronic
1077190129 11:1252532-1252554 CACGGGAGGTGGAGGGCAGGCGG - Intronic
1077204078 11:1333189-1333211 GAGTGGAGGGAGAGGGCGGGAGG + Intergenic
1077208820 11:1358579-1358601 CCGTGCGGGGGGATGGCAGGTGG - Intergenic
1077251924 11:1564555-1564577 GGGTGGGGGAGGAGGGCAGGAGG - Intronic
1077264575 11:1642414-1642436 CAGTGGAGGGGGCGGGCCAGGGG - Intergenic
1077288627 11:1778639-1778661 GAGTGGTGGGTGGGGACAGGTGG + Intergenic
1077299601 11:1840911-1840933 GAGTGGTGGCGGCGGGCCGGCGG + Intronic
1077368745 11:2171888-2171910 CAGGGGTGGGGGATGTAAGGAGG - Intergenic
1077484245 11:2831652-2831674 CAGTGGTGGGGAAGGGGAAAGGG - Intronic
1077489784 11:2855426-2855448 CCGTCCTGGGGGTGGGCAGGAGG + Intergenic
1077551964 11:3204405-3204427 TGGGGGTGCGGGAGGGCAGGTGG + Intergenic
1077675285 11:4189470-4189492 TAGGGGTGGGGGAGGTGAGGAGG - Intergenic
1077915969 11:6611887-6611909 CAGCGGCGGGTGAGGGCAGAGGG - Intronic
1077946983 11:6910557-6910579 CTGTTGTGGGGTGGGGCAGGGGG + Intergenic
1078225135 11:9384863-9384885 TAGCGGTGGCGGCGGGCAGGCGG + Intronic
1078379041 11:10823054-10823076 CAGTGTTGGGAGAGGGAAAGAGG + Intronic
1078452809 11:11453028-11453050 CAGGGCTGGGTGAGGGCAGGGGG - Intronic
1078609552 11:12808593-12808615 CAGTGGGGAGGGGTGGCAGGTGG - Intronic
1078706442 11:13748312-13748334 CAGTGGTTAAGGAGAGCAGGAGG - Intergenic
1078845398 11:15114947-15114969 CAGTGGTGGCGGGGCGCAGCTGG - Intronic
1079085356 11:17441040-17441062 ACCTGGTGGGGGAGGGAAGGTGG - Intronic
1079121494 11:17688296-17688318 CAGAGGAGGGAAAGGGCAGGGGG + Intergenic
1079275437 11:19031817-19031839 CTGTCGTGGGTGGGGGCAGGGGG - Intergenic
1079308133 11:19342634-19342656 GAGAGGTGGGGGAGGGAGGGAGG + Intergenic
1079366470 11:19814372-19814394 CAGGGGAGGGAGAGGGCAGTGGG - Intronic
1079390924 11:20021678-20021700 CAGAGGTGGGGGTGGGCAGTGGG - Intronic
1079560062 11:21811080-21811102 CAGGCATGGGGGTGGGCAGGAGG + Intergenic
1079765514 11:24387569-24387591 CTGTGGTGGGGTGGGGGAGGGGG - Intergenic
1080312461 11:30910999-30911021 CAGTGGTGGCTGCAGGCAGGTGG - Intronic
1080360911 11:31512778-31512800 GAGGGGGGGCGGAGGGCAGGGGG - Intronic
1080366742 11:31582883-31582905 CTGTGGTGGGGGCGGGGTGGGGG + Intronic
1080875051 11:36267248-36267270 CAGTGGTGGGGAGGAGCAGGTGG - Intergenic
1080903271 11:36515630-36515652 CAGTGGAGGGGCAGGGCAGTGGG + Intronic
1081235594 11:40643621-40643643 CCGTGCTGGTGGACGGCAGGGGG - Intronic
1081524828 11:43920297-43920319 GGGGGGCGGGGGAGGGCAGGAGG - Intergenic
1081654164 11:44846402-44846424 CAGTGATGGGGGAGGGCGCTTGG + Intronic
1081812643 11:45922392-45922414 CAGAGCGGGGGCAGGGCAGGGGG + Intronic
1081813278 11:45924897-45924919 CAGTGGTGAGGGGAGGCAGGCGG + Intronic
1081834473 11:46142882-46142904 CTGTGGTGGGGGTGGGGACGGGG - Intergenic
1082005049 11:47414673-47414695 GAAGGGTGGGGAAGGGCAGGGGG + Intronic
1082743535 11:56937805-56937827 CGGTGGTGGGTGGGGGGAGGGGG - Intergenic
1082785262 11:57313184-57313206 CAGTGATGGGGGAGGGAGGCGGG + Exonic
1083148538 11:60775812-60775834 ATGTGGTGAGGGAGGGCAGCTGG - Exonic
1083226846 11:61290763-61290785 GAGTGGTGGGGGAGGGGGAGGGG - Intronic
1083228498 11:61300068-61300090 GAGAGGAGGGGGAGGGCAGCAGG + Exonic
1083264773 11:61541671-61541693 GAGAGATGGGGGAGGGCTGGTGG + Intronic
1083266019 11:61547093-61547115 CAGAGGTGGGTGGGGGCAGGAGG + Intronic
1083612766 11:64011990-64012012 CAGTGGAGGTGGTGGGGAGGGGG - Intronic
1083641479 11:64148102-64148124 GAGTGAGGGGGGCGGGCAGGGGG + Intronic
1083679515 11:64344704-64344726 CAGTGGTGTCGCAGAGCAGGAGG + Exonic
1083740920 11:64711487-64711509 CTGTGGTGTCGGGGGGCAGGGGG - Intronic
1083765600 11:64840066-64840088 CAGGGGTTGGGCAGGGCAGCGGG + Intronic
1083775163 11:64891102-64891124 CAGGGATAGGGGAGGGCCGGGGG - Intergenic
1084006556 11:66326403-66326425 CAGTGGGGGTGGAGGGGTGGAGG + Intergenic
1084104925 11:66975073-66975095 GAGGGGAGGGGGAGGGGAGGGGG + Intergenic
1084120436 11:67065993-67066015 CAGGGGTGGGGCAGGGTGGGAGG + Intronic
1084188678 11:67488995-67489017 CTGTGGTGGGGGTGAGGAGGGGG + Intronic
1084214414 11:67639772-67639794 CTGTGCGGGAGGAGGGCAGGTGG + Intergenic
1084313774 11:68331961-68331983 CTGGGCTGGGAGAGGGCAGGTGG + Intronic
1084343263 11:68523701-68523723 AAGGGGGGGGGGGGGGCAGGGGG - Intronic
1084413048 11:69014992-69015014 CAGTGGGGCAGCAGGGCAGGGGG + Intergenic
1084478211 11:69400860-69400882 AACCGGTGGGGGTGGGCAGGAGG - Intergenic
1084581726 11:70028444-70028466 TGGGGGTGGGGGAGGGCAGAAGG - Intergenic
1084818247 11:71664007-71664029 CTGTGGTGGGGGAGGTGATGTGG + Intergenic
1084945715 11:72637283-72637305 TAGGGCTGGGGGAGGGGAGGCGG - Intronic
1085041869 11:73331444-73331466 CAGGAGTGGGGGAGGGGAGGTGG - Intronic
1085265599 11:75236248-75236270 CAGCAGTGGGGGAGGGGAGGGGG + Intergenic
1085351006 11:75797811-75797833 CAAGGGTGGGGGAGGGTAGAGGG + Intronic
1085386696 11:76161827-76161849 CTGTGGTGGGGGTGGGGAGTGGG - Intergenic
1085507561 11:77068815-77068837 CAGTGCTGGGGGAAGGTAGGTGG + Intronic
1086415932 11:86588951-86588973 GGGAGGTGAGGGAGGGCAGGGGG - Intronic
1086680861 11:89670112-89670134 GAGAAGTGGGGGAGTGCAGGTGG - Intergenic
1087155074 11:94894275-94894297 CAGTGGTGTGGAGAGGCAGGGGG + Intergenic
1087370750 11:97280283-97280305 CAGTGGTGGTGGTGGCCAGAGGG + Intergenic
1088242217 11:107784227-107784249 CTGGGGTGAGGAAGGGCAGGTGG + Intergenic
1088376944 11:109151719-109151741 GAGGGGAGGGGGAGGGGAGGAGG - Intergenic
1088756528 11:112889834-112889856 CAGAGGATGGGGAGGGCAGCAGG - Intergenic
1088903725 11:114138115-114138137 AAGTGGTGAGGGAGGGCAGGAGG + Intronic
1088976619 11:114821925-114821947 AGGTGGTGGGGGAGGGGAGATGG - Intergenic
1089073134 11:115716691-115716713 CGGGGATGGGGGAGGGGAGGAGG - Intergenic
1089180382 11:116579570-116579592 GAGTGGTGAGGAAGGGCAGCTGG - Intergenic
1089195788 11:116693342-116693364 CATTGGTGGGTGGTGGCAGGGGG + Intergenic
1089196433 11:116696351-116696373 CAGTGGAGAGGGCGGGGAGGTGG - Intergenic
1089226773 11:116930765-116930787 GATTGGTGGGGGTGGGGAGGGGG - Intronic
1089346821 11:117796396-117796418 GAGGGGTGGGGTAGGGCCGGGGG + Intronic
1089387705 11:118079050-118079072 GAGGAGCGGGGGAGGGCAGGTGG + Intronic
1089567317 11:119378553-119378575 AAGAGCTGGGGGAGGGGAGGAGG + Intronic
1089618225 11:119707228-119707250 CAGTGGTGAGGTTGGGCTGGTGG - Intronic
1089628316 11:119765953-119765975 CAGTGGTTGTGGGGGGCAGTGGG - Intergenic
1089762156 11:120735799-120735821 CAGTGGTGGTGGAGGCCATGAGG - Intronic
1090053505 11:123401658-123401680 CAGGGGTGGGGGAAGGAAGACGG + Intergenic
1090217635 11:124984003-124984025 CAGTGGCCGTGCAGGGCAGGGGG + Intronic
1090225845 11:125071827-125071849 CAGTGCTGGTGGAGGGCTTGTGG + Intronic
1090394097 11:126407683-126407705 GAGTGGGGGGAGCGGGCAGGGGG - Intronic
1090397365 11:126427885-126427907 AAGTGATGGTGGAGGACAGGTGG + Intronic
1090432339 11:126656562-126656584 CAGTGCAGGGGCTGGGCAGGCGG - Intronic
1090547687 11:127783165-127783187 CAGTGGGGAGGGTGGGGAGGGGG + Intergenic
1090694269 11:129221720-129221742 CAATAGTGGGCAAGGGCAGGAGG + Intronic
1090800370 11:130167608-130167630 CTGTGATAGGGGAGGGAAGGGGG - Intronic
1091044182 11:132311057-132311079 AAGGAGTGGGGGAGGCCAGGAGG + Intronic
1091201495 11:133784227-133784249 AGGTGTTGGGGGAGGGCAAGGGG + Intergenic
1091208852 11:133839525-133839547 CTGTTGTGGGGTAGGGGAGGGGG + Intergenic
1091211331 11:133864020-133864042 CAGTGGCGGGGGAGGGGCGGGGG + Intergenic
1091376352 12:26992-27014 CTGTGGTGGGGGCGTGCCGGTGG - Intergenic
1091527912 12:1323965-1323987 CAGGGAGGTGGGAGGGCAGGGGG - Intronic
1091590004 12:1837227-1837249 CGGTGGGAGGGGAGGGCAGTTGG + Intronic
1091675601 12:2486809-2486831 AGGTGGGGGAGGAGGGCAGGTGG + Intronic
1091682504 12:2537130-2537152 AAGTGGAGGAGGAGGGCAGTGGG - Intronic
1091867093 12:3849639-3849661 CAGAGGCTGGGAAGGGCAGGGGG + Intronic
1092065867 12:5589296-5589318 CTGGGATGGGGGAGGGGAGGAGG + Intronic
1092096034 12:5842550-5842572 CAGTGGTGGTGGCGTGCTGGAGG - Intronic
1092126915 12:6080950-6080972 CAGTGGGTGGGGTGGGCAGCAGG + Intronic
1092138714 12:6167882-6167904 CAGTGGTGGCGGTGGAGAGGCGG + Intergenic
1092160471 12:6312780-6312802 CAGTGGTGGGTAGGGACAGGAGG + Intronic
1092345464 12:7711037-7711059 CAGTGGTGGTGGTGGGGCGGGGG + Intergenic
1092377346 12:7966921-7966943 GAGAGGTGGCAGAGGGCAGGGGG + Intergenic
1092424695 12:8365361-8365383 GTGTGGTGGGGGAGGGGATGTGG - Intergenic
1092499347 12:9030224-9030246 TAGTGGATGGGGTGGGCAGGTGG + Intergenic
1092536650 12:9395253-9395275 CTCTGGTGTGGCAGGGCAGGAGG + Intergenic
1092817268 12:12322990-12323012 GAGGGGAGGGGGAGGGGAGGAGG + Intergenic
1092817323 12:12323092-12323114 GAGGGGAGGGGGAGGGGAGGGGG + Intergenic
1092817340 12:12323119-12323141 GAGGGGAGGGGGAGGGGAGGGGG + Intergenic
1093234578 12:16591182-16591204 CTGGGGTGTGGGAGAGCAGGAGG - Intronic
1093563303 12:20570157-20570179 CAGTGCTTTGGGAGGCCAGGTGG + Intronic
1093678220 12:21968814-21968836 CAGAGGTTGGGAAGGGCAGCTGG + Intergenic
1093921704 12:24866369-24866391 CAGCGGTGGCGGGGGGCGGGAGG - Intronic
1094065689 12:26358769-26358791 CACAGATGGGGGAGGGGAGGGGG - Intronic
1094202788 12:27810347-27810369 CTTTGGTGAGGGAGTGCAGGCGG + Intergenic
1095327700 12:40917049-40917071 CAGTGGTGGGGGCGGGGGGGGGG + Intronic
1095339147 12:41067611-41067633 CTGTGGTGGGGTGGGGGAGGGGG + Intronic
1096071886 12:48780066-48780088 CAGTGGGGGAGAAGGGAAGGGGG + Intronic
1096114933 12:49050252-49050274 CAGGGCTGGGGCAGGGCTGGGGG + Exonic
1096230520 12:49894365-49894387 CTGCGGTGGTGGAGGGCTGGTGG - Intronic
1096252229 12:50040647-50040669 CAGAGGTGTGGGAGGGTGGGTGG - Intergenic
1096336935 12:50764044-50764066 CGGGGGCGGGGGAGGGGAGGGGG - Intronic
1096356885 12:50948871-50948893 GAGGGGAGGGGGAGGGGAGGGGG + Intergenic
1096459078 12:51812135-51812157 CAGTGGGGGGCAGGGGCAGGGGG - Exonic
1096466386 12:51849181-51849203 TAGGGGTGGGGGACGGCATGGGG + Intergenic
1096528403 12:52228109-52228131 GAGGGGAGGGGGAGGGGAGGGGG - Intergenic
1096548320 12:52356357-52356379 CAGGGGTGAAGGAGGGCAGCCGG + Intergenic
1096567964 12:52496830-52496852 CAGTGTGGAGGGAGGACAGGAGG + Intergenic
1096627844 12:52906241-52906263 CAGGGGTTGGGGGGGGCAAGAGG + Intronic
1096653768 12:53075703-53075725 CAGTGGGTGGGCAGAGCAGGGGG - Intronic
1096700636 12:53380533-53380555 CCGTGGCCGGGGCGGGCAGGGGG - Intronic
1096764081 12:53868774-53868796 CAGTGGTGGGAGATGGCAGCAGG + Intergenic
1096796768 12:54082610-54082632 CCGGGCTGGGGGAGGGGAGGCGG + Intergenic
1096802975 12:54123768-54123790 GAGTTGTGGGGGAGGGTGGGTGG - Intergenic
1096914862 12:55020320-55020342 CAGTGGTTGGGGTGGTAAGGGGG + Intronic
1097110248 12:56652459-56652481 GAGGGGAGGGGGAGGGGAGGGGG + Intergenic
1097186960 12:57201162-57201184 CAGAGGTGGTGGTGGGCCGGTGG + Intronic
1097563750 12:61240515-61240537 CAGGGATGGAGGTGGGCAGGGGG + Intergenic
1098050307 12:66446088-66446110 TGGTGGTGGGGGGCGGCAGGAGG - Intronic
1098347726 12:69524066-69524088 CATGGCTGGAGGAGGGCAGGGGG + Intronic
1098364993 12:69693098-69693120 CAGAGGTGGGGGAGAGAAAGTGG - Intronic
1098597954 12:72295118-72295140 CTGTGGTGGGGGGTGGCTGGGGG + Intronic
1099144209 12:79018338-79018360 CGGTTGTGGGGTAGGGGAGGGGG + Intronic
1099779672 12:87177400-87177422 CTGTGGTGGGGTGGGGGAGGGGG + Intergenic
1100357230 12:93842813-93842835 CGGGGGTGGGGGAGAGTAGGGGG + Intronic
1100691010 12:97038504-97038526 CAGAGGTTGGGGTGGGGAGGGGG - Intergenic
1100695436 12:97087647-97087669 GACTGGTTGGGGTGGGCAGGGGG + Intergenic
1101049055 12:100842059-100842081 CAGTGGGGGGGGGGGGGGGGTGG - Intronic
1101249665 12:102919595-102919617 CAGAGGTGGGGAAGGGTAGTAGG - Intronic
1101774302 12:107779573-107779595 CAGAGGAGGGGGAGGGGATGAGG + Intergenic
1101801718 12:108028066-108028088 CAGAGGTGGGGTGGGGCAGTGGG + Intergenic
1102046804 12:109834464-109834486 GGGGGGTGGGGGAGGGCAGCCGG + Intergenic
1102260169 12:111438486-111438508 CTGGGGTGGGGGATGGCAGTAGG + Intronic
1102577111 12:113862849-113862871 GCCTGGTGGGGGAGGGAAGGAGG - Intronic
1102606775 12:114073900-114073922 AGGTGGTGGGGGGGGGCATGGGG - Intergenic
1102670935 12:114618212-114618234 AAGTGGGGAGGGAGGGGAGGAGG + Intergenic
1102789871 12:115635980-115636002 AAGAGGAGGGGGAGGGGAGGAGG + Intergenic
1102929188 12:116849552-116849574 CAGAGGTGGTGGAGGGCAAGAGG - Exonic
1103125675 12:118420292-118420314 CAGTGGTGTGGACAGGCAGGGGG + Intergenic
1103443624 12:120980365-120980387 CTGGGGTGGGGGAGGGCTGGTGG + Intronic
1103450958 12:121028620-121028642 CAGTAGGGGGGGCGGGCGGGGGG - Intronic
1103507112 12:121449089-121449111 CTGTGGTGGGGTGGGGCAGATGG + Intronic
1103519754 12:121530525-121530547 CAGGGGTGGGGTAGGGTGGGAGG - Intronic
1103536581 12:121637691-121637713 AAGTGCTGGGGGTGGGGAGGTGG + Intronic
1103556884 12:121771725-121771747 CAGTGCTGGGGGCTGGGAGGTGG - Intronic
1103619343 12:122176947-122176969 CAGTGGTGGCTGGCGGCAGGGGG - Intronic
1103693608 12:122796180-122796202 GGGCGGTGGGGGAGGGCAGGTGG - Intronic
1103703719 12:122860533-122860555 CCTGGGTGGGGGGGGGCAGGGGG + Intronic
1103747138 12:123132674-123132696 CAGGGGTTGGGGAGGGGAGATGG - Intronic
1103965613 12:124637639-124637661 CAGGGGTGGGGGTGGTGAGGAGG - Intergenic
1104004930 12:124885212-124885234 CGGTGGAGGGGGAAGGGAGGAGG - Intergenic
1104010233 12:124925163-124925185 GAGAGATGGGGGAGAGCAGGAGG + Intergenic
1104015375 12:124958305-124958327 CAGGTCTGGGGGAAGGCAGGAGG + Intronic
1104042632 12:125140258-125140280 CTGGTGTGGGGGTGGGCAGGGGG + Intronic
1104047558 12:125173860-125173882 GAGTGGGGGGGGTGGGCTGGTGG + Intergenic
1104087741 12:125492146-125492168 GAGCGGTGGGGGCGGGCAGCAGG - Intronic
1104415472 12:128594030-128594052 GGGTGGTGGGGGAGGGGCGGTGG - Intronic
1104674482 12:130703479-130703501 GAGGGATTGGGGAGGGCAGGCGG - Intronic
1104854564 12:131895700-131895722 CAGTGCTGGGGGAGGGGGCGTGG + Intronic
1104936777 12:132368817-132368839 CAGAGCCGGGGGAGGGCAGTGGG - Intergenic
1104958543 12:132477426-132477448 CTGTGGTGGGGGAGGGGTGGGGG - Intergenic
1105070403 12:133231134-133231156 CAGTGGAGATGGAGGGCAGGTGG - Intronic
1105202340 13:18191146-18191168 GAGTGGGTGGGGAGGGCAAGAGG + Intergenic
1105404048 13:20119021-20119043 CAGGGGCGGGGGAGGACACGGGG - Intergenic
1105649994 13:22366632-22366654 CAGAGGTGGGAGAGGGTAGGGGG + Intergenic
1105708493 13:22983180-22983202 CGCAGGTGCGGGAGGGCAGGAGG + Intergenic
1105865928 13:24459912-24459934 CAGTGGAGGGGGAGTGGTGGAGG - Intronic
1106012303 13:25836591-25836613 CAGAAGTGGAGGAGGGCAGTGGG - Intronic
1106016747 13:25876470-25876492 CTGTGATGGGGAAGGCCAGGTGG + Intronic
1106080161 13:26493772-26493794 CAGAGGTGGGGAAGGGCAATAGG + Intergenic
1106394547 13:29367439-29367461 CACTGGTGGAGGCAGGCAGGAGG + Intronic
1106512601 13:30424183-30424205 CAGAGGTGGGGGAAGACAGCTGG - Intergenic
1106675806 13:31956743-31956765 CAGAGGTTGGGAAGGGCAAGGGG - Intergenic
1106797046 13:33217360-33217382 CAGTGGAGGTGAAAGGCAGGAGG - Intronic
1107300719 13:38963094-38963116 CAGTAGTGAAGGAGGGCATGGGG - Intergenic
1107420328 13:40240107-40240129 CAGTGTGGAGGGAGGGCAGGGGG - Intergenic
1107484453 13:40813108-40813130 GGGGGGGGGGGGAGGGCAGGTGG - Intergenic
1107697621 13:43015850-43015872 CAGTGGAAGGAGAGGGGAGGAGG - Intergenic
1107874445 13:44777713-44777735 CAGGGATGGGAGAGGGTAGGGGG + Intergenic
1107880351 13:44827066-44827088 TAGTGGAGGGGTAGGGCAGGTGG - Intergenic
1108026117 13:46179744-46179766 CAGTGGCGGGGGAGGGGATGGGG + Intronic
1108180659 13:47836847-47836869 CAGTGCTGGGGAATGGCAGCAGG + Intergenic
1108203723 13:48067181-48067203 CAGTGGTTGGGGGGGGAGGGAGG - Intronic
1108272464 13:48774870-48774892 CAGAGTTGGGGCTGGGCAGGTGG - Intergenic
1108409086 13:50129907-50129929 CAGTGGTGGGCGGGGGTGGGAGG - Intronic
1108415720 13:50196473-50196495 GATTGGTGGGGGCCGGCAGGGGG - Intronic
1108631047 13:52282501-52282523 CTGTGGTGGGGTAGGGGAAGGGG + Intergenic
1108645325 13:52421356-52421378 CAGAGGCTGGGGAGGGTAGGTGG + Intronic
1108839355 13:54593263-54593285 CAGTGGTGGGAGGGTTCAGGTGG - Intergenic
1109157489 13:58928748-58928770 CAGGGGTTGGGGAGGGTGGGAGG + Intergenic
1109602304 13:64647748-64647770 CAGTGGTTGGTGAGGGTATGGGG + Intergenic
1111091269 13:83451469-83451491 CTGTTGTGGGGGAAGGGAGGAGG - Intergenic
1111580800 13:90220653-90220675 CTGTTGTGGGGGTGGGGAGGGGG + Intergenic
1111597235 13:90427745-90427767 CAATGGTGGGGGAAGGTGGGTGG - Intergenic
1112181972 13:97091921-97091943 CAGAGGCTGGGGAGGGAAGGAGG + Intergenic
1112306618 13:98280261-98280283 GTGTGGAGGGGGAGGGCATGGGG - Intronic
1112727323 13:102319439-102319461 GAGGGATGGGGGAAGGCAGGAGG - Intronic
1113618205 13:111695795-111695817 CAGTGGGGCAGGATGGCAGGAGG - Intergenic
1113623736 13:111781056-111781078 CAGTGGGGCAGGATGGCAGGAGG - Intergenic
1113692679 13:112322781-112322803 CTGTGCTGGGGGTGGGCAGCAGG + Intergenic
1113794129 13:113047027-113047049 CAGTCGTGGTGGAAGGCAGCGGG + Intronic
1113808572 13:113123820-113123842 CAGAGGCTGGGGAGGGCAGGGGG - Intronic
1113841648 13:113364355-113364377 GAGGGGCGGGGGAGGGCCGGGGG + Intergenic
1113873466 13:113579362-113579384 CAACGGTGGGAGGGGGCAGGGGG - Intergenic
1113909714 13:113836325-113836347 AAGAGGAGGGGGAGGGGAGGAGG + Intronic
1113984688 13:114304165-114304187 CAGTGCTGGGGCAGGGCTGGTGG + Intronic
1114312231 14:21477606-21477628 CAGCGGTGGGGTAGGGTAGTGGG + Intronic
1114458427 14:22872134-22872156 CAGGGCTGGGGGCGGGGAGGCGG - Exonic
1114529790 14:23388550-23388572 GTGTGGGGGGTGAGGGCAGGGGG - Intronic
1114712335 14:24791272-24791294 CAGAGGATGGGGAGGGTAGGGGG + Intergenic
1115119994 14:29927650-29927672 CTGGGCTGGGGGAGGGCAAGGGG + Exonic
1115271863 14:31561550-31561572 CCGTGGTGCTGCAGGGCAGGGGG + Intronic
1115389789 14:32841975-32841997 GAGGGGAGGGGGAGGGGAGGGGG - Intergenic
1115399412 14:32939792-32939814 CTGGGGAGGGGGAGGGAAGGCGG + Intronic
1115498227 14:34027321-34027343 AAGGGGAGGGGGAGGGAAGGGGG + Intronic
1115498261 14:34027391-34027413 AAGGGGAGGGGGAGGGAAGGGGG + Intronic
1115906990 14:38211220-38211242 GAGTGGTGGTGGCGGGCGGGCGG - Exonic
1116430083 14:44836127-44836149 CCGGGGTGGGGGAGGGCAGAGGG - Intergenic
1117186753 14:53247542-53247564 CAGGGCCAGGGGAGGGCAGGGGG - Intergenic
1117200067 14:53381222-53381244 CAGTGGTTGGGATGGGGAGGAGG + Intergenic
1117246581 14:53892311-53892333 CAGGGGTGGGGGGGTGGAGGTGG - Intergenic
1117331477 14:54716861-54716883 AAGTTGCGGGGCAGGGCAGGTGG + Intronic
1118764771 14:68902392-68902414 GAGAGGTGGAGGCGGGCAGGAGG + Intronic
1118980591 14:70713146-70713168 CAGTTGTGGGGCAGGGTAGGGGG + Intergenic
1119182167 14:72612592-72612614 CAGGGAAGGGAGAGGGCAGGAGG + Intergenic
1119197771 14:72730185-72730207 CAGTGGTGGGTGCGGGGAGAGGG + Intronic
1119273161 14:73327896-73327918 GTGTGGTGGGGGAGGGCAGGCGG - Intronic
1119320690 14:73728497-73728519 CAGCGATGGAGGAGGGCGGGGGG - Intronic
1119387665 14:74267900-74267922 AAGGAGTGGGGGAGGGGAGGAGG - Intergenic
1119505274 14:75167424-75167446 CAGTGGTGGGGGTGGGGGCGAGG - Intronic
1119602184 14:75983585-75983607 CAGGGGTGGGGCAGTGGAGGAGG + Intronic
1119660253 14:76446030-76446052 CAATGGCGGGGGAGGGAAGAGGG + Intronic
1119804774 14:77475552-77475574 CACTGCAGGGAGAGGGCAGGCGG - Exonic
1119842059 14:77800487-77800509 CAGAGCTGGAGGAGGGCCGGAGG + Intronic
1119866808 14:77981140-77981162 CTGGGCTGGGGGAGGGCAGCAGG - Intergenic
1120844569 14:89114653-89114675 TGGTGGTGGGGTAGGGGAGGGGG + Intergenic
1121017658 14:90558191-90558213 CCTGGGTGGGGGATGGCAGGTGG + Intronic
1121081911 14:91115124-91115146 CAGTGCTGGAGGAGGGCAGCAGG + Intronic
1121744046 14:96274109-96274131 CAGGGGAGGGAGCGGGCAGGTGG + Intergenic
1121774808 14:96583662-96583684 GTGTGTTGGGGGAGGGCGGGTGG + Intergenic
1121835429 14:97087973-97087995 GAGTGGTGGGGGAGGGTGGTGGG + Intergenic
1121916006 14:97837424-97837446 GAGTGGAGAGGGAGGGCAGCAGG + Intergenic
1122031576 14:98916160-98916182 CACTGCTGGGAGAGGGCTGGGGG - Intergenic
1122415533 14:101547945-101547967 CGATGGTGGGGGGGGGGAGGAGG - Intergenic
1122516865 14:102314867-102314889 CAGGGGTGCAGGAGGGCAGAGGG + Intergenic
1122543778 14:102511295-102511317 CTGAGGTGGGGCAGGGCTGGTGG - Intergenic
1122619386 14:103046159-103046181 CTGAGGTGGAGGAGGGCTGGTGG - Intronic
1122625486 14:103083515-103083537 CAGGGGGGGGGGGGGGGAGGGGG - Intergenic
1122629071 14:103099192-103099214 CATGGGTGGGGGAGGGCATTAGG - Intergenic
1122692707 14:103538771-103538793 CACTGCTGGGGCAGGGCAGCAGG - Intergenic
1122721966 14:103727354-103727376 CAGAGGGGGCGGGGGGCAGGTGG - Intronic
1122784774 14:104158622-104158644 CAGTGGTGGGGATCAGCAGGGGG - Intronic
1122808565 14:104275920-104275942 CTGGGGTGGGGCAGGGGAGGGGG + Intergenic
1122924940 14:104895151-104895173 CAGGGGTGGGGGTGGCCATGGGG - Exonic
1122979332 14:105184609-105184631 GAGGGGTTGGGCAGGGCAGGTGG + Intergenic
1123123116 14:105927198-105927220 CAGTGCTGGCTGAGGACAGGCGG - Intronic
1123427856 15:20187502-20187524 CTGTGGTGGGGGTGGGCAAGAGG - Intergenic
1123977036 15:25563495-25563517 CAGTGGTTGGGGTGACCAGGGGG - Intergenic
1123988900 15:25668640-25668662 CATTGGTGGGGGAGGAAGGGAGG - Intergenic
1123989088 15:25670018-25670040 CAGGGCTGGGGGAGGGAACGAGG + Intergenic
1124037920 15:26073492-26073514 AAGTGGTGGCTGAGGGAAGGAGG + Intergenic
1124390126 15:29247680-29247702 CAGGGTTGGGGGAGGGAAGCTGG - Intronic
1124580889 15:30954011-30954033 CAGGGGTGGGGCAGGGAAGCAGG - Intronic
1124621932 15:31278851-31278873 CAGTGGGTGGGGTGGGCATGAGG + Intergenic
1125178691 15:36856700-36856722 GAGGGGAGGGGGAGGGAAGGGGG - Intergenic
1125186229 15:36933598-36933620 GTGTGGTGGGGGTGGGCGGGGGG + Intronic
1125576204 15:40757315-40757337 CTGTGGAGGGGGTGGGAAGGTGG - Intergenic
1125741164 15:41965948-41965970 GGGTGGTGGGGGTAGGCAGGAGG - Intronic
1125760114 15:42090569-42090591 CTGTGGTGGGGTAATGCAGGAGG + Intronic
1125760482 15:42092943-42092965 CTGTGGTGGGGCAATGCAGGAGG + Intronic
1126300986 15:47195952-47195974 TGGTGGTGGGTGAAGGCAGGTGG - Intronic
1126604803 15:50465341-50465363 GGGTGGTGGGGGAGGGGAGGGGG + Intronic
1127099513 15:55550900-55550922 CAGTGGTGGGGGATGGGAGGTGG + Intronic
1127147426 15:56038942-56038964 CAGTGTTGGGGGAAGGTGGGAGG - Intergenic
1127507599 15:59610971-59610993 GAGGGGAGGGGGAGGGGAGGGGG - Intronic
1127507616 15:59610998-59611020 GAGGGGAGGGGGAGGGGAGGGGG - Intronic
1127507623 15:59611009-59611031 GAGGGGAGGGGGAGGGGAGGGGG - Intronic
1127690897 15:61396292-61396314 CCTTGATGGGGCAGGGCAGGGGG + Intergenic
1127866973 15:63041468-63041490 CAGTGGGAGGGGAGGAGAGGGGG - Intergenic
1128014836 15:64334392-64334414 GACTGGGGGTGGAGGGCAGGGGG + Intronic
1128107574 15:65055898-65055920 CAGAGGCAGGAGAGGGCAGGGGG + Intronic
1128237310 15:66077133-66077155 GACTGGTGGGCCAGGGCAGGTGG - Intronic
1128291955 15:66484834-66484856 CAGTGTTGGGGGTAGGCAGGAGG + Intronic
1128451900 15:67810714-67810736 CTGTGGTGTGGGACGGTAGGAGG + Intergenic
1128532487 15:68464097-68464119 CAGTAGTGTGGGAGGTCAGATGG + Intergenic
1128677662 15:69623802-69623824 CAGTGCTGGGGGAGGCTAGGAGG - Intergenic
1128765378 15:70248111-70248133 CAGTGTTGGGGGTGGGCAGTGGG - Intergenic
1129191775 15:73941742-73941764 CAGCAGTGGGTGTGGGCAGGGGG - Intronic
1129313506 15:74727734-74727756 CTGTGGTGGGGGGTGGCGGGAGG - Intergenic
1129327623 15:74809465-74809487 GAGGGGTCGGGGAGAGCAGGTGG + Intergenic
1129465571 15:75722542-75722564 CAGTGAGGGAGGAAGGCAGGAGG + Intergenic
1129511527 15:76126898-76126920 CAGGGGTTGCGGGGGGCAGGTGG + Intronic
1129598498 15:76983237-76983259 GAGTGGTGGGGGAGGAGTGGGGG + Intergenic
1129825706 15:78633873-78633895 CAGTGCTGGGGCAGGGGAGCAGG + Intronic
1130066531 15:80609472-80609494 CAGTGGTGGGGTGGGGGTGGTGG - Intergenic
1130076586 15:80695264-80695286 CGGAGGCGGAGGAGGGCAGGAGG - Intronic
1130184620 15:81668627-81668649 CTGTGGTGGGGTGGGGGAGGGGG - Intergenic
1130546310 15:84859369-84859391 CAGTGGGCGAGGTGGGCAGGAGG + Exonic
1130577790 15:85107583-85107605 CAGTGGAAGGAGAGGGGAGGGGG + Intronic
1130670725 15:85910112-85910134 CAGTGGTGGGGGTTGGGGGGAGG + Intergenic
1130704799 15:86223153-86223175 TAGTGGTGGGGAGGGACAGGTGG - Intronic
1130970199 15:88726377-88726399 CAGAGGAGGGTGAGGGCAGCGGG + Intergenic
1131102678 15:89705418-89705440 CAGTGGAGGGGCTGGGAAGGAGG + Intronic
1131423377 15:92326086-92326108 CAGTGATGGGGGATGGTGGGTGG + Intergenic
1132120059 15:99168763-99168785 CAGTGGAGGAGGAGGAGAGGAGG - Intronic
1132184643 15:99792501-99792523 CAGGGGTGGGGGTGGGCGTGAGG + Intergenic
1132293827 15:100720562-100720584 GAGTGTTGGGGGCGGGGAGGAGG + Intergenic
1132301492 15:100779028-100779050 CTGGGGTGGGGGTGGGGAGGAGG - Intergenic
1132359623 15:101201567-101201589 CAGTGGGGTGGGAGGAGAGGAGG + Intronic
1132432340 15:101772155-101772177 CAGGGGTGGGGGTGGGCGTGAGG - Intergenic
1132450576 15:101966010-101966032 CTGTGGTGGGTGGGTGCAGGTGG + Intergenic
1132555837 16:572286-572308 CAGTGGTCAGAGAGGGCAGGCGG - Intronic
1132833486 16:1941223-1941245 CAGGGGTGGGGGAGGGACGGGGG - Intronic
1132874434 16:2130021-2130043 CAGGGGTGGGGGAAGGGATGGGG - Intronic
1132984380 16:2756602-2756624 CAGGGGTGAGGGAGAGCTGGGGG + Exonic
1132986409 16:2769826-2769848 CATGTGTGGGGGCGGGCAGGAGG - Intronic
1133027658 16:2995662-2995684 CAGGGGTGGGGAGGGGCTGGGGG + Intergenic
1133240077 16:4408999-4409021 CAGAGGTGGGGAGGGGTAGGTGG + Intronic
1133373552 16:5264671-5264693 CTGTGATGGGGGAGGGGATGTGG + Intergenic
1133984106 16:10654928-10654950 GGGGGGTGGGGGAGGGGAGGGGG - Intronic
1133999000 16:10768095-10768117 CAGGGGTGTGGAAGGACAGGTGG + Exonic
1134024806 16:10945469-10945491 CAGCTCTGGGGGAGGACAGGTGG + Intronic
1134040244 16:11062892-11062914 GGGGGGTGGGGGAGGGCAGTGGG + Intronic
1134340936 16:13345251-13345273 CAGAGGTGGAGGATGGGAGGAGG - Intergenic
1134449674 16:14355425-14355447 GAGTGGGGGGGGGGGGCGGGGGG + Intergenic
1134553379 16:15148854-15148876 CAGGGGTGGGGGAAGGGATGGGG - Intergenic
1134693090 16:16203793-16203815 GAGTTGGGGGGCAGGGCAGGAGG + Intronic
1134720724 16:16379883-16379905 GAGGGGAGGGGGAGGGGAGGGGG - Intronic
1134750330 16:16619872-16619894 AGGGGGAGGGGGAGGGCAGGGGG + Intergenic
1134946703 16:18332002-18332024 GAGGGGAGGGGGAGGGGAGGGGG + Intronic
1134953962 16:18372117-18372139 GAGGGGAGGGGGAGGGGAGGGGG + Intergenic
1134978758 16:18590902-18590924 GAGTTGGGGGGCAGGGCAGGAGG - Intergenic
1135063505 16:19290341-19290363 TGGTGGTGGGGGAGGGGAAGTGG - Intronic
1135191408 16:20357735-20357757 CAGGGATGGGGGTGGGAAGGTGG + Intergenic
1135365699 16:21851260-21851282 GAGGGGAGGGGGAGGGGAGGGGG + Intronic
1135365706 16:21851271-21851293 GAGGGGAGGGGGAGGGGAGGGGG + Intronic
1136036494 16:27544458-27544480 CTGGGCTGGGGGAGGGGAGGAGG + Intronic
1136089126 16:27905855-27905877 CAGGGGTGGGAGTGGGAAGGTGG - Intronic
1136109700 16:28057089-28057111 GAGGAGTGGGGAAGGGCAGGAGG + Intronic
1136151926 16:28356713-28356735 CAGGGGAGGGGGAGGGGAAGGGG + Intronic
1136160249 16:28415170-28415192 CAGTGGAGAGGGCGGGGAGGGGG - Intergenic
1136184219 16:28576245-28576267 CACTGGGCGGGGAGGGTAGGAGG + Intronic
1136202839 16:28700120-28700142 CAGTGGAGAGGGCGGGGAGGGGG + Intronic
1136211152 16:28758569-28758591 CAGGGGAGGGGGAGGGGAAGGGG - Intronic
1136234544 16:28905684-28905706 AAGGTGAGGGGGAGGGCAGGGGG - Exonic
1136255873 16:29038521-29038543 CAGGGGAGGGGGAGGGGAAGGGG - Intergenic
1136284670 16:29233862-29233884 CGGTGGTGGGGGAGGGCCCTGGG - Intergenic
1136402256 16:30025141-30025163 CGGGGGTGGGGGTGGGGAGGGGG + Exonic
1136519515 16:30786873-30786895 CCGGGGTGGGGGCGGGCGGGGGG - Intronic
1136561110 16:31039837-31039859 CAGGGCTGGGGCAGGCCAGGGGG - Intronic
1136573896 16:31112103-31112125 CAAAGCTGGGGGTGGGCAGGGGG - Exonic
1136610154 16:31361360-31361382 CAGTGCTGGGGGACGTCAGTGGG - Intronic
1136720343 16:32314861-32314883 CAGTGGTGGGGCTGGGGAGTAGG + Intergenic
1136725396 16:32353253-32353275 CAGTGGTGGGGCTGGGGAGTAGG + Intergenic
1136736394 16:32471451-32471473 CACTGGTGGGGGAGGGGTGGGGG - Intergenic
1136838720 16:33521137-33521159 CAGTGGTGGGGCTGGGGAGTAGG + Intergenic
1136843730 16:33559311-33559333 CAGTGGTGGGGCTGGGGAGTAGG + Intergenic
1136856439 16:33662259-33662281 CTGTGGTGGGGGTGGGCAAGAGG + Intergenic
1137384019 16:48024841-48024863 CAGTGGTGGGGCAGGCAAGGAGG + Intergenic
1137513161 16:49119004-49119026 CAGAGTGGTGGGAGGGCAGGAGG - Intergenic
1137531571 16:49281755-49281777 CAGCGGCGGGTGCGGGCAGGAGG - Exonic
1137831231 16:51545269-51545291 CTGTGGTGGGGGAGGGTGAGTGG + Intergenic
1137857198 16:51806789-51806811 AAGATGTGGGGCAGGGCAGGGGG + Intergenic
1138069010 16:53971967-53971989 GAGTGGTGAAGGAGGGAAGGGGG - Intronic
1138497710 16:57418297-57418319 CAGGGGTGGGGTGGGGGAGGAGG - Intergenic
1138560965 16:57800886-57800908 GATTCGTGGGGGAGGGCAGTGGG + Intronic
1138560994 16:57801116-57801138 CAGTGGTGGGTGAATGCAGAGGG + Intronic
1138667747 16:58586357-58586379 GAGGGGGAGGGGAGGGCAGGGGG + Intronic
1138776513 16:59729858-59729880 GGGTAGTGGGGGAAGGCAGGAGG - Intronic
1139099173 16:63744560-63744582 CAGTGCTGGTGCAGGGCGGGTGG - Intergenic
1139374488 16:66488213-66488235 CAGTGGTGGGGCAGGGGGGTGGG + Intronic
1139614203 16:68079269-68079291 CAGCCGTGGGTGAGGGTAGGGGG - Exonic
1139630730 16:68230532-68230554 CAGTGGTGGGGGAGACTGGGGGG + Exonic
1139649384 16:68354853-68354875 TAAGGGTGGGGAAGGGCAGGTGG - Intronic
1139898592 16:70308965-70308987 CACTAATGGGGGAGGGCAGTGGG - Intronic
1140134928 16:72197601-72197623 CAGTGGAGGAGGAGGGCAGCCGG - Intergenic
1140225102 16:73070803-73070825 GAGTGGTGGGGGAGGGGACCGGG - Intergenic
1140326060 16:74004957-74004979 CAGTGGTGGGTCATGGCAGGTGG + Intergenic
1140365538 16:74377806-74377828 GAGGGGAGGGGGAGGGGAGGGGG - Intergenic
1140365545 16:74377817-74377839 GAGGGGAGGGGGAGGGGAGGGGG - Intergenic
1140365552 16:74377828-74377850 GAGGGGAGGGGGAGGGGAGGGGG - Intergenic
1140365559 16:74377839-74377861 GAGGGGAGGGGGAGGGGAGGGGG - Intergenic
1140697418 16:77548677-77548699 AAGAGTTGGGGGAGGGGAGGAGG + Intergenic
1141013650 16:80427058-80427080 CAGTGGTGGGAAAGGGAGGGAGG - Intergenic
1141236364 16:82221462-82221484 CAGAGGCTGGGGAGGGAAGGAGG - Intergenic
1141289450 16:82704151-82704173 AAGAGGTGGGGGTGGGCATGGGG + Intronic
1141461469 16:84180791-84180813 CAGGGGTGGAGCAGGGGAGGAGG - Intronic
1141677145 16:85523901-85523923 CAGAGGTGGGAGGGCGCAGGAGG + Intergenic
1141797530 16:86285365-86285387 CAGAGGTGGGGGATGGGAAGGGG - Intergenic
1141814954 16:86403561-86403583 CAGTGGTGGTGGAAGGCAAAAGG + Intergenic
1141841090 16:86574582-86574604 AAGTGGGCGGGGAGGGAAGGAGG + Intergenic
1141862520 16:86727672-86727694 CAGAGGTGGGGCTGGGGAGGAGG + Intergenic
1141956594 16:87376079-87376101 CTGTGGCAGTGGAGGGCAGGGGG - Intronic
1141989716 16:87602863-87602885 GAGGGGAGGGGGAGGGGAGGAGG - Intronic
1142068146 16:88074417-88074439 CAGTGGGTTGGGAGGGTAGGGGG + Intronic
1142089686 16:88203330-88203352 CGGTGGTGGGGGAGGGCCCTGGG - Intergenic
1142119113 16:88377223-88377245 CCGGGGTGGTGCAGGGCAGGGGG + Intergenic
1142124541 16:88403632-88403654 CTGTGGGGGCCGAGGGCAGGAGG - Intergenic
1142193012 16:88726510-88726532 CGGTGGCGGGGGAGGGCGTGGGG - Intronic
1142236299 16:88924137-88924159 CTGCGGTGGGGCGGGGCAGGTGG + Intronic
1142323765 16:89401092-89401114 CTGGGGAGGGGGAGGGCGGGTGG - Intronic
1142336045 16:89490197-89490219 CGGTGGTCGGGGCGGGCACGGGG - Intronic
1142412034 16:89921816-89921838 CAGGGGTGGGGCTGGCCAGGGGG - Intronic
1203001035 16_KI270728v1_random:164501-164523 CAGTGGTGGGGCTGGGGAGTAGG - Intergenic
1203006088 16_KI270728v1_random:202908-202930 CAGTGGTGGGGCTGGGGAGTAGG - Intergenic
1203016676 16_KI270728v1_random:358127-358149 CACTGGTGGGGGAGGGGTGGGGG + Intergenic
1203035011 16_KI270728v1_random:631285-631307 CACTGGTGGGGGAGGGGTGGGGG + Intergenic
1203118019 16_KI270728v1_random:1510736-1510758 CTGTGGTGGGGGTGGGCAAGAGG + Intergenic
1203132637 16_KI270728v1_random:1700905-1700927 CAGTGGTGGGGCTGGGGAGTAGG - Intergenic
1203148885 16_KI270728v1_random:1821423-1821445 CAGTGGTGGGGCTGGGGAGTAGG + Intergenic
1203153895 16_KI270728v1_random:1859609-1859631 CAGTGGTGGGGCTGGGGAGTAGG + Intergenic
1142671068 17:1487570-1487592 CAGAGGCGGGGGAGGGCGGGAGG + Intronic
1142733868 17:1882148-1882170 CAGTGGTGGCGGAGAGGAGCTGG - Intronic
1142759536 17:2034773-2034795 GAGTGGGGGAGGAGGGGAGGGGG - Intronic
1142977824 17:3656100-3656122 GGGTGGAGGGGCAGGGCAGGGGG - Intronic
1142977908 17:3656302-3656324 GGGTGGTGGGGCAGGGCAGGGGG - Intronic
1143336544 17:6175795-6175817 CAGTGCTGGGTGTTGGCAGGGGG - Intergenic
1143386586 17:6534600-6534622 TGGTGGTGGTGGGGGGCAGGGGG + Intronic
1143391390 17:6561173-6561195 AAGAGGAGGGGGAGGGGAGGAGG - Intergenic
1143391400 17:6561196-6561218 AAGAGGAGGGGGAGGGGAGGAGG - Intergenic
1143391526 17:6561648-6561670 AAGAGGAGGGGGAGGGGAGGAGG - Intergenic
1143518196 17:7430373-7430395 CAGTGCTGGAGCAGGGCTGGGGG - Intergenic
1143585312 17:7847820-7847842 GGGTGGTGGGGCAGGGCGGGGGG - Exonic
1143594690 17:7907270-7907292 CTGTGGAGCGGGAGGGGAGGGGG + Intronic
1143627836 17:8121461-8121483 CAGGTGTTGGGGAGGGCAGTGGG - Exonic
1143635651 17:8162645-8162667 CAGGGGCGGGGAGGGGCAGGAGG + Intronic
1143731198 17:8883922-8883944 CAGTGAAGGAGGTGGGCAGGAGG - Intronic
1143783687 17:9242017-9242039 CCGGGGTGGGGTAGGGCATGGGG + Exonic
1143870479 17:9954459-9954481 CAGTGATGGGGGATGGGGGGTGG + Intronic
1144026010 17:11276298-11276320 CAAAGGTGGCGGAGGGGAGGTGG + Intronic
1144140105 17:12340116-12340138 GACTGGTGGGTGAGGGGAGGTGG - Intergenic
1144642904 17:16948390-16948412 CAGCACTGGTGGAGGGCAGGTGG + Intronic
1144716282 17:17437953-17437975 CAGAGGCTGGGAAGGGCAGGAGG + Intergenic
1144851176 17:18244719-18244741 CGGCGGGGGGGGGGGGCAGGGGG + Exonic
1144994490 17:19258023-19258045 CAGAGGTTTGGGAGGCCAGGAGG + Intronic
1145263613 17:21368966-21368988 CTGTGGTGGGGAAGCCCAGGAGG + Intergenic
1145300049 17:21627780-21627802 GAGGGATGGGGAAGGGCAGGGGG + Intergenic
1145350239 17:22075496-22075518 GAGGGATGGGGAAGGGCAGGGGG - Intergenic
1145416012 17:22714736-22714758 CAGAGGAGGCAGAGGGCAGGAGG - Intergenic
1145881515 17:28356179-28356201 AAGTGCTGTGGGAGGTCAGGAGG - Intronic
1146054704 17:29575260-29575282 GAGTGGAGGGGGAGGTGAGGGGG - Intronic
1146178148 17:30679698-30679720 CAGAGGAGGGGGAGGACAGAGGG + Intergenic
1146457642 17:33019905-33019927 CTATGCTGGGGGAGGGCAGGGGG + Intronic
1146537703 17:33667287-33667309 CAGCAGTATGGGAGGGCAGGAGG + Intronic
1146667554 17:34715211-34715233 CAGTGCTGGGGCTGAGCAGGAGG - Intergenic
1146727398 17:35167370-35167392 CAGTGCTTTGGGAGGCCAGGTGG + Intronic
1146753912 17:35409173-35409195 GAGTGGTAGGGGAGGGCACTGGG - Intergenic
1146913793 17:36665264-36665286 CAGAGGTGGGGAAGGGAAGGGGG - Intergenic
1146931145 17:36778805-36778827 CTGTGCTGGAGGAGGGCAGCTGG - Intergenic
1146935386 17:36809720-36809742 GGTAGGTGGGGGAGGGCAGGGGG + Intergenic
1146965524 17:37025489-37025511 CATTGACGGGGGAGGGCAGGAGG + Intronic
1147161676 17:38572494-38572516 ATGCGGTGGGGGAGGGGAGGAGG + Intronic
1147168708 17:38606054-38606076 CGGGGGCGGGGGAGGGGAGGGGG + Intergenic
1147603026 17:41757611-41757633 GTGAGCTGGGGGAGGGCAGGAGG - Intronic
1147652565 17:42070909-42070931 CAGTGCTGGGAGAGGGCAGTGGG - Intergenic
1147842470 17:43381733-43381755 GAATGGTGGGGCTGGGCAGGGGG - Intergenic
1147946583 17:44083768-44083790 CAGCAGTGGGGGTGGGCGGGCGG - Intronic
1147991882 17:44338959-44338981 AAGAGGTGGGGGTGGGGAGGTGG + Intergenic
1148047285 17:44751892-44751914 CAATGGTGAGGAAGGGCAGGGGG - Exonic
1148063806 17:44854240-44854262 CTGGGGTGGGGGAGTGCTGGTGG + Intronic
1148081121 17:44968135-44968157 CAATGGTGCCGGCGGGCAGGGGG + Intergenic
1148146171 17:45366464-45366486 CAGGGGTGGGGGTGGGGAGCCGG - Intergenic
1148216865 17:45838041-45838063 CAGTGGTGGGGGAAGGTCGCTGG + Intergenic
1148393424 17:47289966-47289988 TTGTGGTGGTGGAGGGGAGGTGG + Intronic
1148736579 17:49868533-49868555 CAGGGGTGGAGGAGGACTGGGGG + Intergenic
1148868130 17:50639690-50639712 CAGTGGTTGGGGCTGGCAGGGGG + Intronic
1148988829 17:51647544-51647566 CAGTGCTGGGGGATGGGTGGTGG + Intronic
1149247364 17:54726476-54726498 CAGAGGTTGGGGAGGGTAGTGGG + Intergenic
1149272182 17:54991934-54991956 CAGTGGTGGGGGAGGGATATGGG - Intronic
1149530026 17:57387812-57387834 CACTAGTGGGGAAGGGAAGGTGG + Intronic
1149536566 17:57438133-57438155 TAGAGGTGGGGTGGGGCAGGTGG + Intronic
1149849975 17:60028476-60028498 CACAGAAGGGGGAGGGCAGGAGG - Intergenic
1149860192 17:60118048-60118070 CACAGAAGGGGGAGGGCAGGAGG + Intergenic
1149997252 17:61411754-61411776 CAGCGGCGGGGGAGTGGAGGAGG - Exonic
1150179571 17:63102620-63102642 CAGAGGTGGGGGGAGGGAGGAGG - Intronic
1150207345 17:63419101-63419123 CTGGGGAGGAGGAGGGCAGGAGG - Intronic
1150289133 17:63971670-63971692 CTGGGGTGGGTGAGGGGAGGGGG - Intronic
1150410473 17:64937250-64937272 GAGTGGTGGGGGTGGGGAGAAGG + Intergenic
1150488657 17:65560555-65560577 CAGTGGCGGGGGCGGAGAGGGGG - Intronic
1150566765 17:66348768-66348790 CAGCAGAGGGGGAGGGCAGCTGG + Intronic
1151393600 17:73804296-73804318 GAAAGGTGGGGGAGGGGAGGAGG + Intergenic
1151484010 17:74387365-74387387 CGGTGGCTGGGGAGGTCAGGTGG + Intergenic
1151520974 17:74629313-74629335 AAGTGGTGGGGAGGGGGAGGGGG + Intergenic
1151790438 17:76302298-76302320 CAGAGGTGGGGGTGGGGTGGGGG - Intronic
1151807360 17:76414472-76414494 TGGCGGTGGGGGAAGGCAGGAGG + Intronic
1151951486 17:77356670-77356692 ATGTGGGGGGGGAGGGGAGGGGG - Intronic
1152013653 17:77735771-77735793 CAGTGGGCGGGGAGGGAGGGAGG - Intergenic
1152035278 17:77868418-77868440 CAGCGGTGAGGGAGGGGAGGTGG - Intergenic
1152110726 17:78356278-78356300 CTGTGGTGGGGGAGGGGGTGGGG + Intergenic
1152193365 17:78902085-78902107 CAGTGGTGGCGGGGGGACGGGGG + Intronic
1152320981 17:79608807-79608829 CAGTCCTGGGGGAGGGGCGGGGG + Intergenic
1152423272 17:80205294-80205316 GCGTGGTGGGGGAGGGAAGGAGG - Intronic
1152467863 17:80475935-80475957 ACGGGGTGGGGGAGGGCAGAGGG + Intronic
1152469281 17:80481949-80481971 CAGTGAGTGGGCAGGGCAGGTGG + Intergenic
1152471581 17:80492554-80492576 AGGTGGTGGGGCAGGGCAGGAGG + Intergenic
1152471606 17:80492639-80492661 AGGTGGTGGGGCAGGGCAGGAGG + Intergenic
1152542248 17:80982227-80982249 TAGTGGGGAGGGAGGGAAGGTGG - Intergenic
1152544393 17:80993393-80993415 CAGCAGTGGGGCTGGGCAGGGGG + Intronic
1152555181 17:81049542-81049564 CAGTGCTGGGGCAGGGGATGGGG - Intronic
1152577515 17:81149376-81149398 CACAGGCCGGGGAGGGCAGGAGG - Intronic
1152684501 17:81687422-81687444 CACTGGGTGGGCAGGGCAGGTGG + Intronic
1152744854 17:82033927-82033949 GAGCGGTGGGGGTGGGCCGGGGG + Exonic
1152749241 17:82055031-82055053 ATGAGGTGGGGGAGGACAGGAGG - Intronic
1152753481 17:82077364-82077386 TAGTGTTGGGGGACCGCAGGAGG + Intergenic
1152817707 17:82418288-82418310 GGGGGGTGGGGGGGGGCAGGTGG - Intronic
1152891441 17:82883810-82883832 CTGTGGTGGGGCGGCGCAGGAGG - Intronic
1152900010 17:82935473-82935495 CACAGGTGGGGGCGGGGAGGGGG - Intronic
1153285102 18:3449791-3449813 CGGGGGTGGAGGAGGGAAGGAGG + Intronic
1153463112 18:5359169-5359191 TAGTGGTGGGTGGGGGCAAGGGG - Intergenic
1154026864 18:10716188-10716210 CAGAGGTGGAGGAGAGAAGGTGG - Intronic
1154163416 18:11996549-11996571 CAGCGGGCGGGGTGGGCAGGTGG - Intronic
1154193840 18:12252057-12252079 GAGAGGTGGGAGAGGGCAGAGGG - Intergenic
1154196129 18:12268484-12268506 CTGAGGTGGGGGAGCCCAGGAGG - Intronic
1154416312 18:14177779-14177801 CAGCGGTGGGGGCGGGTTGGGGG + Intergenic
1154460285 18:14576641-14576663 CTGTGGTGGGGGAGGGGGGAGGG + Intergenic
1154503188 18:15006586-15006608 CAGAGGAGGCAGAGGGCAGGAGG - Intergenic
1155061617 18:22233635-22233657 GGGTGGTAGGGGAGGGGAGGAGG + Intergenic
1155096218 18:22559208-22559230 CGGCGGTGGAGGAGGGCTGGTGG + Intergenic
1155326875 18:24673138-24673160 CTGTGGTGGGGGTTGGCAGTGGG - Intergenic
1155464627 18:26120903-26120925 CACTGGTGGGGGATAGCTGGAGG - Intergenic
1155611136 18:27669155-27669177 CAGTGGGAGGGGAGGGCAAGTGG - Intergenic
1155861711 18:30909584-30909606 CTGTTGTGGGGGAGGGGAGAGGG + Intergenic
1155963631 18:32016650-32016672 CATGGGTGGTGGGGGGCAGGCGG - Intergenic
1156036840 18:32773582-32773604 CAGTGCTGGGGGTGGGGGGGAGG - Exonic
1156350087 18:36296317-36296339 CAGTGGTGGGGTGGGGGTGGGGG - Intergenic
1156447310 18:37247384-37247406 AAGAGGTGGGGCAGGGCAGGTGG + Intronic
1156449640 18:37259640-37259662 CAGAGCAGGGGCAGGGCAGGAGG - Intronic
1157024992 18:43831842-43831864 CAGTGGAGAGGGAGAGAAGGGGG - Intergenic
1157083046 18:44549018-44549040 CAGAGGTGGGGCGGGGCACGGGG + Intergenic
1157220489 18:45825638-45825660 GCGTGGTGGGGGAAGGAAGGCGG - Exonic
1157412715 18:47477018-47477040 CAGTGGTAGGGGCGGGGTGGGGG - Intergenic
1157544927 18:48540355-48540377 CGGTCATGGGGGAGGGCGGGCGG + Intronic
1157552430 18:48590811-48590833 CAGTGGTGGGGGCGGGGTGGAGG - Intronic
1157559531 18:48636794-48636816 GAGAGGTGGGAGAGGGGAGGGGG + Intronic
1157566258 18:48680944-48680966 CAGTGGTGGTGGAGGGGGCGGGG + Intronic
1157606832 18:48931150-48931172 AAGTGCTGGGGGAGGGGAGAAGG + Intronic
1157893212 18:51438635-51438657 CAGAGGCAGGAGAGGGCAGGAGG + Intergenic
1158123308 18:54074570-54074592 CAATGGTGGGGGAGGTCACTGGG - Intergenic
1158130662 18:54149181-54149203 CACTGGGGGTGGAGGGCTGGGGG - Intergenic
1158160489 18:54477625-54477647 CAGTGGTGGGGAGGAGCAGGAGG + Intergenic
1158372582 18:56826050-56826072 TGGGGTTGGGGGAGGGCAGGTGG + Intronic
1158535689 18:58306279-58306301 CAGGGGTGGGGGAGATGAGGGGG + Intronic
1158580910 18:58681958-58681980 CAGCAGTGGTGGAGGGCAGGAGG + Intronic
1158796882 18:60856949-60856971 CGGTGGGGGGAGAGGGGAGGAGG - Intergenic
1158819728 18:61145599-61145621 CTGTGGTAGGGGGGGGGAGGGGG + Intergenic
1158959856 18:62580514-62580536 CAGTGCTGTGGAAGGCCAGGTGG + Intronic
1158959867 18:62580558-62580580 CAGTGCTGTGGAAGGCCAGGTGG + Intronic
1158959889 18:62580646-62580668 CAGTGCTGTGGAAGGCCAGGTGG + Intronic
1158959922 18:62580778-62580800 CAGTGCTGTGGAAGGCCAGGTGG + Intronic
1158959996 18:62581086-62581108 CAGTGCTGTGGAAGGCCAGGTGG + Intronic
1158960040 18:62581262-62581284 CAGTGCTGTGGAAGGCCAGGTGG + Intronic
1158960177 18:62581834-62581856 CAGTGCTGTGGAAGGCCAGGTGG + Intronic
1158960188 18:62581878-62581900 CAGTGCTGTGGAAGGCCAGGTGG + Intronic
1159558139 18:69966437-69966459 CTGTTGTGGGGGGGGGGAGGGGG + Intergenic
1159623526 18:70667359-70667381 GAGGGGAGGGGGAGGGGAGGGGG - Intergenic
1159827104 18:73226977-73226999 CAGTGAGGAGGGAGGGCAGGGGG - Intronic
1159845099 18:73449686-73449708 CAGTGGTGGGGGAATGAGGGTGG - Intergenic
1159936848 18:74375829-74375851 CAGAGATGGGGAAGGCCAGGCGG - Intergenic
1160217644 18:76947038-76947060 CAGCGGTGAGGGTGGGCCGGGGG - Intronic
1160251919 18:77210387-77210409 CAGGAGTGGGGGTGGGGAGGTGG + Intergenic
1160522410 18:79515441-79515463 CAGTGGTGGTGGTGGGCGGGTGG + Intronic
1160581967 18:79888162-79888184 CAGGGGTGGAGGAGGCCATGGGG + Intronic
1160634684 19:66537-66559 CTGTGGTGGGGGCGTGCCGGTGG - Intergenic
1160657311 19:280236-280258 CACTGGGCGGGGAGGGCGGGGGG - Intergenic
1160726755 19:620891-620913 CAGGGGAGGGGGAGGGGAGGAGG + Intronic
1160726774 19:620932-620954 CAGGGGAGGGGGAGGGGAGGAGG + Intronic
1160924226 19:1535336-1535358 CTGTCCTGGGGGAGGGCTGGGGG + Exonic
1160930650 19:1568161-1568183 CAGCGGCGGGGGCGGGCACGGGG + Intergenic
1160983277 19:1826469-1826491 CAGAGATGGGGGAAGGGAGGAGG + Intronic
1161043330 19:2121594-2121616 GTGTGGTGGGGCAGGGCAGAGGG - Intronic
1161139333 19:2638435-2638457 AAGGGGAGGGGGAGGGGAGGGGG + Intronic
1161169983 19:2807804-2807826 CCGCGGTGGGTGAGGGCAGCGGG + Exonic
1161202614 19:3024449-3024471 CAGGGGTTGGGGAGGGGACGGGG - Intronic
1161253762 19:3295151-3295173 CAGTAGAGGGGCAGGGCAAGGGG - Intronic
1161378228 19:3950836-3950858 CAGGGGTTGGGGTGGGGAGGGGG + Intergenic
1161403802 19:4080937-4080959 GAGGGGATGGGGAGGGCAGGAGG + Intergenic
1161465964 19:4430637-4430659 CAGAGGTGAGGGAGTGAAGGGGG + Exonic
1161590936 19:5128844-5128866 CAGTGGAGGCGGGGGGCGGGGGG + Intronic
1161643082 19:5436381-5436403 GAGGGGAGGGGGAGGGAAGGGGG + Intergenic
1161761037 19:6173004-6173026 GTGTGGGGTGGGAGGGCAGGTGG + Intronic
1161854273 19:6754476-6754498 CAGGGGTGAGGGGGGACAGGAGG + Intronic
1161894282 19:7069092-7069114 CAGTGGTGGGGCATGGAATGGGG - Intergenic
1162094806 19:8304028-8304050 CAGGGGCAGGGGAGGCCAGGGGG + Exonic
1162095567 19:8307952-8307974 CCATGCTGGGGGAGGGGAGGAGG - Intronic
1162103497 19:8355058-8355080 CGGTGGCGGGGGAGGGCACGTGG - Intronic
1162125638 19:8498358-8498380 CATAGGTGGGTGAGGGCGGGCGG - Exonic
1162396913 19:10422654-10422676 CAGAGGTGGGGGTGGCCTGGAGG - Intronic
1162464099 19:10830389-10830411 CAGTTGGGGTGGAGGGCAGGGGG - Intronic
1162534766 19:11256325-11256347 CAGAGGAGGGAGAGGGGAGGAGG + Intronic
1162550512 19:11355679-11355701 GAGGGGCGGGGGAGGGGAGGCGG + Intronic
1162746731 19:12802699-12802721 CATGGGTGTGGGAGGGTAGGAGG + Intronic
1162785483 19:13032123-13032145 CAGTGGAGGGGGAGGGGGGCAGG + Intronic
1162822052 19:13229056-13229078 CAGGGGTGGGGGGGGGCTTGTGG + Intronic
1162931267 19:13959134-13959156 CAGAAGCTGGGGAGGGCAGGGGG - Exonic
1162962441 19:14136132-14136154 CAGTGGGGGAGGAGGTCACGGGG + Intronic
1163093831 19:15041303-15041325 CAGTTGTGGGGTGGGGGAGGGGG - Intergenic
1163236677 19:16034088-16034110 CAGAGGTGGGGGAGGGGTGAGGG + Intergenic
1163517712 19:17774982-17775004 CAGTGTTGGGGGCTGACAGGGGG + Intronic
1163677807 19:18664061-18664083 AAGGGCTGGGGGAGGGGAGGGGG - Intronic
1163704684 19:18805313-18805335 CACTGCTGGGGGAGGTCTGGGGG - Intergenic
1163715367 19:18869722-18869744 AAGAGGTGGGGGTGGGCATGGGG + Intronic
1164052218 19:21593062-21593084 CAGTGGTTGGGGACCACAGGTGG + Intergenic
1164364635 19:27563068-27563090 GTGGGGTGGGGGAGGGGAGGGGG + Intergenic
1164946162 19:32294932-32294954 GAGTGGAGGGGGTGGGCAGGAGG + Intergenic
1165064031 19:33218858-33218880 CAGTGGTGTGGGAAGGTCGGAGG + Intronic
1165149775 19:33753746-33753768 GGTTGGTGGGGGATGGCAGGTGG - Intronic
1165185323 19:34015408-34015430 CCGGGGTGGGGTGGGGCAGGGGG + Intergenic
1165286191 19:34844353-34844375 CAGTGGGGGTGCTGGGCAGGGGG + Intergenic
1165313003 19:35039921-35039943 CTGGGGTGGGAGGGGGCAGGGGG + Intronic
1165797584 19:38527883-38527905 AAGTTTTGGGGCAGGGCAGGAGG + Intronic
1165803912 19:38568757-38568779 AAGTGGTGGTGGGGGGCGGGGGG + Intronic
1165902398 19:39174891-39174913 CAGTGGTGGAGGGAGGCGGGAGG - Intronic
1166047819 19:40239935-40239957 CAGTCTTGGGGTAGGCCAGGCGG - Intronic
1166139740 19:40799489-40799511 GAGTGGAGGGGGAGGGGAGGGGG + Intronic
1166190421 19:41173057-41173079 CTGGGATGGGGGAGGCCAGGGGG - Intergenic
1166234012 19:41442822-41442844 AAGTGGTGGTGGGGGGCAGGTGG + Intergenic
1166293979 19:41879942-41879964 CACTCCTGGGTGAGGGCAGGAGG - Intronic
1166382734 19:42363148-42363170 AAGGGGTGGGGCAGGGCAGTGGG - Exonic
1166565650 19:43763864-43763886 CAGTGGAGAATGAGGGCAGGCGG + Intergenic
1166571085 19:43797773-43797795 CGGTGGTGCAGGAGGGCCGGTGG + Exonic
1166685389 19:44793456-44793478 GAGTGCTGGGGGAGGTCGGGAGG - Exonic
1166718699 19:44985423-44985445 CAGTGCTCAGGGAGGGGAGGTGG - Intronic
1166981459 19:46634461-46634483 AAGGGGCGGGGCAGGGCAGGAGG - Intronic
1167116018 19:47489481-47489503 CTGAGGTTGGGGAGGTCAGGAGG - Intronic
1167202344 19:48074687-48074709 CAGGGGTGGGGAAGAGCAAGAGG + Intronic
1167225709 19:48238132-48238154 CACTGGGAGGCGAGGGCAGGTGG - Intronic
1167424467 19:49423044-49423066 TAGGGGTGGGGGAAGGCGGGAGG - Intronic
1167464913 19:49645599-49645621 CAGTGCTGGGAGAGGGCAGGAGG + Intronic
1167473235 19:49686790-49686812 GAGTGGTGGGGGAGGAATGGTGG + Intronic
1167493114 19:49803017-49803039 GAGTGGTGGGGGAGGGGAACGGG + Intronic
1167529172 19:50004281-50004303 CAGGGTGGGGAGAGGGCAGGAGG - Intronic
1167575657 19:50316288-50316310 CTGGGGAGGGGGAGGGGAGGAGG + Intronic
1167699734 19:51035344-51035366 CAGTGCAGGGGAGGGGCAGGGGG + Intergenic
1167765378 19:51479087-51479109 GAGAGGTGGGGGAGGGGATGGGG - Intronic
1168453366 19:56483926-56483948 CAGTAATGGGAGGGGGCAGGGGG - Intergenic
1168471300 19:56643055-56643077 CGGGGGTGGAGGAGGGGAGGAGG + Intergenic
1168474957 19:56668899-56668921 GTGTGTAGGGGGAGGGCAGGTGG + Intronic
1168549625 19:57282014-57282036 CAGTGGTTAGGGAGGCCTGGGGG + Intronic
1168630125 19:57949902-57949924 CAGTGCTGGCTGAGGGCAGGAGG + Intergenic
925123584 2:1438041-1438063 CCTGGGTGGAGGAGGGCAGGGGG + Intronic
925137716 2:1532186-1532208 CAGTGGTGGGGGATTTGAGGAGG - Intronic
925137762 2:1532379-1532401 CAGTGGTGGGGGATTTGAGGAGG - Intronic
925140917 2:1549410-1549432 CAAGGGTGGGTGAGGGCAGGAGG - Intergenic
925216958 2:2104789-2104811 CATGGTTGGGGGAGGGCAGGAGG + Intronic
925418389 2:3690296-3690318 GAGGGGAGGGGGAGGGGAGGGGG - Intronic
925423067 2:3727179-3727201 CAGGGGGAGGGGAGGGGAGGAGG - Intronic
925667578 2:6277084-6277106 GGGGGGTGAGGGAGGGCAGGGGG + Intergenic
926010075 2:9400374-9400396 GAGGGGTGGAGGAAGGCAGGTGG - Intronic
926098440 2:10097798-10097820 CAGTGATGGTGCAGGGTAGGGGG - Intergenic
926116550 2:10217365-10217387 CCGTGGTAGGTGAGGGCTGGAGG - Intergenic
926121553 2:10243762-10243784 GAGTGGGGGGAGAGGCCAGGGGG - Intergenic
926202929 2:10814184-10814206 GAGTGGTGGGGGCCGGCTGGTGG + Intronic
926224887 2:10960776-10960798 CAGGGCTGGGTGAGGGGAGGTGG + Intergenic
926809864 2:16746560-16746582 GAGGGGAGGGGCAGGGCAGGAGG - Intergenic
926846965 2:17152044-17152066 CAGTGATGGAGGAGGGATGGTGG + Intergenic
927188088 2:20496994-20497016 CAGAGGTGGTGGAGAGCACGGGG + Intergenic
927203555 2:20593072-20593094 CAGTGGGGGGACAGGGCTGGAGG - Intronic
927279174 2:21288534-21288556 GAGTGGGAGGGGAGGGGAGGGGG + Intergenic
927557890 2:24049029-24049051 CAGAGCTGGGGGAGGGAGGGAGG - Intronic
927928152 2:27027110-27027132 CAGGGGGTGGGGAGGGCAGGTGG - Exonic
928108456 2:28488196-28488218 GAGGGGAGGGGGAGGGGAGGGGG + Intronic
928293593 2:30061509-30061531 CTGTGGTGGGGGAGGCCATGAGG + Intergenic
928448686 2:31357539-31357561 CAGAGGCTGGGGAGGGTAGGGGG + Intronic
928715665 2:34056757-34056779 CACTGCTGGGGGATGGCAGAGGG + Intergenic
928863493 2:35889350-35889372 CAGTGGTGGAGCAGGGGAAGTGG - Intergenic
928899839 2:36305037-36305059 TAGATGTGGGGGAAGGCAGGTGG - Intergenic
929071099 2:38031429-38031451 CACTGGTGGGGGAGGCTGGGAGG - Intronic
929489635 2:42384858-42384880 CAGAGCTGGGGGAAGGCAGGTGG - Intronic
929713197 2:44285420-44285442 CAGAGATGTGGGAGGGCAGCCGG + Intronic
929781925 2:44962585-44962607 CAGAGGTGGGGGTAGGAAGGAGG - Intergenic
929911262 2:46091241-46091263 AAGTGTATGGGGAGGGCAGGTGG - Intronic
929950698 2:46407515-46407537 CAGTGCCTGGGGAGGCCAGGTGG + Intergenic
929977588 2:46650314-46650336 CAACTGTGGGGGTGGGCAGGGGG + Intergenic
930018094 2:46984572-46984594 CAGTTGTGGGGAAGGGGAGCAGG - Intronic
930048186 2:47192463-47192485 AAGGGGTCTGGGAGGGCAGGGGG - Intergenic
930054918 2:47244428-47244450 CACTGATTGGGGAGGGAAGGGGG + Intergenic
930174352 2:48286468-48286490 CAGTGGTGGCTTAGGGCTGGGGG - Intergenic
930411471 2:51030970-51030992 CATTAGTGGAGGAGGGCAGGAGG - Intronic
930639564 2:53840665-53840687 GAGGGGAGGGGGAGGGGAGGGGG + Intergenic
930723917 2:54664527-54664549 CAGAGGTCGGGGAGGGGATGGGG - Exonic
930826327 2:55700298-55700320 GAGGGGAGGGGGAGGGGAGGGGG - Intergenic
931013639 2:57949061-57949083 GAGTGGTGGTGGGGGACAGGGGG + Intronic
931038458 2:58269078-58269100 CAGTGGGGGGGTAGGGCGGGCGG - Intergenic
931178587 2:59877467-59877489 CACTGTTTGGGGAGGGAAGGGGG - Intergenic
931451368 2:62370081-62370103 TGGAGGTGGGGTAGGGCAGGGGG + Intergenic
931496155 2:62809353-62809375 CAGTTGGGGGAGAGGGGAGGAGG - Intronic
931881704 2:66576372-66576394 CAGATGGGGGTGAGGGCAGGAGG - Intergenic
932234916 2:70113166-70113188 CAGTGGGGTGGGAGTGGAGGTGG - Intergenic
932236558 2:70125234-70125256 CAGGGGTAGTGGAGGGCAGAGGG + Intergenic
932274448 2:70441659-70441681 CTGTGGTGGGGGGGGGAGGGGGG - Intergenic
932477094 2:72013131-72013153 CAGTGCTGGGGGAAGGGAAGCGG + Intergenic
932488743 2:72104916-72104938 GAGTGAGGGGGCAGGGCAGGAGG + Intergenic
932624560 2:73286950-73286972 AACTGGTGGGGGAAGGGAGGTGG + Intergenic
932763736 2:74457537-74457559 CAGTGGGCGGGGAGGCCGGGGGG + Exonic
933036502 2:77406127-77406149 CAGTGGTGGTAGTGGGCTGGGGG + Intronic
933162909 2:79045400-79045422 CAGTGGTGGTGGTGGCCATGGGG + Intergenic
933286102 2:80386214-80386236 TGGTGGTGGGGAAGGGAAGGAGG - Intronic
933299939 2:80530227-80530249 CAGTGCCGGGGGTGGGCAGGAGG - Intronic
933705573 2:85287083-85287105 CAGAGGTGTGGGAAGTCAGGCGG - Intronic
933707456 2:85302638-85302660 CAGTGCTGCTGCAGGGCAGGCGG + Intronic
934039030 2:88112365-88112387 CAGTGGTCTGAGAGGGAAGGAGG - Exonic
934102527 2:88666671-88666693 CAGCAGTTGGGGAGGGCAGGAGG - Intergenic
934112494 2:88756517-88756539 CAGTGTTGGGGGGAGGCTGGTGG + Intergenic
934187557 2:89760572-89760594 CACTGGTAGGGGAGGGGTGGGGG - Intergenic
934247821 2:90323410-90323432 CAGTGGCGGGGGGGGGTGGGGGG + Intergenic
934320491 2:91967305-91967327 CAGTGGTGGGGCTGGGGAGTAGG - Intergenic
934554130 2:95278490-95278512 CAATGGTGGGAGAGGGATGGGGG + Intronic
934856195 2:97731904-97731926 CAGTGAGGAGGGAGGGCAGCTGG - Intronic
935106120 2:100045149-100045171 CAGAGGTGGGGAAGGGGAGGAGG + Intronic
935163607 2:100550221-100550243 CAGTGATGGGTGGGGTCAGGCGG + Intergenic
935698744 2:105792110-105792132 CAGTGGTGAGGCTGAGCAGGAGG - Intronic
935725980 2:106024483-106024505 TAGTGTAGGCGGAGGGCAGGAGG - Intergenic
935747808 2:106204589-106204611 CATTGGAGGGTGGGGGCAGGGGG + Intergenic
936172191 2:110186027-110186049 CATTAGTGTGGCAGGGCAGGAGG - Intronic
936288125 2:111197551-111197573 GAGAGGTGGGGGTGGGCATGGGG - Intergenic
936372772 2:111917046-111917068 TAGTGTTTGGGGAGGCCAGGTGG - Intronic
936444652 2:112586137-112586159 CAGTGTGGGGGGTGGGCAGTGGG + Intronic
936544058 2:113374938-113374960 CAGTCATGGGGGAGGGCAAAAGG + Intergenic
936566793 2:113588490-113588512 CTGTGGTGGGGGCGTGCCGGTGG + Intergenic
937080726 2:119137773-119137795 CAGTGGCCAGAGAGGGCAGGTGG + Intergenic
937103260 2:119287984-119288006 CAGTGGTGGGTGATGACAGAGGG + Intergenic
937126313 2:119476983-119477005 CAGGGGTAGGGGAGGGAAGGTGG + Intronic
937227027 2:120375902-120375924 CCGAGGTGGGGTTGGGCAGGGGG - Intergenic
937236984 2:120437028-120437050 CAGGGCTGGGGGAAGGCAGCAGG + Intergenic
937324016 2:120978321-120978343 CACAGGTCGGGGAGGGCTGGGGG + Intronic
937345216 2:121121163-121121185 CTGTGGAAGGGGAGGGCAGGGGG + Intergenic
937984531 2:127632614-127632636 CAGTGGTGGGGCAGGGGAGCTGG - Intronic
937989576 2:127654762-127654784 CAGCAGTGGCGGGGGGCAGGGGG - Intronic
938253263 2:129833031-129833053 CTGTGGGGGGGGGGGGGAGGAGG - Intergenic
938502369 2:131836756-131836778 CAGAGGAGGCAGAGGGCAGGAGG - Intergenic
939788119 2:146541081-146541103 GCGGGGTGGGGGGGGGCAGGGGG + Intergenic
939983229 2:148805673-148805695 GAGGGGTGGGGGAGGGGAGGGGG - Intergenic
940098925 2:150010910-150010932 CTGTTGTGGGGTAGGGGAGGGGG + Intergenic
940384746 2:153057809-153057831 TAGTGGGGAGGGAGGGCATGGGG - Intergenic
940605372 2:155917002-155917024 CGGTGGTGGTGGAGTGCTGGGGG + Intergenic
940808377 2:158213979-158214001 CAGTGGTGGGGTAGGGGGAGGGG + Intronic
941262911 2:163319567-163319589 CATTTGTGGGGGTGGGGAGGTGG - Intergenic
941687472 2:168461897-168461919 CTGTGATGGGGAAGGACAGGTGG + Intronic
941770209 2:169337038-169337060 CAGCGGTGGGGGAAGTCAGGCGG - Intronic
941943575 2:171070410-171070432 GAGTGGTGGTGGTGGGGAGGGGG - Intronic
942124428 2:172809283-172809305 CAGTGGTGGAGATGGGCAGTGGG + Intronic
942506302 2:176645030-176645052 CTGTGGTTGGGGAGGCCAGTTGG + Intergenic
942870426 2:180728086-180728108 CAGTGGTGGGCGGGGGCTGGGGG - Intergenic
942890430 2:180980866-180980888 CAGCTGTGGGGGGGGGAAGGGGG - Exonic
942940119 2:181606411-181606433 GAGAGGAGGGGGAGGGGAGGGGG + Intronic
942940176 2:181606530-181606552 GAGAGGAGGGGGAGGGGAGGGGG + Intronic
942970829 2:181956039-181956061 CAGGGGTGGCGGCGGGGAGGTGG - Intronic
943009579 2:182430951-182430973 CTGTGGTGGGGTCGGGGAGGGGG + Intronic
943247502 2:185473948-185473970 CAATGCTGACGGAGGGCAGGAGG - Intergenic
943657968 2:190529323-190529345 CAGTGGGCTGGGAGGGAAGGTGG - Intronic
943946162 2:194068595-194068617 GTGTGGTGGGGGACGGGAGGAGG - Intergenic
944098452 2:195995630-195995652 CAGTGGTGTGGGGGTGAAGGCGG + Intronic
944401139 2:199327954-199327976 TAGAGGTGGCTGAGGGCAGGGGG - Intronic
944511101 2:200467089-200467111 GATTGGTGGAGGAGGACAGGAGG + Intronic
944593027 2:201236178-201236200 CAGGGGTGGGGAGGGGCAGGAGG - Intronic
944824104 2:203463525-203463547 CAGTGGTTAGGGAAGGCAGTGGG + Intronic
945083637 2:206109991-206110013 GAAGGGTGGGGGAGGGGAGGGGG + Intergenic
945119106 2:206440577-206440599 CAGTCGTAGGTGAAGGCAGGTGG - Intergenic
945270932 2:207939356-207939378 CTGTTGTGGGTGAGGGCAAGAGG + Intronic
945348281 2:208746635-208746657 CTGTTGTGGGGGGGGGAAGGGGG - Intronic
945471359 2:210230785-210230807 TAGTGGTGGGGGTTGGGAGGAGG - Intergenic
945662808 2:212707217-212707239 CTCTTGTGGGGGAGGGCATGGGG + Intergenic
945778767 2:214140927-214140949 CATTGGTGGGGGGGGGGGGGTGG + Intronic
945809836 2:214535418-214535440 CGGTGGTGGGGTCGGGGAGGAGG - Intronic
946010506 2:216560177-216560199 GAGGGGAGGGGGAGGGGAGGGGG - Intronic
946154347 2:217797388-217797410 GTGTGATGGGGGAGGTCAGGAGG - Intergenic
946179987 2:217943180-217943202 TAGTGGTTGGAGAGGGCAGAGGG + Intronic
946200410 2:218068076-218068098 CAGACCTGGAGGAGGGCAGGGGG + Intronic
946208844 2:218130959-218130981 CTGTGCTGGGGGTGGGCTGGAGG - Intronic
946404596 2:219485513-219485535 TGGGGGTAGGGGAGGGCAGGAGG - Intronic
946432282 2:219632187-219632209 CCGTGATGGGGCAAGGCAGGGGG - Intronic
946526919 2:220530614-220530636 CAGTGCTGGGAGTGGGCAGTGGG - Intergenic
947067102 2:226239980-226240002 CACTGGTGGGAGGGGGCAGGTGG + Intergenic
947572387 2:231246351-231246373 TATTGGCGGGGGAGGGTAGGAGG - Intronic
947789453 2:232855790-232855812 AAGAGATGGGGGTGGGCAGGGGG - Intronic
947808997 2:232988166-232988188 CAGTGGTGGGGGAGGGAGCAGGG - Intronic
947809015 2:232988184-232988206 CACTGGGGGAGGAGGGGAGGTGG + Intronic
948233692 2:236370803-236370825 GGGTGGTGGGGGTGGGCTGGTGG + Intronic
948236560 2:236395124-236395146 CAGCGCTGGGGGTGGGAAGGGGG + Intronic
948397450 2:237657057-237657079 CAGTGGTGGGAAAAGGCTGGCGG + Intronic
948501585 2:238398158-238398180 GAGAGGTGGGGGGGAGCAGGGGG + Intronic
948542889 2:238702772-238702794 CAGGGGTGGGGCAGGGGTGGAGG - Intergenic
948664148 2:239524030-239524052 CAGGGCTGGGGGTGGGCAGGGGG - Intergenic
948718488 2:239881408-239881430 CCCTGGTGGGGCAGGGCAGTGGG - Intergenic
948725078 2:239929609-239929631 CAGTGGAGGAGCAGGGCTGGTGG - Intronic
948725118 2:239929779-239929801 CAGTGGAGGAGCAGGGCTGGTGG - Intronic
948768923 2:240237532-240237554 AGGTGGTGGGGGAGGGGAAGGGG - Intergenic
948793007 2:240388849-240388871 CAGAGGTGGGGTTGGGCAGGAGG + Intergenic
948810061 2:240470219-240470241 CAGTAGTGGCTTAGGGCAGGAGG - Intergenic
948914027 2:241021203-241021225 CAGTGGTGGGGAAGAGCAATGGG - Intronic
948922618 2:241072832-241072854 CAGTTGGGGGCGAGGGCATGAGG + Intronic
1169122534 20:3105963-3105985 CAGCGGGGGAGGAAGGCAGGTGG + Intergenic
1169355502 20:4901620-4901642 CAGTGGGAGGGGAGGGCAGCCGG - Intronic
1169408804 20:5349323-5349345 CAGTGGTGGGGAAGTGGGGGAGG + Intergenic
1169581312 20:7026355-7026377 GAGTGTTGGAGGAGGGGAGGTGG + Intergenic
1170177673 20:13490665-13490687 GAGGGGTGAGGGAGGGAAGGAGG - Intronic
1170327345 20:15171296-15171318 CAGTGGTGGAGGAGGAGAGATGG - Intronic
1170690100 20:18606772-18606794 CTGTGGTGGGGGGGGGGAGGGGG + Intronic
1170817839 20:19729806-19729828 CAGTGGTGTGGGAAGCCAGGAGG + Intergenic
1171002310 20:21426815-21426837 CAGTGGAGAGGGAGAGCAGAAGG - Intergenic
1171167707 20:22986547-22986569 CAGAGCCGGGGGAGGGCAGGGGG + Intergenic
1171337245 20:24395415-24395437 CAGAGGTGGTGGGGGTCAGGGGG + Intergenic
1171360228 20:24582137-24582159 CAGTGGGGAGGGAGTGCAGCAGG - Intronic
1171483063 20:25468452-25468474 CAGTCGGGGGACAGGGCAGGGGG - Intronic
1171557605 20:26092364-26092386 CAGAGGAGGCAGAGGGCAGGAGG + Intergenic
1171560497 20:26120484-26120506 GAGGGATGGGGAAGGGCAGGGGG - Intergenic
1171958318 20:31475974-31475996 GAGCGGTGGGGAAGGGGAGGAGG + Intronic
1172006584 20:31822589-31822611 CAGGGGTGCGGCAGGGCTGGGGG + Intronic
1172014490 20:31864885-31864907 CTGTGGTGGGGGAGGGGGAGGGG - Intronic
1172077567 20:32310941-32310963 CAGTGGTGGGGGTGGGGAAGAGG + Exonic
1172083183 20:32358573-32358595 CGGCGGTGGGGGAGGGGCGGCGG - Exonic
1172104829 20:32510696-32510718 CAGTGGTTGGGGGGTGGAGGTGG + Intronic
1172240238 20:33408271-33408293 CACTGGTGGAGGGGGGCAGCAGG + Exonic
1172271189 20:33656667-33656689 CAGTAATGGAGGGGGGCAGGAGG + Intergenic
1172280437 20:33703983-33704005 TAGGGGTTGGGGAGGGCAGAGGG - Exonic
1172698123 20:36836059-36836081 GGGTGGTGGGGGAAGGCAGTAGG - Intronic
1172723457 20:37016924-37016946 CAGGGGAGGGGGAGAGGAGGGGG + Intronic
1172831331 20:37837721-37837743 CAGTGGTGGAGGTGGGCATGGGG - Intronic
1172995437 20:39066812-39066834 GAGTGATGGGGGAGGGTCGGGGG + Intergenic
1173180538 20:40803426-40803448 CTGTGTTGGGAGTGGGCAGGGGG - Intergenic
1173226272 20:41164019-41164041 CAGGGCTGGGGGAGGGAAGATGG + Intronic
1173451540 20:43168688-43168710 CAGTTGTGGGGCAGGGCACATGG - Intronic
1173602755 20:44307730-44307752 CAGGGGTGGGGTAGGGGAGGAGG - Intronic
1173654473 20:44690177-44690199 CACTTGTGGGGGAGGGGAGGAGG + Intergenic
1173666352 20:44766074-44766096 CTGTGGTGGGGGAGGGACAGGGG + Intronic
1173679638 20:44868724-44868746 CAGTGATGGGGTAGTGGAGGAGG + Intergenic
1173752049 20:45484858-45484880 CAGTGGTGGGGTGGGGGATGGGG + Intergenic
1174061426 20:47835667-47835689 AAGTGGTGGGGGCAGGCGGGGGG - Intergenic
1174070100 20:47893656-47893678 AAGTGGTGGGGGCAGGCGGGGGG + Intergenic
1174101220 20:48127522-48127544 AAGTGGTGGGGGCAGGCGGGGGG - Intergenic
1174156293 20:48517569-48517591 AAGTGGTGGGGGCAGGCGGGGGG - Intergenic
1174183382 20:48688918-48688940 TGGTGGTGGTGGAGGGCAGGTGG - Intronic
1174343674 20:49914496-49914518 CATTGGTGTGGGTGGGGAGGTGG - Intronic
1174431467 20:50472860-50472882 CAATGGTGGGGGCGGGGTGGTGG - Intergenic
1174772844 20:53317499-53317521 CTGGGGTGGGGGAGAGGAGGAGG - Intronic
1174949523 20:55028971-55028993 CAGTGGTGGGAGTGGTCATGTGG + Intergenic
1175176620 20:57116153-57116175 CAGGGGTGGGGTAGGGGAAGAGG + Intergenic
1175221326 20:57418407-57418429 CAGAGCTGGGGGTGGGGAGGTGG - Intergenic
1175278819 20:57788944-57788966 AGTTGGTTGGGGAGGGCAGGAGG + Intergenic
1175408198 20:58748787-58748809 CTGTGGTTGGGGAGGGAGGGAGG - Intergenic
1175441451 20:58995242-58995264 CAAGGGTGGGGGAGGGAGGGAGG - Exonic
1175444512 20:59010752-59010774 CAGTGGTGCTTGAGGGCAGAGGG + Intergenic
1175573874 20:60045730-60045752 CAGAGGCAGGGGAGGGTAGGAGG + Intergenic
1175723808 20:61303387-61303409 CAGGGGTGGGGGACAGCAAGGGG + Intronic
1175828828 20:61951115-61951137 CAGGGCTGGGGGAGGGGAGAGGG - Intergenic
1175828847 20:61951150-61951172 CAGGGCTGGGGGAGGGGAGAGGG - Intergenic
1175874808 20:62224310-62224332 CCGAGGTGGGAGAGTGCAGGAGG + Intergenic
1175918430 20:62438441-62438463 CAGTGGTGCAGGAGGGCTGCCGG + Intergenic
1175990260 20:62785250-62785272 CAGAGGTGGGGGATGGAGGGTGG + Intergenic
1176037135 20:63045107-63045129 CTGAGGTGGGAGAGGGGAGGAGG - Intergenic
1176093040 20:63327403-63327425 CAGACGTGGTGGAGGGGAGGTGG + Intronic
1176099835 20:63359960-63359982 CAGGGGTGGGAGAGAGCCGGAGG - Intronic
1176125522 20:63472965-63472987 GAGTGGAGGGGGAGGGGAGGGGG + Intergenic
1176125545 20:63473007-63473029 GAGGGGGAGGGGAGGGCAGGGGG + Intergenic
1176136181 20:63522981-63523003 CAGTGGTGGGGGAGGGACTCTGG + Intergenic
1176195447 20:63834764-63834786 CAGTGAGGGTGGAGGGCAGGTGG - Intergenic
1176201974 20:63865181-63865203 CACTGGTGGGGGCGGGAAGAAGG + Intergenic
1176304476 21:5115965-5115987 CAGTGGGTGGGGAGGGCCGAGGG + Intergenic
1176385759 21:6137934-6137956 CTGGGATGGCGGAGGGCAGGTGG + Intergenic
1176715612 21:10346862-10346884 GAGTGGGTGGGGAGGGCAAGAGG - Intergenic
1176960598 21:15154753-15154775 GTGTGTTGGGGGAGGGGAGGTGG + Intergenic
1177128548 21:17228027-17228049 CAGAGGTTAGGAAGGGCAGGAGG + Intergenic
1178202839 21:30427196-30427218 CAGTGTTGGGGAAGGCCTGGTGG + Intergenic
1178493918 21:33071210-33071232 CAGGGGTGGGGGCGGGGAAGGGG - Exonic
1178616962 21:34143158-34143180 CCGGGGTGGGGCAGGGGAGGAGG + Intergenic
1178685332 21:34706190-34706212 CAGTCGTGGAGGAGGGCAAAGGG + Intronic
1178951981 21:36992800-36992822 CAGGGGAGGGGGAGTGGAGGTGG - Intergenic
1179101770 21:38360652-38360674 ATGTTGTGGGAGAGGGCAGGTGG + Intergenic
1179135777 21:38678837-38678859 AAGGGGAGGGGGAGGGGAGGGGG + Intergenic
1179135784 21:38678848-38678870 GAGGGGAGGGGGAGGGGAGGGGG + Intergenic
1179428194 21:41298938-41298960 GAGTGGGGAGGGAAGGCAGGGGG + Intergenic
1179562958 21:42228380-42228402 CTGTGGCTGGGGAGGGCAGTGGG - Intronic
1179626813 21:42653714-42653736 CAGGGGAGGGGGCGGGCGGGGGG - Intronic
1179714618 21:43280611-43280633 CAGTGGAGGTGGAGGGGACGGGG + Intergenic
1179724681 21:43335511-43335533 CTGGGGTAGGAGAGGGCAGGAGG + Intergenic
1179737714 21:43400318-43400340 CTGGGATGGCGGAGGGCAGGTGG - Intergenic
1179837719 21:44048322-44048344 CAGAGGGTGGGGAGGGCAGGGGG - Intronic
1179852580 21:44146065-44146087 CAGTGGGTGGGGAGGGCCGAGGG - Intergenic
1179879983 21:44289517-44289539 CTGGGGTGGGGGCGGGCTGGAGG + Intronic
1179884569 21:44308089-44308111 CGGAGGTGGGGGAATGCAGGAGG + Intronic
1180190953 21:46162172-46162194 CAGTGGGGGGTGGCGGCAGGTGG - Intronic
1180202411 21:46232559-46232581 CAGGGGTTGGGGAGGGAATGGGG + Intergenic
1180308736 22:11151364-11151386 CAGTGGTGGGGCTGGGGAGTAGG - Intergenic
1180536153 22:16394469-16394491 AACTGGTGGGGGAGGGGTGGGGG + Intergenic
1180547213 22:16513175-16513197 CAGTGGTGGGGCTGGGGAGTAGG - Intergenic
1180669546 22:17542589-17542611 CACTGGTTGGGGGGGACAGGTGG - Exonic
1180732593 22:17993413-17993435 CAGGGGTGGAGGAAGGCAAGTGG - Intronic
1180749443 22:18114020-18114042 CAGTGATGGGGGTGGGCAGGAGG + Intronic
1180789347 22:18566115-18566137 GGGTGGTGGGGGTAGGCAGGAGG - Intergenic
1180830247 22:18901998-18902020 AAGTGGTGGGGGATGGGAGGAGG - Intergenic
1180949532 22:19714886-19714908 CAGGGCTGGGTGAGGGCCGGCGG - Intronic
1180996979 22:19970579-19970601 GAGTGGGGTGGGGGGGCAGGAGG + Exonic
1181069464 22:20323532-20323554 AAGTGGTGTGGGATGGGAGGAGG + Intergenic
1181232394 22:21429196-21429218 GGGTGGTGGGGGTAGGCAGGAGG + Intronic
1181236639 22:21451062-21451084 CCGGGGTGGGAGAGGGCAGAGGG - Exonic
1181246257 22:21505661-21505683 GGGTGGTGGGGGTAGGCAGGAGG - Intergenic
1181278113 22:21699454-21699476 CACTCCTGGTGGAGGGCAGGTGG + Exonic
1181517337 22:23422734-23422756 CAGGGGTGGAGGAAGGCAAGTGG - Intergenic
1181807806 22:25385585-25385607 CTGGGCTGGGAGAGGGCAGGTGG - Intronic
1181983563 22:26783343-26783365 CATTGGTGGGAGGGGGCATGGGG + Intergenic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1182211956 22:28684160-28684182 CAGTGGTGGGGGTGGGGGGTAGG + Intergenic
1182254802 22:29030733-29030755 CAGGGCTGGTGGAGGGGAGGAGG + Intronic
1182537672 22:31017352-31017374 CAGTGCTTGGGGAGGCCAAGGGG - Intergenic
1182679836 22:32070229-32070251 GAGGGGAGGGGGAGGGGAGGGGG - Intronic
1182697467 22:32206521-32206543 CAGCTGTGGGGGAGGGTCGGGGG + Intergenic
1182920786 22:34077067-34077089 CAGAAGTGGGGGTGGGCAGGTGG - Intergenic
1183192304 22:36329473-36329495 ACGCAGTGGGGGAGGGCAGGGGG - Intronic
1183196761 22:36358745-36358767 AAGTGGCAGGGGAGGCCAGGAGG - Intronic
1183311465 22:37112158-37112180 CAGGGCTGGGCCAGGGCAGGAGG + Intergenic
1183343667 22:37295351-37295373 GTGTGGTGGGGGAGGGGAGGAGG - Intronic
1183457360 22:37930062-37930084 CCTTGGTGGTGGAGGGCACGGGG + Intronic
1183536414 22:38404216-38404238 CAGTGCTAGGGGAGGGCGGGAGG - Intergenic
1183717722 22:39543641-39543663 GAGTGGTGGAGGAGGGGAGGTGG + Intergenic
1183751492 22:39723598-39723620 GAGAGGAGAGGGAGGGCAGGAGG - Intergenic
1183930671 22:41234323-41234345 CAGAGGTGGGGGCAGGGAGGAGG + Intronic
1184099963 22:42336782-42336804 CAGTCGTGAGGGAGGTCAGGGGG - Intronic
1184193256 22:42908992-42909014 CAGGGTTGGGGGAATGCAGGAGG + Intronic
1184198025 22:42945231-42945253 CAGTGGGGGACGAGGGCAAGAGG + Intronic
1184272685 22:43393544-43393566 CTGTGGTGGGGGAGGGGCTGTGG + Intergenic
1184302743 22:43572034-43572056 CACTGATGGGACAGGGCAGGAGG + Intronic
1184335700 22:43851884-43851906 CAGTCGTGAGGGTGGCCAGGTGG - Intronic
1184341839 22:43890597-43890619 CAGTGGTTCTGGGGGGCAGGCGG - Intronic
1184453090 22:44594448-44594470 TAGGGGTGGGAGGGGGCAGGAGG - Intergenic
1184654720 22:45935336-45935358 CAGTGGTGGGCGAGGAGCGGTGG - Intronic
1184711250 22:46250647-46250669 CCGCGGCGCGGGAGGGCAGGTGG - Exonic
1184732157 22:46376943-46376965 CAGAGGTGGGGGTGGTGAGGAGG + Intronic
1184760087 22:46538731-46538753 CAGTGGTCGGGGACGGTAGGTGG + Intergenic
1184881820 22:47310500-47310522 CATTGGTGGCGTAGGGCTGGGGG - Intergenic
1184892745 22:47389710-47389732 CCTGGGTGGGGGAGGGGAGGGGG - Intergenic
1184933710 22:47702223-47702245 GAGAGGAGGGGGAGGGGAGGGGG - Intergenic
1184981534 22:48099281-48099303 CAGTTCTGGGAGAGGGCAGGTGG - Intergenic
1185160991 22:49229773-49229795 CAGTGGTCGGGGATGGCAGTGGG - Intergenic
1185166137 22:49263469-49263491 CAGGGGTGGTGGAGGGGACGGGG - Intergenic
1185167261 22:49269388-49269410 CTGTTGTGGGGTGGGGCAGGGGG - Intergenic
1185224817 22:49646503-49646525 CAGGGGTGGGGAATGGCAGGGGG - Intronic
1185229824 22:49673587-49673609 CAGAGGGGGGGGAAGGGAGGAGG + Intergenic
1185279444 22:49963693-49963715 CAGTGGGGAGGCAGGGGAGGGGG + Exonic
1185314793 22:50174337-50174359 CAGGACTGGGGGAGGGCCGGGGG + Intronic
1185324351 22:50218398-50218420 CAGGGCTGGCGGAGGGCAGAAGG + Exonic
1185338586 22:50281755-50281777 CAGTGGTCGGGGTGAGGAGGAGG + Intronic
1185415337 22:50706227-50706249 AGGTGGTACGGGAGGGCAGGCGG + Intergenic
1203280336 22_KI270734v1_random:127269-127291 AAGTGGTGGGGGATGGGAGGAGG - Intergenic
949608969 3:5684186-5684208 AGGTGGGGTGGGAGGGCAGGTGG + Intergenic
949683909 3:6546754-6546776 CTGTGGTGGGGTGGGGGAGGGGG - Intergenic
949876015 3:8626538-8626560 TAGTGGTGGGGGAGGGGGGGGGG - Intronic
950102323 3:10365466-10365488 CCAGAGTGGGGGAGGGCAGGAGG + Intronic
950158826 3:10743753-10743775 CAGTGGCGGGGGAGGGTGGAGGG - Intergenic
950249659 3:11453796-11453818 CAGTGATGGGGGAGTGCAAGGGG + Intronic
950266246 3:11575213-11575235 CTGTGGTGCGAGAGGGAAGGCGG + Intronic
950285574 3:11742218-11742240 CAGTGGGAGGGGAGGGGAGTGGG - Intergenic
950412430 3:12847829-12847851 CTATGGTGGGGGTGGGTAGGCGG + Intronic
950535908 3:13577969-13577991 CAGTGGAGGAGGAGGGCTTGTGG + Intronic
950704872 3:14773414-14773436 AAGTGAGGGGGGAGGGGAGGGGG + Intergenic
950751907 3:15135841-15135863 CTGTGGTGGGGGAGGGGATGTGG + Intergenic
950772526 3:15323688-15323710 AAGCCGTGGGGAAGGGCAGGTGG - Intronic
951688283 3:25369047-25369069 CAGTGGTGGGAGAGAGGAGTAGG + Intronic
952377697 3:32781067-32781089 CTGGGGTGGGGGAGGGCCGAGGG - Intergenic
952742085 3:36743841-36743863 GATTGGTGGGGGAGTGGAGGTGG - Intergenic
952942892 3:38456699-38456721 CAGGGGTGGGGTGGGGCAAGGGG + Intronic
952964713 3:38614112-38614134 GGCTGGTCGGGGAGGGCAGGCGG - Intronic
953191858 3:40695147-40695169 CAGAGCAGGGGCAGGGCAGGAGG + Intergenic
953331852 3:42060348-42060370 TGGTGGTGGGTGAGGGCGGGTGG + Intronic
953391278 3:42535275-42535297 CAGGGGTGGGGCAGGGCTGGGGG + Intronic
953393190 3:42545670-42545692 CAGTGGTGGGGGAAGGGGCGGGG - Intergenic
953635567 3:44660918-44660940 AAGTGATGGGAGAGGGGAGGTGG + Intergenic
953882986 3:46701208-46701230 CTGAGGTGGGGGTGGGCGGGAGG - Intergenic
953902851 3:46853000-46853022 GAGGGGTGGGAGGGGGCAGGGGG - Intergenic
953916215 3:46922666-46922688 CAGTGGAGGGGCTGGGCCGGTGG - Intronic
953925258 3:46979516-46979538 CACTGGTGGGGCAGGGCAGCGGG + Intronic
954110449 3:48430105-48430127 CAGAGGTGGGGGCCGGAAGGAGG - Intergenic
954333251 3:49901942-49901964 CGGGGGTGGGGGAGGGGAGGGGG + Intronic
954405858 3:50344788-50344810 GAGGGGTTGGGGAGGGCGGGAGG - Intronic
954416485 3:50395850-50395872 GAGTGGTGGGGGAGGCTATGAGG + Intronic
955281240 3:57596959-57596981 CTGTGGTGGGGGAGGGGCGCCGG - Intronic
955333368 3:58065695-58065717 GAGTGATGGGTGAAGGCAGGAGG - Intronic
955598671 3:60620639-60620661 CAGAGGAGGGGGAGGGAAAGAGG + Intronic
956035334 3:65084665-65084687 CAGTGGTGGGGGTGGGGGGTGGG - Intergenic
956960926 3:74399826-74399848 CAGAGGCTGGGAAGGGCAGGAGG - Intronic
957068703 3:75548463-75548485 CTGTGGTGGGGGAGGGGTTGTGG - Intergenic
957494572 3:80975296-80975318 CAGTGATGGGGGAAGGCAAGGGG + Intergenic
957541707 3:81579654-81579676 GAGTGGTGGGGGTGGGGAGGGGG - Intronic
957645725 3:82922309-82922331 CAGAGGCTGGGAAGGGCAGGGGG + Intergenic
957911771 3:86627094-86627116 ATTTGGTGGGGGAGAGCAGGGGG + Intergenic
958132319 3:89443732-89443754 CAGTGGTGAAGGGGGCCAGGTGG + Intronic
959156643 3:102674497-102674519 CAGTGGCTGGGGCGGGCAGAAGG - Intergenic
959358845 3:105366194-105366216 GAGTGGTGGGGGTGAGCAGGGGG + Intergenic
959539644 3:107524138-107524160 GGGTGGTGGTGGAGGGGAGGAGG + Intronic
960536569 3:118822077-118822099 GAGAGGTGGGGGTGGGAAGGAGG - Intergenic
960615281 3:119590852-119590874 CAGTGGTGAGGGGGAGGAGGGGG - Intergenic
961017487 3:123479108-123479130 CAGTGCTGGGGCAGGCCAGGGGG + Intergenic
961142142 3:124564569-124564591 CAGTGGGGGGCTGGGGCAGGAGG + Intronic
961244144 3:125436789-125436811 CACTGCTGGGGGAGGGCTAGGGG + Intergenic
961284707 3:125791857-125791879 CTGTGGTGGGGGAGGGGATGTGG + Intergenic
961384291 3:126515708-126515730 CAGATGAGGGGGAGGGTAGGTGG - Intronic
961384329 3:126515805-126515827 CAGATGAGGGGGAGGGTAGGTGG - Intronic
961391257 3:126553461-126553483 CAGGGGTGGTGGGGGGCAGAAGG + Intronic
961519618 3:127459422-127459444 AAGAGATGGGGGAGGGCAAGAGG + Intergenic
961814621 3:129543122-129543144 GAGTGGTGGGGGTGGGCTGCTGG + Intergenic
961940884 3:130636798-130636820 AAGGGGAGGGGGAGGGGAGGGGG - Intronic
961940898 3:130636821-130636843 AAGGGGAGGGGGAGGGGAGGAGG - Intronic
962237843 3:133723802-133723824 CTGTGGTGGGGTGGGGAAGGGGG - Intergenic
962808903 3:138945785-138945807 CCGTGGTGCGGTGGGGCAGGCGG + Exonic
962973310 3:140424872-140424894 CTGTGGTAGGGGAGGGTGGGTGG + Intronic
963193688 3:142502463-142502485 AAGGGGTGGGGGAGGGAGGGAGG + Intronic
963402307 3:144814965-144814987 CACTGGTGGGGTTGGGTAGGGGG - Intergenic
963799003 3:149658379-149658401 CGGGGGTGGCGGAGGGCACGCGG + Intronic
964413699 3:156425919-156425941 AAGTGGAGAGGGAGGGCAAGAGG + Intronic
964584531 3:158282081-158282103 CAGGGCTGGGGGTGGGGAGGTGG - Intronic
964639381 3:158892419-158892441 CACTGGAGGGATAGGGCAGGAGG - Intergenic
964664006 3:159152096-159152118 CAGTGGTGAGGGAGGTGAGGTGG + Intronic
965029836 3:163351891-163351913 CTGTTGTGGGTGGGGGCAGGGGG - Intergenic
965349920 3:167599351-167599373 CAGTGGTGGTGGTGGTCATGAGG - Intronic
965528595 3:169747818-169747840 TAGGGGTGGTGGAGGGAAGGGGG - Intergenic
965612787 3:170562485-170562507 CAGTGGGGAGGGTGGGAAGGGGG + Intronic
965634735 3:170769552-170769574 CAGGTCTAGGGGAGGGCAGGAGG + Intronic
965759469 3:172060339-172060361 TAGTGGTGGTGGTGGGCAGAGGG + Intronic
965908457 3:173740522-173740544 CAGGGGTATGGGAGGGCATGAGG - Intronic
966824872 3:183955023-183955045 GAGTGGTGGGGGAGTGGTGGGGG + Intronic
966881771 3:184354690-184354712 CAGTGGAGGGGGAGGGCAGGGGG + Intronic
966912391 3:184566708-184566730 CAGCGGGGCAGGAGGGCAGGGGG - Intronic
967192505 3:186997025-186997047 CTGTGTTGGAGGCGGGCAGGTGG + Intronic
967228028 3:187311986-187312008 CAGGGGTGGGGGTGGGGAGGGGG + Intergenic
967459776 3:189732252-189732274 CAGGGGTGGTGGAGGGGAGTTGG - Intronic
967572132 3:191042308-191042330 CTGTGGTGGGGTGGGGGAGGGGG - Intergenic
967853368 3:194098527-194098549 GAGTGCTGGGGCAGGGGAGGAGG - Intergenic
967922002 3:194620657-194620679 CAGTGGTGGGGCTGGCCTGGGGG + Intronic
967948971 3:194825618-194825640 CAGTGTTGAGGGAGGACAGATGG - Intergenic
967973881 3:195020070-195020092 GAGAGATGAGGGAGGGCAGGAGG - Intergenic
968024907 3:195433087-195433109 TAGTGCAGGGGGTGGGCAGGGGG - Intronic
968066368 3:195761787-195761809 CAGCGGTGGAGGAGGGCGGGAGG + Intronic
968135409 3:196216659-196216681 CCGGGGTGAGGAAGGGCAGGCGG - Exonic
968155155 3:196374879-196374901 GAGGGGAGGGGGAGGGGAGGGGG + Intronic
968523691 4:1045989-1046011 AAGGGGTCGGGGAGGGCTGGGGG - Intergenic
968606582 4:1538342-1538364 CAGTGGTGGGAGGGGAGAGGTGG + Intergenic
968628240 4:1637603-1637625 CAGGAGAGGGGGAGGGCTGGGGG + Intronic
968727034 4:2252552-2252574 CTGGGGTGGGGGAGGGCAGCAGG + Intronic
968739495 4:2320131-2320153 AGGAGGTGGGGGAGGGGAGGGGG - Intronic
968899734 4:3425658-3425680 CAGTGCAGGGGAGGGGCAGGTGG + Intronic
968952006 4:3700217-3700239 GAGTGGAGGGGGAGGGGGGGAGG + Intergenic
969013034 4:4083004-4083026 CTGTGGTGGGGGAGGGGATGTGG - Intergenic
969162530 4:5273836-5273858 CTGTGGTGGGTGGGGGGAGGGGG + Intronic
969196745 4:5569228-5569250 CAGGTGTGGGGCAGGGGAGGTGG + Intronic
969220328 4:5754857-5754879 AAGTGTTGACGGAGGGCAGGCGG - Intronic
969418687 4:7077203-7077225 CAGTGCTGGGGCAGAGCTGGAGG - Intergenic
969421186 4:7097102-7097124 CGGGGCTGGGGGAGGGCAGCTGG + Intergenic
969442708 4:7226762-7226784 CGTTGGTGGGGGATGGAAGGGGG + Intronic
969586392 4:8096709-8096731 CAGGGGCTGGGGAGGGAAGGGGG + Intronic
969703204 4:8779025-8779047 CAGAGGTCAGGGAGGGCACGGGG - Intergenic
969731421 4:8959919-8959941 CACTGGGAGGGCAGGGCAGGGGG + Intergenic
969740810 4:9024790-9024812 CTGTGGTGGGGGAGGGGATGTGG + Intergenic
969800148 4:9557621-9557643 CTGTGGTGGGGAAGGGGATGTGG + Intergenic
970030819 4:11672641-11672663 CAGTGGTGAGGAAGGGCTGGAGG - Intergenic
970289416 4:14555002-14555024 CTGTGGTGGGGTGGGGGAGGGGG + Intergenic
970454109 4:16204835-16204857 CAGTGGTGAGTGAGGCCAGAAGG - Intronic
970501287 4:16679768-16679790 CAGAGGTGAGGGTGGGCAAGGGG + Intronic
970538585 4:17055211-17055233 CAGTGTTGAGAGAGGGCTGGGGG - Intergenic
970761645 4:19496556-19496578 TAGTGGTGGGGGAGAGTAGGAGG + Intergenic
970826171 4:20278802-20278824 CAGTGGTGGGGGGCGGTGGGGGG + Intronic
970919727 4:21379867-21379889 GGGTGATGGGGGTGGGCAGGTGG - Intronic
971190171 4:24420700-24420722 AAGTGGTAGGGGAGGGCTGCTGG - Intergenic
971220653 4:24702824-24702846 GAATGATGGGGGAGGGCAGTGGG + Intergenic
971384733 4:26132565-26132587 CAGTGCAGCGGGAGGGCAGGTGG - Intergenic
971521783 4:27561532-27561554 CAGGGGTGGGTGGGGGCAAGTGG + Intergenic
971880103 4:32360709-32360731 CTGTGGTGGGGTGGGGGAGGGGG - Intergenic
972630227 4:40835962-40835984 CTGGAGTGGGGGAGGGAAGGAGG + Intronic
972640021 4:40916894-40916916 CTGTGGTGGGGAAGGTCAGAGGG + Intronic
972738232 4:41866054-41866076 CTGGGGTTGGGGAAGGCAGGTGG - Intergenic
973155287 4:46943963-46943985 CAGTGGTGGTGTGGGCCAGGGGG + Intronic
973279788 4:48347318-48347340 CAGGGGTGGGGGAGGGGGGGTGG - Intronic
973532906 4:51850943-51850965 GAGTTGTGGGGGAGGGCAGAGGG + Intronic
973772254 4:54217716-54217738 CAGTGCTGGGGGAGGGGAGGAGG - Intronic
973779138 4:54271969-54271991 GAGGGGAGGGGGAGGGGAGGGGG - Intronic
974220352 4:58961361-58961383 CAGTGCTATGGGAGGGCTGGAGG - Intergenic
974761773 4:66285545-66285567 CAGTGCTGATGGAGGGCAGGAGG + Intergenic
974806123 4:66882915-66882937 CTCTGGTGGGGCAGGGCAGAAGG + Intergenic
974831355 4:67193314-67193336 CCCTGGTAGGGGAGGGCAAGAGG + Intergenic
974833397 4:67216430-67216452 GAGGGGAGGGGGAGGGGAGGGGG + Intergenic
974849264 4:67385605-67385627 AAGGGGAGGGGGAGGGGAGGGGG + Intergenic
975715883 4:77205517-77205539 CCGTGGCGGGGTAGGGGAGGAGG - Intronic
975996445 4:80321512-80321534 CAGTGGCGGTGGTGGGCGGGGGG - Intronic
976026485 4:80693541-80693563 CTGTGGTGGGGTGGGGGAGGGGG + Intronic
976201569 4:82584763-82584785 CAGAGGTGGTGGAGGGGAGGGGG - Intergenic
976556183 4:86453573-86453595 CTGTGGTGGGGGTGGGGTGGGGG - Intronic
976775117 4:88698750-88698772 CAGTGCGGGGGAGGGGCAGGAGG - Intronic
977293960 4:95191915-95191937 CAGGGGAGGAGGTGGGCAGGGGG - Intronic
977512439 4:97978507-97978529 CAGTGGTGGAGGGTGGGAGGAGG + Intronic
978110926 4:104963492-104963514 CAGTGGATGGGATGGGCAGGTGG + Intergenic
979217142 4:118179500-118179522 AAGTGGTAAGGGAGGGAAGGTGG + Intronic
979541612 4:121890150-121890172 CAGAAGTTGGAGAGGGCAGGGGG + Intronic
979630761 4:122900062-122900084 CAGTGGTGGTGGGGGCCGGGGGG - Intronic
980075299 4:128287824-128287846 GTGGGGTTGGGGAGGGCAGGGGG - Exonic
980581758 4:134763350-134763372 CAACAGTGGGGGAAGGCAGGAGG + Intergenic
980999649 4:139816522-139816544 CAGCGGTGGGGGAGGGAGAGAGG + Intronic
981337063 4:143580415-143580437 CAGTGGTAGGGGTGGTCATGGGG - Intronic
981555268 4:145986668-145986690 GAGTGATGGGGGTGGGGAGGTGG + Intergenic
981691644 4:147515359-147515381 CTGTGGTGGTGGGGGGAAGGGGG + Intronic
981968811 4:150639197-150639219 CTGTGGTGGGGTAGGGGAAGGGG + Intronic
982212585 4:153051227-153051249 CAGTGGCGAGCGGGGGCAGGAGG - Intergenic
982241956 4:153308839-153308861 CAGAGGTGGGGCAGGGGAGAGGG - Intronic
982276046 4:153638195-153638217 CAGTGGTGGGCAGGGGCTGGGGG + Intergenic
982329855 4:154169543-154169565 GAAGGGTGGGGGAGGGGAGGGGG - Intergenic
982878930 4:160686206-160686228 CAATGGTGGCACAGGGCAGGGGG - Intergenic
983258820 4:165432860-165432882 CAGTGCTTGGTGAGGGCTGGAGG - Intronic
983685231 4:170400587-170400609 AAGTGGAGTGGGAGGACAGGAGG - Intergenic
984287389 4:177749569-177749591 CAGAGGTGGGTGAGGGTAGAGGG - Intronic
984658963 4:182352089-182352111 GAGGAGTGGGGGAGGGGAGGAGG - Intronic
984824278 4:183910499-183910521 CAGGGCTGGGGGAGGGGAGAGGG - Intronic
984873789 4:184349858-184349880 CAGTGGAGGATGAGGACAGGGGG + Intergenic
985184284 4:187298439-187298461 CTCTGCTGGGCGAGGGCAGGAGG + Intergenic
985637069 5:1041216-1041238 CAGTGGTGAGTGAGGGCTGAGGG + Intergenic
985658113 5:1142465-1142487 AAGGGGAGGGGGAGGGGAGGGGG - Intergenic
985705862 5:1401028-1401050 CAGTGGTGGGTGCTGGCAGTGGG - Intronic
985784831 5:1887996-1888018 CAGGGTTAGGGGAGGGCATGGGG + Intergenic
985863707 5:2495164-2495186 CAGTGCTGAGGCTGGGCAGGAGG + Intergenic
985894863 5:2743070-2743092 GAGTGGTGGGAGAGGGCTCGGGG - Intergenic
986074936 5:4326816-4326838 CAGTAGAGGTGGAGGGCAGCAGG - Intergenic
986302181 5:6486424-6486446 CTGTGGTGGGAGAGGACAAGGGG - Intronic
986357795 5:6945612-6945634 GAGTGATGAGGGAGGGCAGGAGG - Intergenic
986573144 5:9185937-9185959 CAGTGGTGGGGAAGAGCCAGTGG + Intronic
987232937 5:15913930-15913952 CGGGGGTTGGGGAGGGCAGGGGG + Intronic
987380046 5:17276245-17276267 CAGCGGTGGAGGAGTGCATGTGG - Exonic
988460034 5:31426845-31426867 GAGCGGTGGGGGATGGCAGCCGG + Intronic
988798435 5:34673958-34673980 GAGTGGGTGGGGAGGGTAGGAGG + Intronic
988801174 5:34698111-34698133 GAGGGGAGGGGGAGGGGAGGGGG - Intronic
988965727 5:36415836-36415858 CAGTGGTTGTATAGGGCAGGAGG + Intergenic
989125012 5:38044603-38044625 CAGGGCTGGGGGAGGGGGGGTGG - Intergenic
990277014 5:54208034-54208056 CAGTGGTGGGGGAAGCAAGGGGG - Intronic
990434762 5:55777583-55777605 AGGTGTCGGGGGAGGGCAGGTGG + Intronic
990743700 5:58937232-58937254 CAGGGGAGGGGGAGGGGCGGGGG + Intergenic
991045393 5:62217820-62217842 CTGTGGTGGGGGTGGGCAAGAGG - Intergenic
991054983 5:62310396-62310418 CAGTAGTGGGGGTGGGAATGGGG - Intronic
991292301 5:65044809-65044831 CTGGGGTGGGGGATGGCAGTGGG - Intergenic
991952793 5:71963019-71963041 CAGTGGTGGTGAGGGGGAGGAGG - Intergenic
992198109 5:74359570-74359592 CAGTGGAGGGTGAGGGGAAGGGG + Intergenic
992415999 5:76551885-76551907 GAGGGGAGGGGGAGGGGAGGGGG + Intronic
992613047 5:78523926-78523948 CTGTGGAGGGGCTGGGCAGGGGG + Intronic
992652409 5:78872660-78872682 CTGTGGTGGGGAGGGGGAGGGGG + Intronic
992980257 5:82162829-82162851 CAGGGGCGGGGGTGGGGAGGAGG + Intronic
993124479 5:83816352-83816374 TAGTGTTGGGGCAGGGGAGGGGG - Intergenic
993266460 5:85732273-85732295 GATTGGTGGGGGAGGGGGGGTGG + Intergenic
993290547 5:86062578-86062600 CTGGCGTGGGGGAGGGCTGGGGG + Intergenic
993613161 5:90079070-90079092 CTGTGGTGGGGTGGGGGAGGGGG + Intergenic
994613765 5:102078177-102078199 CAGTGGTGGGGAAGCACAGGGGG - Intergenic
994906529 5:105846354-105846376 TAGTGGTGGTGGAGTTCAGGAGG - Intergenic
995106229 5:108380992-108381014 CGGTGGCGGGGGAGGGCCTGCGG - Exonic
995180707 5:109227913-109227935 CACTGGTGGGGCAGGACTGGTGG + Intergenic
996119671 5:119656872-119656894 CAGTAGTGGAGGAAGGCATGGGG + Intergenic
996503750 5:124244713-124244735 CAGTGGTGGATGAAGGGAGGGGG - Intergenic
996932830 5:128911231-128911253 GCCTGCTGGGGGAGGGCAGGGGG - Intronic
997206319 5:132052322-132052344 AGGAGGTGGAGGAGGGCAGGAGG + Intergenic
997225752 5:132208390-132208412 GAGGGGAGGGGGAGGGGAGGGGG + Intronic
997225759 5:132208401-132208423 GAGGGGAGGGGGAGGGGAGGGGG + Intronic
997381388 5:133440784-133440806 AAGTGGTGGGTGAGGGCTGGGGG - Intronic
997381512 5:133441487-133441509 CTGTGATGGGTGAGGGCTGGAGG - Intronic
997521195 5:134525583-134525605 GTGGGGTGGGGGCGGGCAGGAGG - Intronic
997625139 5:135326541-135326563 TGGTGGTGGGGGGGGCCAGGAGG - Intronic
998051681 5:139041233-139041255 ATGTGGTGTGGGAGGGCACGTGG - Intronic
998092803 5:139380909-139380931 CAGGGGTGGGGAGGGGCGGGTGG + Intronic
998170439 5:139869522-139869544 CTGTGCTGGAGAAGGGCAGGGGG - Intronic
998252327 5:140561556-140561578 CAGGGGTGGGGCAGGGAATGTGG - Intronic
998349044 5:141489062-141489084 GAGTGGCGGGGGTGGGCAGGGGG - Intronic
998400738 5:141847668-141847690 TGGAGGTGGGGGAGGGGAGGGGG - Intergenic
998486434 5:142506510-142506532 CAATGCTGGAGGAGAGCAGGAGG + Intergenic
998528498 5:142863983-142864005 GAATGGTGGGGAGGGGCAGGTGG - Intronic
998553188 5:143097221-143097243 CTGGGGTGGGGCAGGGGAGGCGG + Intronic
998584738 5:143415334-143415356 CAGAGGCTGGGAAGGGCAGGGGG + Intronic
998894573 5:146785864-146785886 CAGTGGTTGGGAAGGGCATAGGG + Intronic
999175583 5:149629554-149629576 CAGTGACAGGAGAGGGCAGGAGG + Intronic
999177226 5:149640000-149640022 CAGCCCTGGGGGAGGGGAGGAGG + Intergenic
999452866 5:151691506-151691528 GAGTGGTTGGAGAGGGCAGTGGG - Intergenic
999607606 5:153333259-153333281 CAGGGGTGGTGGGGGGCAAGGGG - Intergenic
1000092761 5:157944501-157944523 CAGTGGAGGGGGTCGGTAGGAGG + Intergenic
1000219876 5:159204380-159204402 AAGTAGTGGGGGGGGGCAGGGGG + Intronic
1000294523 5:159901434-159901456 GAGGGGAGGGGGAGGGGAGGGGG + Intergenic
1000393670 5:160750588-160750610 CAGTGATGGTGGAGGGAAAGAGG - Intronic
1000908493 5:166993021-166993043 CAGGAGTGGGGGAGGGGAGAGGG - Intergenic
1001003687 5:168031030-168031052 CAGTGGTCGGGGGGTGCAGTTGG - Intronic
1001335774 5:170795447-170795469 CAGGGGTGGAGGACGGCAGCTGG + Intronic
1001404974 5:171469803-171469825 CGGGGGTGGGGAGGGGCAGGGGG - Intergenic
1001426413 5:171625526-171625548 CACTGGTAGGGGCCGGCAGGAGG - Intergenic
1001625873 5:173132473-173132495 GAGGGGAGGGGGAGGGGAGGGGG - Intronic
1001771701 5:174301813-174301835 GTGTGGTGGGGGATGGGAGGGGG - Intergenic
1001838486 5:174852927-174852949 CAGTGGAGGGGGATGGCAGTGGG + Intergenic
1001975343 5:175994182-175994204 CAGTGGAGGGGCAGGCCAGAGGG - Intronic
1002033547 5:176448255-176448277 CAGAGGTGGCGGGGGGCGGGGGG + Intronic
1002084326 5:176762550-176762572 TAGTGTTGGGGGAGGCTAGGGGG - Intergenic
1002102379 5:176863835-176863857 GAGGAGTGGGGGAGGGGAGGAGG - Intronic
1002189254 5:177470247-177470269 CCGTGGTGGGTTAGGGCAGCAGG - Intronic
1002196285 5:177503458-177503480 CAGTGGGGGCGGGGTGCAGGTGG - Intronic
1002242090 5:177849588-177849610 CAGTGGAGGGGCAGGCCAGAGGG + Intergenic
1002300054 5:178252781-178252803 CAGGCTTGGGGGAGGCCAGGAGG + Intronic
1002350328 5:178578650-178578672 CAGGGGTGGGTGGGGGAAGGCGG - Intronic
1002388276 5:178887885-178887907 CAGGGGTGGGGGGGCGCATGTGG - Intronic
1002454908 5:179340325-179340347 CACTGGTGGGGGACTGCAGCTGG - Intronic
1002466826 5:179412392-179412414 CGGTGGTGGGGGAGGGAGGAAGG - Intergenic
1002466927 5:179412622-179412644 CGGTGGTGGGGGAGGGAGGAAGG - Intergenic
1002467093 5:179413008-179413030 CCGTGCTGGGGGAGGGCGGAAGG - Intergenic
1002470886 5:179435440-179435462 CAGGGATGGGGCAGGGCAAGGGG + Intergenic
1002606386 5:180385309-180385331 AGGCGGTGGGGAAGGGCAGGTGG + Intergenic
1002641780 5:180633863-180633885 CAGTCATGGGGCTGGGCAGGTGG - Intronic
1002869204 6:1150706-1150728 GAGTGCTTGGGGAGGGCAGAGGG - Intergenic
1002887503 6:1310382-1310404 CTGGGGTTGGGCAGGGCAGGAGG - Intergenic
1002922736 6:1584604-1584626 TAGTTTTGTGGGAGGGCAGGTGG - Intergenic
1002927312 6:1611798-1611820 CGGCGGCGGGGGAGGCCAGGAGG + Exonic
1002930531 6:1631497-1631519 CAGTGGTGGTGGGGCGGAGGGGG - Intronic
1003127175 6:3364578-3364600 CAGAGGTGAGGGAGGGCATTGGG + Intronic
1003487905 6:6595510-6595532 CTGGGGTGGGGTGGGGCAGGAGG - Intronic
1003516531 6:6823230-6823252 CAGGGGTGGTGGCTGGCAGGTGG - Intergenic
1003873600 6:10419359-10419381 CAGGGGTGGAGTAGGGGAGGGGG - Intronic
1003964859 6:11243110-11243132 CAGTGTTGGGGAAGGAGAGGTGG - Intronic
1004062274 6:12209155-12209177 GAGTGCTGGGGGATGGTAGGAGG - Intergenic
1004134758 6:12956031-12956053 CAATAGTGGAGGAAGGCAGGAGG + Intronic
1004510050 6:16277884-16277906 CAGTGGGGAGGGAGGGGAGCAGG + Intronic
1004819173 6:19348103-19348125 CACTGGGGGTGGAGGGGAGGTGG - Intergenic
1005018076 6:21392680-21392702 GAGTGGTGGGGGAAGGGAAGGGG - Intergenic
1005040300 6:21595014-21595036 CAGTGGCGGGGGCGGCCATGGGG + Exonic
1005282755 6:24291914-24291936 CAATGGGGTGAGAGGGCAGGAGG + Intronic
1005436964 6:25822961-25822983 CAGTGGTGGGGGAGGGCAGGAGG - Intronic
1005593044 6:27348486-27348508 CAGTGGTGGTGGTGGTCAGCTGG - Intergenic
1006174554 6:32114152-32114174 CAGTAATGGGTGAGGGCAGTGGG + Intronic
1006262016 6:32882620-32882642 AAGTGATGGGGGTGGGAAGGAGG + Intergenic
1006436221 6:34027402-34027424 TTGTGGTGGGGGAGGGCACCAGG - Intronic
1006470751 6:34227373-34227395 CACTGGTGGGAGAGCGGAGGAGG - Intergenic
1006505402 6:34485860-34485882 CAGTGGCTGGGGAGGGCCAGAGG + Intronic
1006509159 6:34512425-34512447 CAGGGCTGGGGGCCGGCAGGTGG + Intronic
1006648861 6:35534778-35534800 CAGTGGCAGGGGAGGGAGGGAGG - Intergenic
1006812507 6:36829116-36829138 CAGTGGTGGGCAAGGGTAGTAGG - Intronic
1006836030 6:36999279-36999301 AGGGGGTGGGGGTGGGCAGGAGG + Intergenic
1006901885 6:37507878-37507900 TGGTGGTGGGTGAGGGTAGGTGG + Intergenic
1006906234 6:37535664-37535686 TAGAGCTGGGGGAGGGGAGGCGG + Intergenic
1007036796 6:38681736-38681758 AAGTGGTGGGGTCGGGCAGTGGG + Intronic
1007177923 6:39909219-39909241 CAGGGGAGGGGGAGGGGAGAGGG + Intronic
1007384698 6:41512789-41512811 CAGGGCTGGGGGAGAGCAGAGGG - Intergenic
1007513339 6:42391554-42391576 GGGTGGTGGGTGTGGGCAGGAGG - Intronic
1007621856 6:43220354-43220376 TAGTGGAGGGGAAGGGAAGGAGG + Intronic
1007634087 6:43287604-43287626 GAGAGGTGGGGGAGGGAAAGTGG + Exonic
1007677187 6:43606302-43606324 CTGGGATGGGGGAGGGGAGGAGG - Intronic
1007689217 6:43687842-43687864 CAGTGGTGGGGCAGGAACGGCGG + Intergenic
1007742552 6:44021749-44021771 TGGTGCTGGGGGAGGGAAGGGGG - Intergenic
1007743123 6:44024968-44024990 TGGTGCTGGGGGAGGGAAGGGGG - Intergenic
1007760979 6:44133646-44133668 GAGTGGATGGGGTGGGCAGGAGG - Intronic
1007904931 6:45450278-45450300 CAGTGGTGGGACAGGGTTGGGGG - Intronic
1008125476 6:47663623-47663645 CAGTGTAAGGGGAGAGCAGGAGG + Intronic
1008548562 6:52605280-52605302 CAGGGGCAGGGGAGGGTAGGAGG + Intergenic
1008823715 6:55665567-55665589 CAGTTGTGGGGTGGGGAAGGAGG - Intergenic
1008864709 6:56195436-56195458 ATGTGGTGGGGGAGGGAAAGAGG + Intronic
1008966908 6:57322043-57322065 CAGTGGTTGGAGAAGGAAGGTGG + Intronic
1010042209 6:71398059-71398081 CAGTGTTGGGGGACAGCAGTAGG + Intergenic
1011180959 6:84620186-84620208 AAGTGATGGGGGAGGGGATGGGG - Intergenic
1011232475 6:85178487-85178509 GAGGGGTGGGGGAGGGATGGAGG - Intergenic
1011545011 6:88473607-88473629 CTTTTGTGGGGGTGGGCAGGAGG - Intergenic
1011625209 6:89277852-89277874 CAGTGGTGGGCGGGGGTGGGGGG + Intronic
1011643043 6:89433121-89433143 CAGGGGTGGGGCGGGGCCGGCGG + Intergenic
1011930121 6:92701088-92701110 CACTGCTGGCAGAGGGCAGGAGG + Intergenic
1011959558 6:93070243-93070265 CAGTGGTGGGGAAGGGGAAAGGG + Intergenic
1012100795 6:95083846-95083868 GAGTGCGGGGGGAGGGGAGGAGG + Intergenic
1012425095 6:99105278-99105300 TAATGGAGGGGGAGGGAAGGAGG + Intergenic
1012481359 6:99670946-99670968 CAGTCGTGGGGTGGGGGAGGAGG - Intergenic
1013451929 6:110290346-110290368 CAGTGGTTGCCTAGGGCAGGTGG - Intronic
1013492984 6:110668236-110668258 CAGGGGTGGGGTAGGGATGGAGG - Intronic
1013603893 6:111730563-111730585 AATTGGTGGGAGAGGGAAGGGGG + Intronic
1013623074 6:111909222-111909244 CAGAGGTGCAGGAGGGCAGAAGG - Intergenic
1013638246 6:112048941-112048963 CAGTGGTGTGGGTGGGTGGGTGG - Intergenic
1014769458 6:125444787-125444809 CAGGGGTGGGGGTGGGGAGACGG - Intergenic
1015113456 6:129619494-129619516 CAGTGAAGGGGAAGGGAAGGGGG + Intronic
1015197269 6:130537275-130537297 CTCTGGTGGGGGATGGCTGGAGG - Intergenic
1016351957 6:143177974-143177996 CAGTGGTGGGCCTGGTCAGGCGG + Intronic
1016575404 6:145564767-145564789 ATATGGTGGGGGGGGGCAGGGGG + Intronic
1016887516 6:148971713-148971735 CAGTGATGTGGGCAGGCAGGTGG + Intronic
1017748369 6:157467315-157467337 GGGTGGTGGGGTAGGACAGGGGG - Intronic
1018235606 6:161720510-161720532 CACAGGTGGGGGGGGGCAGGTGG + Intronic
1018347841 6:162921297-162921319 AGGTGGTGGGGCAGGGCAGTAGG + Intronic
1018461667 6:164004694-164004716 AAGGGGAGGGGGAGGGAAGGGGG + Intergenic
1018509461 6:164509847-164509869 TTGTGGTGGGGGAAGGAAGGTGG + Intergenic
1018607547 6:165613969-165613991 CAGTTTTGGGTGTGGGCAGGTGG - Intronic
1018710776 6:166496958-166496980 GAGTGGTGGGTGAGGGCAGCGGG - Intronic
1018735064 6:166681680-166681702 CGGGGGGGGGGGCGGGCAGGGGG - Intronic
1019278885 7:190542-190564 CAGTGGCGGGGCAGGGAGGGGGG + Intergenic
1019417242 7:933470-933492 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417253 7:933500-933522 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417269 7:933537-933559 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417300 7:933627-933649 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417311 7:933657-933679 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417322 7:933687-933709 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417353 7:933777-933799 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417394 7:933897-933919 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417415 7:933957-933979 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417426 7:933987-934009 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417465 7:934107-934129 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417486 7:934167-934189 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417497 7:934197-934219 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019519520 7:1454448-1454470 GAGAGGAGGGGGTGGGCAGGGGG + Intronic
1019563058 7:1667391-1667413 CGGGGGTTGTGGAGGGCAGGGGG + Intergenic
1019571341 7:1713879-1713901 GAGAGGTGGGGGAGGGGAGCCGG - Intronic
1019666039 7:2252753-2252775 CAGGGGTGAGGGGGAGCAGGAGG - Exonic
1019776586 7:2915203-2915225 GAGTGGTGGGAGGGGCCAGGCGG + Intronic
1019798714 7:3072000-3072022 CAGTGGGTTGGGAGGGTAGGTGG + Intergenic
1019948959 7:4355400-4355422 CAGTGGTGGGGTCTGGTAGGAGG + Intergenic
1019960975 7:4459136-4459158 AAGGGGTGGGGGAGGGAGGGAGG + Intergenic
1020009241 7:4799497-4799519 CAGAGGTGGGGGTGGGCAGGAGG + Intronic
1020282362 7:6656070-6656092 CAGGGCTGGGGGCGGGTAGGAGG + Exonic
1020309875 7:6859515-6859537 CTGGGGGGGGGCAGGGCAGGTGG - Intergenic
1020440140 7:8208783-8208805 CAGTGTTGGGTGGGGGTAGGGGG + Intronic
1020705978 7:11544804-11544826 GAGTGGTGGGGGTGGGGAGGCGG - Intronic
1021180266 7:17497777-17497799 CAGTCATGGGGTGGGGCAGGTGG + Intergenic
1021451368 7:20785814-20785836 AAGGAGTGGGGGAGGGGAGGTGG + Intronic
1021768124 7:23969690-23969712 GAGTGTGGGGGAAGGGCAGGGGG + Intergenic
1021998468 7:26202097-26202119 CGCGGGTGGGGGAGGGGAGGGGG - Intronic
1022599396 7:31742687-31742709 TAGTTGAGGGGGAGGACAGGTGG + Intergenic
1022898515 7:34777439-34777461 CATTGGTGGGGGATGGGAGAGGG + Intronic
1023340507 7:39214332-39214354 GAGTGCTGGGGCAGGGGAGGAGG - Intronic
1023682632 7:42703224-42703246 AAGTGGTGGAGGAAGGAAGGAGG + Intergenic
1023698291 7:42869812-42869834 AAGAAGTGGGGGAGGGCAGATGG - Intergenic
1023723474 7:43118762-43118784 CAATGCTGGGGGTAGGCAGGGGG - Intronic
1023738335 7:43254614-43254636 CAATGGTGGGGGAGGCAAGGGGG - Intronic
1023833537 7:44054789-44054811 CAGGGGTTGGGAAGGGCATGGGG - Intronic
1023860577 7:44215758-44215780 CAGGTGTGTGGGTGGGCAGGTGG - Intergenic
1023998532 7:45176690-45176712 CAGAGGTTGGGAAGGGCAGTGGG + Intronic
1024601836 7:50988823-50988845 CAGTGGTGGTGGTGGGGTGGGGG + Intergenic
1024814517 7:53253259-53253281 CACTGATGTGGGAGGGCAGAAGG + Intergenic
1024948120 7:54832831-54832853 AAGTGGTGGGGCAGGGAATGGGG - Intergenic
1025099511 7:56123270-56123292 CAGAGGAGAGGCAGGGCAGGAGG + Intergenic
1025106483 7:56175216-56175238 CGGGGGTGGGGGGGGGCGGGGGG + Intergenic
1025233010 7:57215408-57215430 AAGTGGTGGGGGCAGGCAGGGGG + Intergenic
1025258159 7:57399307-57399329 GAGAGGAGGGGGAGGGCTGGGGG + Intergenic
1025277337 7:57594880-57594902 GAGGGATGGGGAAGGGCAGGGGG + Intergenic
1025814068 7:64893688-64893710 GAGGGGAGGGGGAGGGGAGGGGG - Intronic
1025932936 7:66010882-66010904 CAGAGGTGGGGATGGGCAGTGGG + Intergenic
1026038759 7:66848032-66848054 GGGGGGTGGGGGAGGGGAGGGGG + Intergenic
1026285022 7:68955279-68955301 GAGGGGAGGGGGAGGGCGGGAGG + Intergenic
1026675256 7:72423396-72423418 CAGCAGAGGGGCAGGGCAGGAGG + Intronic
1026828302 7:73597116-73597138 CAGGGGGTGGGGAGGACAGGGGG - Intronic
1026848960 7:73713039-73713061 CAGTGGTTGGGAAGGGCTTGGGG - Intronic
1027138216 7:75639243-75639265 AAGGGGAGGGGGAGGGGAGGCGG + Intronic
1027212612 7:76163525-76163547 GGGGGGTGGGGGAGGGGAGGGGG - Intergenic
1027224990 7:76238072-76238094 CTGAGGATGGGGAGGGCAGGGGG - Intronic
1027374383 7:77536657-77536679 CAGGAGTGGGGGCGGGCGGGAGG - Intergenic
1027443893 7:78249691-78249713 CAGTGGCTGGGGAGGGTAGTGGG + Intronic
1028030458 7:85905613-85905635 CAGTGGTGGGAGGTGGCAGAGGG - Intergenic
1028160978 7:87484145-87484167 CTGTGGTGGTGAAGGCCAGGGGG + Intergenic
1028347278 7:89798429-89798451 CAGTGGTAGAGGGTGGCAGGTGG + Intergenic
1028413753 7:90558339-90558361 GAGTGATGGGGTAGGGAAGGGGG + Intronic
1028905316 7:96147844-96147866 TGGTGGTAGGGGATGGCAGGGGG - Intronic
1029071691 7:97904638-97904660 CTGTGGTGGGGGAGGGGATGTGG - Intergenic
1029481726 7:100817421-100817443 GAGTGGAGGGCGAGGGAAGGAGG - Intronic
1029729959 7:102433025-102433047 CAGTGGAGGGGAAAGGAAGGTGG - Intergenic
1029813139 7:103069140-103069162 CAGTGGGGCGGCAGGGCAGAGGG - Intronic
1029868568 7:103663151-103663173 GAGTGGTGGGGCTGGGTAGGAGG - Intronic
1030121201 7:106112281-106112303 CGGTGGCGAGGAAGGGCAGGCGG + Intronic
1030331866 7:108279625-108279647 GGGTGGGTGGGGAGGGCAGGGGG - Intronic
1031311692 7:120207128-120207150 CAGTGGTCGGGGAGGGTGGCAGG - Intergenic
1031907220 7:127474101-127474123 CAGAGGTTGGGAAGGGTAGGGGG - Intergenic
1031955016 7:127934166-127934188 CTGTGTTGGGGGAGGGGAGTAGG + Intronic
1031958116 7:127963400-127963422 CTGTGGTGGCGGCGGGGAGGGGG - Intronic
1031995777 7:128229906-128229928 CACTGGCAGGGGAGGGAAGGAGG + Intergenic
1032167643 7:129558262-129558284 CCGGGGTGGGGGCGGGGAGGCGG - Intergenic
1032641562 7:133774894-133774916 AAGTGGTGGGGGAGGGGCGGGGG - Intronic
1032695758 7:134334843-134334865 AAGGGGTGGGGATGGGCAGGGGG - Intergenic
1032999957 7:137492950-137492972 CAGTGGTGGGAGGGTGCGGGTGG - Intronic
1033157939 7:138972358-138972380 GAGAGGTGGGGGAGGGCGGGAGG - Intronic
1033358447 7:140620343-140620365 AAGGGGTGGGGGGGGGGAGGAGG + Intronic
1033444734 7:141410447-141410469 CAGAGGTGGGGGAGGGAGGGAGG - Intronic
1033732244 7:144191339-144191361 CAGTGGGGGGGGGGGGGATGGGG - Intronic
1033943272 7:146681579-146681601 GGGTGGTGGGGGATGGGAGGGGG + Intronic
1034087320 7:148331889-148331911 AAGTTGTGTGAGAGGGCAGGAGG + Intronic
1034263762 7:149772145-149772167 CCGGGGTGGGGGAGGAGAGGAGG - Intronic
1034271321 7:149804600-149804622 GAGGAGTGGGGGAGGGGAGGGGG + Intergenic
1034398846 7:150848181-150848203 CTGTGCTGAGGAAGGGCAGGTGG - Intronic
1034422069 7:150995646-150995668 CAGGGGTGGGAGAGGGAAGAGGG - Intronic
1034422278 7:150996170-150996192 CAGGGGTGGGAGAGGGGAGAGGG - Intronic
1034422439 7:150996664-150996686 AAGTGCTGGGGGAGGGCGGGAGG - Intronic
1034503443 7:151467292-151467314 CAGTAGGAGGGCAGGGCAGGCGG - Intronic
1034662613 7:152785377-152785399 GAGGGGGGGGGGAGGGGAGGGGG + Intronic
1034942164 7:155237603-155237625 GAGGGGTGGGGAAGGCCAGGAGG + Intergenic
1035080915 7:156215359-156215381 CTGGGGTGGCTGAGGGCAGGAGG - Intergenic
1035167602 7:157000594-157000616 GCGGGGTGGGGGAGGGAAGGGGG + Intronic
1035282676 7:157787472-157787494 CAGTGGGCAGGGCGGGCAGGGGG + Intronic
1035450615 7:158974616-158974638 CAGAGATGGGGGAGGCCAGGCGG + Intergenic
1035554176 8:553276-553298 CAGTGGTGGGCCAGGGGAGTGGG + Intergenic
1035568318 8:656493-656515 CACAGGTGGGGAAGGTCAGGAGG - Intronic
1035759974 8:2061965-2061987 CAGCTGTGGGTGAGGGGAGGGGG + Intronic
1035945309 8:3955164-3955186 CACGGGTGGTGGAGGACAGGAGG - Intronic
1036246015 8:7117358-7117380 CTGTGGTGGGGGAGGGGATGTGG + Intergenic
1036561748 8:9904671-9904693 GAGAGGTGGAGGAGGGCATGGGG - Intergenic
1036888255 8:12576670-12576692 CTGTGGTGGGGGAGGGGATGTGG - Intergenic
1037293088 8:17372015-17372037 CAGAGGAGGGGGAGGGAATGAGG - Intronic
1037767538 8:21781348-21781370 GAGTGGTGGTGGGTGGCAGGTGG - Intronic
1037772414 8:21810349-21810371 CAGTGAGGGGGGTGGGCAGAGGG - Intronic
1037833151 8:22200979-22201001 GGGTGGGGCGGGAGGGCAGGCGG - Intronic
1037976657 8:23218771-23218793 CAGTAGAGGGGCTGGGCAGGAGG - Intronic
1038268249 8:26052237-26052259 CAGTGGTGGCGGGGGGAGGGGGG + Intergenic
1038395635 8:27243649-27243671 CCATGTTGGGTGAGGGCAGGGGG + Intronic
1038529456 8:28306140-28306162 GAGTGGGGGCAGAGGGCAGGTGG - Intergenic
1038579482 8:28735199-28735221 TAGTGGTGGGGGTGGGCGGTAGG + Intronic
1038598384 8:28911801-28911823 CAGGGTTGGGGGAGGGCAGAGGG + Intronic
1039043476 8:33429571-33429593 CAATTGAGGGGGAGGGCAGATGG + Intronic
1039442003 8:37601591-37601613 CAGTGGTGGGACGGGGCAGGAGG - Intergenic
1039476780 8:37842953-37842975 CAGTCCTGGGGGAGGGGAGTGGG + Exonic
1039476817 8:37843123-37843145 GAGTAGAGGGAGAGGGCAGGTGG + Exonic
1039546440 8:38414329-38414351 TTGTGCTGGGGGAGGGGAGGCGG - Intronic
1039636330 8:39170846-39170868 CAGAGGTTGGGAAGGGTAGGGGG + Intronic
1039884227 8:41646278-41646300 CAGGGGAGGAGGAGGGGAGGCGG - Exonic
1039912475 8:41835946-41835968 CAGGGAGGGGAGAGGGCAGGGGG + Intronic
1039969206 8:42307196-42307218 TGGAGGTGGGGGACGGCAGGGGG + Intronic
1039977677 8:42381191-42381213 GAGTGGGGAGGGAGGGGAGGAGG + Intergenic
1040302912 8:46197214-46197236 CAGTGGAGTGGGCGGGCAGCAGG + Intergenic
1040331881 8:46389808-46389830 AAGTGGCGTGGGAGGGCAGCAGG + Intergenic
1040336595 8:46419188-46419210 GAGTGGAGTGGGAGGGCAGCAGG + Intergenic
1040414555 8:47184558-47184580 GAGTGCTGGGGGAGGGGAAGAGG - Intergenic
1040484020 8:47853411-47853433 GAGTGATTGGGCAGGGCAGGCGG + Intronic
1041083236 8:54233570-54233592 CAGGGGTGGGGGTGGGGAGTGGG - Intergenic
1041244844 8:55880124-55880146 CAGGGGTGGGCGCGGGCACGCGG + Intronic
1041249514 8:55920767-55920789 GGGTGGTGGGGAAGGGCAAGGGG - Intronic
1041466918 8:58166269-58166291 CAGTGGAGGTGGGTGGCAGGAGG + Intronic
1041537161 8:58939468-58939490 GAGTGGTCTGGGAGGGAAGGAGG + Exonic
1042177829 8:66054872-66054894 CTGTGCTGGGGTAGGGGAGGTGG + Intronic
1042202934 8:66299376-66299398 CAGAGGTGGGAAAGGACAGGAGG + Intergenic
1042247203 8:66720052-66720074 CAGGGCTGGGGCATGGCAGGTGG - Intronic
1042591531 8:70402876-70402898 CCGTGGTGGGGGCGGGGAGCCGG - Intronic
1042851960 8:73225790-73225812 TGGTGGTGGTGGAGGGCTGGGGG - Intergenic
1042960826 8:74301967-74301989 CAGTGGAGGGGAAGGGCTTGGGG + Intronic
1043511605 8:80955521-80955543 CTGTTGTGGGGTAGGGGAGGGGG + Intergenic
1043829402 8:84969935-84969957 AAAAGGTGGGGGAGGGGAGGAGG + Intergenic
1044058734 8:87605721-87605743 AAGGTGGGGGGGAGGGCAGGGGG + Intronic
1044295646 8:90523976-90523998 GAGAGGTGGGTGGGGGCAGGTGG + Intergenic
1044932048 8:97260180-97260202 GAGGGGAGGGGGAGGGGAGGGGG + Intergenic
1045085091 8:98673595-98673617 GAGGGGTGGGGAGGGGCAGGTGG + Intronic
1045149464 8:99387634-99387656 CCATGGTGGGGTGGGGCAGGGGG - Intronic
1045220574 8:100195230-100195252 CAGTGGCGGGGCAGTGGAGGGGG + Intronic
1045267872 8:100635681-100635703 GCGTGGTGGGGGAGGGAAAGAGG + Intronic
1045337459 8:101221045-101221067 CAGAGGTGGGAAATGGCAGGAGG + Intergenic
1045701493 8:104871637-104871659 ATGAGGTGGGGGTGGGCAGGGGG + Intronic
1045947797 8:107816454-107816476 CTGTTGTGGGGTAGGGGAGGGGG - Intergenic
1046669654 8:117043731-117043753 TGGTGGTGGGGCAAGGCAGGTGG - Intronic
1046936052 8:119887117-119887139 GAGGGGGGGGGGAGGGGAGGGGG - Intronic
1046967808 8:120186666-120186688 CGGTAGTGTGGCAGGGCAGGAGG + Intronic
1047299353 8:123599526-123599548 CAGTGGGGGGTGGGGGCTGGTGG + Intergenic
1047338112 8:123955276-123955298 CAGTGGGTGGGGAGAGAAGGAGG + Intronic
1047499724 8:125431604-125431626 CATTGGCGGGGGAGGGGGGGTGG - Intronic
1047543866 8:125796989-125797011 CAGTGCATGTGGAGGGCAGGAGG + Intergenic
1047637244 8:126777671-126777693 CTGTGGTGGGGTGGGGGAGGGGG + Intergenic
1047676183 8:127205761-127205783 CAGTGGCGGGCGGGGGCCGGGGG + Intergenic
1047695107 8:127395632-127395654 CAGTGGTGGAGGAGGTTAAGGGG - Intergenic
1047998539 8:130358443-130358465 CAGCGGCGGGGGAGGGGACGCGG + Intronic
1047999095 8:130362229-130362251 CAGAGGTGGGGGAGTGTGGGTGG + Intronic
1048216393 8:132499551-132499573 CAGCTCTGGGGGAGGACAGGAGG - Intergenic
1048260099 8:132937988-132938010 GAGTGGAGGAGGAGGGGAGGAGG + Intronic
1048334141 8:133490585-133490607 CACTGATGGAGGAGGGCAGAGGG + Intronic
1048522723 8:135171504-135171526 CACTGGTGAGAGAGGACAGGAGG + Intergenic
1049060497 8:140272724-140272746 CAGTGAGGGGAGAGGGGAGGAGG + Intronic
1049105299 8:140608941-140608963 CAGTGGGTGGGGAGGGCCTGTGG - Intronic
1049150989 8:141035446-141035468 CAGTGGGGAGCGAGGGCAGGAGG - Intergenic
1049217759 8:141415658-141415680 CAGGGGTGGTGAAGGGTAGGGGG + Intronic
1049292221 8:141810255-141810277 CAGTGGTGGTGGAGGCAAGGCGG + Intergenic
1049378534 8:142300938-142300960 CAGAGGGGAGGGTGGGCAGGAGG + Intronic
1049453662 8:142676147-142676169 CAGTGGGGTGGGTGGGCAGAAGG + Intronic
1049466861 8:142755342-142755364 CTCTGGTGGGGTAGGGCAGCAGG + Intergenic
1049511067 8:143026882-143026904 GTGTGATGGGGGTGGGCAGGGGG - Intergenic
1049527666 8:143136532-143136554 CAGTGCAGGGGCCGGGCAGGCGG - Intergenic
1049671931 8:143873775-143873797 CTGGGGTGGGGCAGGGCATGGGG - Intronic
1049704566 8:144035189-144035211 AGTTGATGGGGGAGGGCAGGCGG - Intronic
1049746335 8:144264853-144264875 GAGGGGTGGGGCAGGGCTGGCGG - Intronic
1049756178 8:144312191-144312213 CAGGGGTGGAGGTGGGCGGGGGG - Exonic
1049817935 8:144616635-144616657 CAGGAGGTGGGGAGGGCAGGGGG + Intergenic
1050011515 9:1189956-1189978 CTGTGGTGGGGTGGGGGAGGAGG - Intergenic
1050186351 9:2979119-2979141 CAGTGGTGGCTGAGGGATGGTGG - Intergenic
1050230990 9:3525986-3526008 GAGGGGTGGGGGAGGGAAGAGGG + Intronic
1050245479 9:3685366-3685388 CAGGGGTTGGGGATGGCAGAGGG - Intergenic
1050309656 9:4339856-4339878 GAGGGGTGGGGGAGGGGAGGGGG + Intronic
1050513052 9:6413983-6414005 CAGAGGGCGGGGAGGGCAGAGGG + Intronic
1051764236 9:20504572-20504594 TGGTGGTGGGTGGGGGCAGGTGG + Intronic
1052580568 9:30349415-30349437 GGGCGGTGGGGGAGGGGAGGAGG + Intergenic
1052857754 9:33417632-33417654 CAGAGGTGAGAGAGGGCAGGAGG - Intergenic
1052879375 9:33591384-33591406 CAGTGGTGGGGTGGGGGAGTTGG + Intergenic
1052967593 9:34352481-34352503 CAGTGGGGGGGGCGGGGTGGGGG + Intergenic
1052990164 9:34514373-34514395 CACTGGTCGGGGAGGGAACGGGG - Exonic
1053072580 9:35110033-35110055 CAGAGGTGGGGGTGGGGAGCAGG + Exonic
1053120830 9:35546603-35546625 CAGTGCTGTGGAGGGGCAGGTGG + Exonic
1053551063 9:39079876-39079898 CGGTGGTGTGGGAGGGAGGGTGG - Intronic
1053792510 9:41696851-41696873 GAGTTGTGGGGGAGGGTGGGTGG - Intergenic
1053815173 9:41899957-41899979 CGGTGGTGTGGGAGGGAGGGTGG - Intronic
1054152661 9:61617969-61617991 GAGTTGTGGGGGAGGGTGGGTGG + Intergenic
1054180923 9:61908872-61908894 GAGTTGTGGGGGAGGGTGGGTGG - Intergenic
1054449908 9:65398206-65398228 CCGGGCTGGGGGAGGGGAGGCGG + Intergenic
1054615423 9:67287484-67287506 CGGTGGTGTGGGAGGGAGGGTGG + Intergenic
1054656668 9:67672270-67672292 GAGTTGTGGGGGAGGGTGGGTGG + Intergenic
1054850639 9:69843441-69843463 GAGGGGAGGGGGAGGGGAGGGGG - Intronic
1055656281 9:78453057-78453079 CAGTGCCAGGGCAGGGCAGGGGG + Intergenic
1055775116 9:79759559-79759581 CAGGGTTGGGGCAGGGAAGGAGG + Intergenic
1055965217 9:81859332-81859354 AAGTGGGGAGGGAGGGGAGGGGG + Intergenic
1056198503 9:84251784-84251806 CAGGGAAGGGGGAGGGCAGGAGG - Intergenic
1056368404 9:85929491-85929513 AAGTGGTGGGGGGTGGGAGGCGG - Intergenic
1056455004 9:86751618-86751640 CAGTGGTGGCGGTGGGATGGTGG - Intergenic
1056612599 9:88134540-88134562 CATCTGTGGGGGAGCGCAGGAGG - Intergenic
1056613095 9:88138030-88138052 CATCTGTGGGGGAGCGCAGGAGG - Intergenic
1056766557 9:89447774-89447796 AAGTGGTGGTGGGGGGCAGTGGG - Intronic
1056897751 9:90566691-90566713 AAGAGGTGAGGGAAGGCAGGAGG - Intergenic
1057028997 9:91759208-91759230 GAGAGGTGGGGGAAGCCAGGCGG + Intronic
1057054101 9:91948835-91948857 CGGGGGTGGAGGAGGGCGGGCGG - Intronic
1057090978 9:92257927-92257949 CAGTTGTGGGGCATGGAAGGTGG + Intronic
1057313873 9:93956996-93957018 GAGTGGGGGTGGGGGGCAGGTGG + Intergenic
1057407224 9:94783596-94783618 CAGTGGAGAAGGAGGCCAGGAGG + Intronic
1057448355 9:95134845-95134867 CAGGGGAGGGTGAAGGCAGGTGG + Intronic
1057481639 9:95449278-95449300 CAGGGGAGGGTGTGGGCAGGCGG + Exonic
1057716661 9:97501541-97501563 GAGTGGAGGGGGGGGGAAGGAGG + Intronic
1057744599 9:97741296-97741318 CAGGGGCGGAGGAGGGCGGGGGG - Intergenic
1058310099 9:103490152-103490174 GTGGGGTGGGGGAAGGCAGGAGG - Intergenic
1058664307 9:107296249-107296271 AGGTGGTGGGGGAAGGCACGGGG - Intronic
1058704591 9:107627927-107627949 CCCTGCTGAGGGAGGGCAGGAGG + Intergenic
1059199582 9:112401712-112401734 GTGGGGTGGGGGAGGGAAGGAGG + Intronic
1059304978 9:113346945-113346967 AAGAGGTTGTGGAGGGCAGGGGG - Intergenic
1059756873 9:117302082-117302104 AAGTGGTGGGGGTGGGAGGGGGG + Intronic
1060124050 9:121024318-121024340 GAGGGGAGGGGGAGGGGAGGGGG + Intronic
1060139934 9:121201387-121201409 CGCCGGTTGGGGAGGGCAGGAGG + Intronic
1060217491 9:121747017-121747039 GAGAGATGGGGGAGGGCAGTGGG + Intronic
1060284434 9:122236439-122236461 AAGTGGTGGGGGTGGGCAGAAGG + Intergenic
1060512125 9:124241769-124241791 CTCTGGTGGGGGGGGGCAGCTGG + Intergenic
1060747605 9:126148011-126148033 CCTTGGTGGGGGGTGGCAGGGGG + Intergenic
1060868133 9:127016098-127016120 CAGTGGGGTGGCAGGGAAGGAGG - Intronic
1060980180 9:127786955-127786977 CAGTTATGGGTGAGGCCAGGAGG + Intronic
1061107325 9:128541540-128541562 CAGGGGTGAGGGTGGGTAGGTGG - Exonic
1061181132 9:129025978-129026000 TGGGGGTGGGAGAGGGCAGGAGG - Intronic
1061289885 9:129644666-129644688 GAGGGGTGGGGGTGGGCAGCTGG + Intergenic
1061396398 9:130346152-130346174 CAGCGCTGGCGGAGGTCAGGGGG + Intronic
1061637323 9:131920776-131920798 TAGTGGTGGGGGAGAGGGGGTGG + Intronic
1061798744 9:133103070-133103092 CACTGGAGGGTGAGGGTAGGAGG - Intronic
1061864470 9:133485270-133485292 CCGTGCAGGGGGAGGGCAGCTGG + Intergenic
1061893190 9:133633459-133633481 CTGAGGAGGGTGAGGGCAGGAGG + Intergenic
1061941600 9:133887024-133887046 CACTGCTGAGGGAGAGCAGGAGG - Intronic
1062178869 9:135179968-135179990 CAGTGCTGGGATGGGGCAGGTGG - Intergenic
1062362757 9:136195450-136195472 CAGTGGACGGGGAGGGAAGGTGG - Intergenic
1062403246 9:136381616-136381638 GAGTGGTGGGGTAGGGAGGGAGG + Intronic
1062520259 9:136954674-136954696 CAGGGATGGGTGAGGGGAGGAGG - Intronic
1062560537 9:137139741-137139763 CGGAGGTGGGGGAGGGCACCTGG - Exonic
1062614649 9:137390882-137390904 CAGTGGACGCTGAGGGCAGGGGG + Intronic
1185502493 X:608448-608470 GAGGGGAGGGGGAGGGGAGGGGG - Intergenic
1185502500 X:608459-608481 GAGGGGAGGGGGAGGGGAGGGGG - Intergenic
1185506994 X:638980-639002 TGGTGGTGGGGGAGAGGAGGGGG + Intronic
1185581369 X:1213240-1213262 GAGGGGAGGGGGAGGGGAGGTGG - Intergenic
1185713019 X:2319232-2319254 GAGAGGAGGGGGAGGGGAGGAGG - Intronic
1186250450 X:7660331-7660353 CAGTGGTGGGAGAGGGAGGGTGG + Intergenic
1186356880 X:8799776-8799798 GAGGGGTGGGGCAGGGGAGGGGG - Intronic
1186357206 X:8800891-8800913 TAGGGGTGGGGCAGGGGAGGGGG - Intronic
1186410605 X:9342293-9342315 CGGGGGAGGGGGAGGGGAGGTGG - Intergenic
1186669957 X:11758196-11758218 GCGCGGTGGGGGAGGGCGGGCGG - Exonic
1186688115 X:11946803-11946825 CACTGATGGCTGAGGGCAGGAGG - Intergenic
1186947225 X:14582213-14582235 CTGTTGTGGGGGTGGGGAGGGGG - Intronic
1187179670 X:16932016-16932038 CAGTGGTGGGGGAGGACAGCAGG + Intergenic
1187490222 X:19744414-19744436 GACTGGTGGGGGAGGGCCAGAGG + Intronic
1187754065 X:22500590-22500612 GTGTGGGGGGGGAGGGCATGTGG + Intergenic
1188009216 X:25039710-25039732 CACTGGTGGGGCGGGGAAGGGGG - Intergenic
1188194023 X:27208437-27208459 CTGTTGTGGGGGGGGGGAGGGGG + Intergenic
1188304096 X:28541265-28541287 GAGTGGTGGTGGAGGGGAGGTGG + Intergenic
1188640936 X:32503805-32503827 CAGTGCTGGGGTGGGGCGGGGGG + Intronic
1189893545 X:45630355-45630377 CTCTGGTGGGGTAGAGCAGGGGG + Intergenic
1190047342 X:47123272-47123294 CAGTGATTGTGGAGGGCAGGGGG + Intergenic
1190150460 X:47943015-47943037 AAGCTGTGGGGGAGGACAGGAGG + Intronic
1190304876 X:49076233-49076255 CAGGGGTGGGGCAGGTCCGGAGG + Intronic
1190437040 X:50435814-50435836 CAGTGGTAGGTGAGAGCAGGAGG + Intronic
1190515189 X:51216513-51216535 CAGAGCTTAGGGAGGGCAGGGGG - Intergenic
1190691806 X:52918831-52918853 CAGGGGTCGGGGAGAGCATGAGG - Intergenic
1190694177 X:52936961-52936983 CAGGGGTCGGGGAGAGCATGAGG + Intronic
1190744327 X:53312543-53312565 CTGTGCTGTGGGAGGACAGGAGG - Intronic
1191061739 X:56305213-56305235 GAGTGGTGAGAGAGGGCAAGAGG + Intergenic
1191136993 X:57075603-57075625 CAGTGGTTGGGGATAGGAGGAGG - Intergenic
1191675055 X:63784900-63784922 AAGTGGAGGGGGATGGTAGGGGG + Intronic
1192050390 X:67719132-67719154 CAGGGTTGGGAGAGGGCAGCTGG - Intronic
1192244557 X:69361788-69361810 CAGGGGTGGGAGATGGGAGGAGG + Intergenic
1192293498 X:69822843-69822865 CAGTTGTGGGGTGGGGGAGGGGG - Intronic
1192338361 X:70240389-70240411 ATGTGGTAGGGGAGGGCATGAGG + Exonic
1192629804 X:72768587-72768609 CAATGGTGAGGGCTGGCAGGGGG - Intergenic
1192637437 X:72832638-72832660 TGGGGGTTGGGGAGGGCAGGAGG + Intronic
1192651906 X:72952217-72952239 CAATGGTGAGGGCTGGCAGGGGG + Intergenic
1192657015 X:73003131-73003153 GAGAGGCGGGGGAGGGCGGGAGG - Intergenic
1192665105 X:73079870-73079892 GAGAGGCGGGGGAGGGCGGGAGG + Intergenic
1192962511 X:76145366-76145388 GGGTGCTGGGGGAGGGCTGGCGG + Intergenic
1192963022 X:76149721-76149743 GGGTGCTGGGGGAGGGCTGGCGG - Intergenic
1193056727 X:77160082-77160104 CAGTGATGGGAGAGAGCAGATGG - Intergenic
1193196637 X:78639691-78639713 CAGGTGTGGGGGTGGGGAGGTGG + Intergenic
1193642806 X:84032717-84032739 CAGTGGCTGGGAAGGGCAGTGGG - Intergenic
1194807568 X:98348074-98348096 GGGTGGTGGTGGTGGGCAGGAGG + Intergenic
1195447674 X:104972396-104972418 TAGTGGTGGGGGAGTGCAGGTGG + Intronic
1195884550 X:109625216-109625238 GCGTGGTGGGGAAGGGGAGGAGG - Intronic
1196205951 X:112939664-112939686 CAGAGGTTGGGGAGGGTAGTAGG + Intergenic
1196207210 X:112954605-112954627 AAGGAGTGAGGGAGGGCAGGAGG - Intergenic
1196650077 X:118159352-118159374 GAGGGGGGGGGGAGGGAAGGAGG + Intergenic
1196755663 X:119155298-119155320 AAATGTTGGGGGAGGGCTGGGGG - Intergenic
1197145792 X:123170882-123170904 TGGGGGAGGGGGAGGGCAGGGGG - Intergenic
1197376043 X:125682777-125682799 CAGTGGTGGTGGTGGGCACAGGG + Intergenic
1197483332 X:127014705-127014727 CAGGGGTTGGGGAGGTGAGGAGG + Intergenic
1197641684 X:128974997-128975019 CAGCAGTGGGGGAGGGGAGGTGG + Intergenic
1198257037 X:134932872-134932894 CTGGTGTGGGGGAGGGCTGGTGG - Intergenic
1198934982 X:141895712-141895734 CATTGCTGGGGGAGGGGTGGAGG + Intronic
1199708160 X:150449118-150449140 CAGTGGTTGGGCAGGGTGGGGGG + Intronic
1199728394 X:150606950-150606972 GAGGGGAGGGGGAGGGGAGGGGG - Intronic
1199729922 X:150621834-150621856 CAGTGGTAGGGGGAGGTAGGAGG - Intronic
1200049773 X:153422560-153422582 TGGTGGTGGGGCGGGGCAGGGGG - Intergenic
1200058899 X:153475287-153475309 CAGTGGAGGGGGACTGCAGAGGG - Intronic
1200112317 X:153747328-153747350 CACTGGCGGGGGAGGGGTGGGGG + Intergenic
1200137615 X:153882725-153882747 CAGGGGTTGGGTGGGGCAGGAGG - Intronic
1200139109 X:153889096-153889118 CAGTGGTGGCCAAGGGCAGGGGG - Intronic
1200316808 X:155142014-155142036 GAGTGGAGGGAGAGGGGAGGAGG + Intronic
1200328870 X:155273307-155273329 CAGAAGTGGGGGAGGGCTGGAGG + Intergenic
1200397452 X:155999509-155999531 CAGGGGTAGGGATGGGCAGGAGG - Intronic
1200954854 Y:8933204-8933226 AAGTTGGGGGGCAGGGCAGGAGG + Intergenic
1201187994 Y:11422410-11422432 CAGTGGTGGGGCTGGGGAGTAGG - Intergenic
1202378734 Y:24259235-24259257 CATTGGTGGGGAGGGGCCGGGGG - Intergenic
1202492048 Y:25410886-25410908 CATTGGTGGGGAGGGGCCGGGGG + Intergenic