ID: 1005437357

View in Genome Browser
Species Human (GRCh38)
Location 6:25829105-25829127
Sequence AAGGCCCAACTTATGTTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 131}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005437357_1005437360 13 Left 1005437357 6:25829105-25829127 CCTCAAAACATAAGTTGGGCCTT 0: 1
1: 0
2: 0
3: 7
4: 131
Right 1005437360 6:25829141-25829163 TCACTGTGGACTTTTGATCTTGG No data
1005437357_1005437362 22 Left 1005437357 6:25829105-25829127 CCTCAAAACATAAGTTGGGCCTT 0: 1
1: 0
2: 0
3: 7
4: 131
Right 1005437362 6:25829150-25829172 ACTTTTGATCTTGGGATTTTTGG 0: 1
1: 0
2: 7
3: 71
4: 523
1005437357_1005437361 14 Left 1005437357 6:25829105-25829127 CCTCAAAACATAAGTTGGGCCTT 0: 1
1: 0
2: 0
3: 7
4: 131
Right 1005437361 6:25829142-25829164 CACTGTGGACTTTTGATCTTGGG 0: 1
1: 0
2: 2
3: 22
4: 202
1005437357_1005437359 -1 Left 1005437357 6:25829105-25829127 CCTCAAAACATAAGTTGGGCCTT 0: 1
1: 0
2: 0
3: 7
4: 131
Right 1005437359 6:25829127-25829149 TGAAGTCAGATGTTTCACTGTGG 0: 1
1: 0
2: 1
3: 24
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005437357 Original CRISPR AAGGCCCAACTTATGTTTTG AGG (reversed) Intronic
901432535 1:9225786-9225808 AAGCCCCAGATTTTGTTTTGAGG - Intergenic
907930846 1:58998363-58998385 AACTCCCAACTTACTTTTTGTGG - Intergenic
908657887 1:66407038-66407060 AAAGCCCAACAAATGTTTTAGGG + Intergenic
910492986 1:87793722-87793744 AAGGGCAAATTTAAGTTTTGTGG - Intergenic
911368217 1:96965965-96965987 ATGGGCCAATTTATGTTTTCAGG + Intergenic
911626367 1:100129499-100129521 AAGGCCCAAATAATGGTTTAAGG + Intronic
913323818 1:117608826-117608848 TAAGCTAAACTTATGTTTTGGGG + Intronic
917621014 1:176795923-176795945 AAAGCACTATTTATGTTTTGGGG - Intronic
919174855 1:194006591-194006613 AAGGCAATTCTTATGTTTTGAGG + Intergenic
920359077 1:205400043-205400065 AAGGCAAAAATAATGTTTTGGGG + Intronic
923107679 1:230867539-230867561 AATGCCCAGCGTATGTTTTAAGG - Intronic
1063201939 10:3792591-3792613 GAGGCACAACTGATGTTTAGTGG + Intergenic
1065268956 10:24006987-24007009 AGCGTCCAACTAATGTTTTGGGG + Intronic
1070357552 10:75655504-75655526 GAGGCCCAACTGATCATTTGTGG + Intronic
1071906010 10:90174191-90174213 AGGAGCCAGCTTATGTTTTGAGG - Intergenic
1081387593 11:42490590-42490612 AAGTCTTAACTTATTTTTTGAGG + Intergenic
1082097544 11:48143744-48143766 AAAGCCCAAGTTTTGTTGTGGGG + Intronic
1083381723 11:62274702-62274724 ATGGCCAAACTTTTGTCTTGGGG - Intergenic
1084384410 11:68833800-68833822 AAGACTCACCTTATGTTTTTCGG + Intronic
1084706942 11:70821069-70821091 GAGGCTCAACTTAGGTTGTGGGG - Intronic
1086990531 11:93298818-93298840 AAAGCCCAAAATATGTTTTATGG - Intergenic
1087336008 11:96845730-96845752 AAGCTCTAACTTCTGTTTTGAGG - Intergenic
1087480113 11:98689477-98689499 AATTCCCAACTTATTTTATGAGG - Intergenic
1087829844 11:102807873-102807895 AAGGCCGAATTTATTGTTTGAGG - Intergenic
1087931190 11:103979737-103979759 AAAGCAGATCTTATGTTTTGTGG - Intronic
1091972291 12:4797457-4797479 AAGGAACAAATTATGTTTTATGG - Intronic
1094654511 12:32407582-32407604 AGGGCCCAGATTATGTATTGAGG - Intronic
1096551032 12:52371749-52371771 ATGATCCAACTTATGTTTTACGG - Intergenic
1098918768 12:76283887-76283909 AAGGACCAAATTATTTTCTGAGG - Intergenic
1100959062 12:99942958-99942980 TAGGACCAACTTAGGTTGTGTGG - Intronic
1103958340 12:124592173-124592195 AAGGCCTAGCTTTTGTGTTGGGG + Intergenic
1107566650 13:41611777-41611799 ATGACCCAACTTTTGTTCTGTGG - Intronic
1109746627 13:66631634-66631656 AAGCCCCAACTTTAGTTTTAAGG - Intronic
1110794406 13:79620150-79620172 TAGGATCAACTGATGTTTTGGGG - Intergenic
1112255596 13:97827720-97827742 AAGGTCCATCTTCTGGTTTGTGG + Intergenic
1113541364 13:111112397-111112419 AGAGCCCAACGTATCTTTTGGGG - Intergenic
1117180543 14:53186962-53186984 AAGGCATAACTTCTGTTCTGAGG + Intergenic
1119574954 14:75711737-75711759 AAGGCACTACAAATGTTTTGGGG - Intronic
1126402571 15:48288136-48288158 AAGGCACAATTGATGTTTGGTGG + Exonic
1126908457 15:53392820-53392842 AATACCTTACTTATGTTTTGGGG + Intergenic
1135902789 16:26479935-26479957 AATTACCAATTTATGTTTTGAGG + Intergenic
1136085315 16:27880754-27880776 AACGACAAACTTTTGTTTTGTGG + Intronic
1137246758 16:46712145-46712167 AATGCCCAACTAATTTTTTTTGG + Intronic
1137432607 16:48430570-48430592 AAGGGCCTTCTGATGTTTTGAGG + Intronic
1139519628 16:67473503-67473525 TACGCCCAACTAATTTTTTGTGG + Intronic
1142785287 17:2216936-2216958 AAGAAGCAACTTAGGTTTTGAGG - Intronic
1144418833 17:15076934-15076956 AAGGTCCAATTCATGTTCTGAGG + Intergenic
1149286493 17:55171216-55171238 GAGGCACACCTGATGTTTTGTGG - Intergenic
1149748010 17:59118107-59118129 AATGCCCAGCTAATTTTTTGTGG - Intronic
1151124362 17:71828702-71828724 AAGTCTCAACTTTTGTTCTGTGG + Intergenic
1153437545 18:5083880-5083902 GAGGCCCAGCTTAAGTTTTGTGG - Intergenic
1154118538 18:11633069-11633091 CAGGCCCAACTAATCTTTTTTGG + Intergenic
1157678952 18:49588723-49588745 AAGGCCCATCTTGTGGTGTGAGG + Intronic
1158110150 18:53931767-53931789 AAGGACCACCTGATGTTATGAGG - Intergenic
1158799658 18:60891307-60891329 ATATCCCAACTTATGTTTTGAGG - Intergenic
1162265596 19:9571107-9571129 AATGCCTAACATATATTTTGTGG - Intronic
1166381004 19:42355414-42355436 AGGGCCCAATTCACGTTTTGAGG + Intronic
925236236 2:2280251-2280273 AATGCCTAACTAGTGTTTTGTGG - Intronic
925793826 2:7521517-7521539 AAAGCCCAAGCTATGTTCTGGGG + Intergenic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
937667041 2:124499502-124499524 AAGGCACAACGTATGTCTAGAGG + Intronic
942668317 2:178346599-178346621 AAGGCCCAAATTGAGTGTTGAGG + Intronic
942791190 2:179762701-179762723 ACTGCCCAACTTATTTTATGAGG - Intronic
944511442 2:200469989-200470011 AAGGCCCAAATCATGCTCTGCGG + Exonic
1169673420 20:8129734-8129756 AAGGCTCAAAATATGCTTTGAGG - Intergenic
1173679778 20:44869861-44869883 AAGGCCCAGCTAATTTTTTGTGG - Intergenic
1176048284 20:63103628-63103650 AACGCCCATCTTCTGTCTTGAGG - Intergenic
951308703 3:21098182-21098204 AAGGTCCAACTCATATCTTGAGG + Intergenic
952034356 3:29181387-29181409 AAGGCCAAAGGTAAGTTTTGTGG + Intergenic
955102135 3:55860510-55860532 AGGGCCCTAATTATGCTTTGGGG - Intronic
959923241 3:111893096-111893118 AATGCCCAACTTATTTTGGGGGG - Intronic
961066540 3:123881704-123881726 TAGGCTCATCTTATATTTTGAGG + Intronic
962947257 3:140183196-140183218 TAGGCCAAACTAATGTTTAGGGG + Intronic
964191219 3:154003226-154003248 AAAGCCCACCCTATGATTTGTGG + Intergenic
964824410 3:160809394-160809416 AAGGCTCAACTTTAGTTTTCAGG + Intronic
970879117 4:20907159-20907181 AAGGGTCAAGTTATTTTTTGTGG - Intronic
971735754 4:30449277-30449299 AAGTCACAACTTATTTTATGAGG + Intergenic
972267682 4:37478477-37478499 AAGGGCCAACCTCTGTTTGGCGG - Intronic
972931291 4:44073904-44073926 AAGACTCTAGTTATGTTTTGAGG - Intergenic
973780913 4:54287671-54287693 AAGGCACAACATGTGGTTTGAGG - Intronic
973851622 4:54966632-54966654 AAGGCCAAACTTCTTTTGTGGGG - Intergenic
976299597 4:83505626-83505648 ATGGCCAAACTTTTGTTTTGGGG - Intronic
976843864 4:89464230-89464252 AAAGTCCAATTTATTTTTTGTGG - Intergenic
979218194 4:118191573-118191595 AAGGGCCTACTTAATTTTTGTGG + Intronic
981806418 4:148720770-148720792 AAGGCACAAGTTAAGTTTGGAGG - Intergenic
982426612 4:155270034-155270056 AATGCCCAACTCATTTTATGAGG - Intergenic
984535276 4:180967424-180967446 CTGGCCCAAATTATGTTTTGAGG + Intergenic
985102092 4:186468667-186468689 AAAGCCCTACATATTTTTTGGGG - Intronic
994052998 5:95383110-95383132 AAGGACCCACTTAAGGTTTGTGG + Intergenic
994123640 5:96146071-96146093 CAGGCCCAACTTATATTTAAGGG + Intergenic
998328026 5:141299337-141299359 AAGGGGCAAATTATGTTATGTGG + Intergenic
999990624 5:157046812-157046834 AAGGCCCAAGTTACATTTTCTGG - Intronic
1000937509 5:167320853-167320875 AAGGGACAACTTATTTTTTATGG + Intronic
1001598346 5:172912923-172912945 CATGCCCAGCTAATGTTTTGTGG + Intronic
1003608124 6:7584062-7584084 AATGCCAAGCTTCTGTTTTGTGG - Exonic
1003701100 6:8466217-8466239 AAGACCCAACTAAAGTTATGAGG + Intergenic
1005437357 6:25829105-25829127 AAGGCCCAACTTATGTTTTGAGG - Intronic
1005446424 6:25928516-25928538 AAAGCCCTACTTAAGTTTTATGG + Intronic
1006968946 6:38020018-38020040 AAGGCCAAAATAGTGTTTTGAGG - Intronic
1007012400 6:38430376-38430398 CACACCCAACTTATGTTTTATGG + Intronic
1011909114 6:92412629-92412651 ATGTGCCAACTTATGTGTTGTGG + Intergenic
1012001016 6:93655324-93655346 TAAGCCCAACTTAGGTTTTTTGG + Intergenic
1014541760 6:122684463-122684485 AAGGCCCAGCCTCTGTTTGGGGG - Intronic
1018124433 6:160668407-160668429 CAGGCCTGAGTTATGTTTTGTGG + Intergenic
1018190156 6:161303429-161303451 AATACCCAACTTCTGTTTTCTGG + Intergenic
1018682541 6:166275774-166275796 GGGGCCCAGCATATGTTTTGGGG + Intergenic
1021729715 7:23584690-23584712 TACGCCCAACTAATTTTTTGGGG + Intergenic
1022003796 7:26248997-26249019 ATGGCCAAACTTTTGTCTTGGGG + Intergenic
1023636034 7:42211469-42211491 ATGGACCAACGTATGTTTTCTGG + Intronic
1023798427 7:43812622-43812644 AAGACAAAACTTATGTTTTGGGG + Intergenic
1028094206 7:86740251-86740273 TAGGCCCAACTTCCATTTTGAGG + Intronic
1030569968 7:111211225-111211247 AAAATCCAATTTATGTTTTGGGG - Intronic
1033831816 7:145263752-145263774 TAGTCCCACCTTATCTTTTGAGG + Intergenic
1036058786 8:5290997-5291019 AAGGCCCAACCTCTGTGTTGGGG + Intergenic
1041521006 8:58756377-58756399 AAGTTCCAACTTATGAATTGTGG - Intergenic
1042796182 8:72665596-72665618 CAGGCCCACCTTAGGTTCTGAGG - Intronic
1043506904 8:80911258-80911280 ATGGCCAAACTTTTGTCTTGGGG - Intergenic
1043618972 8:82164389-82164411 AAGGGCCAACTCATGGTTTCTGG + Intergenic
1044300798 8:90580800-90580822 AAGGTCCCACTGGTGTTTTGGGG + Intergenic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053155729 9:35777423-35777445 CAGGCCTAAATCATGTTTTGTGG + Intergenic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1056996258 9:91462807-91462829 AAGGCCCAATGTTTTTTTTGGGG + Intergenic
1187287008 X:17915351-17915373 AATGCCCACTTAATGTTTTGTGG - Intergenic
1191151444 X:57224080-57224102 ATGGCCAAACTTTTGTCTTGGGG + Intergenic
1191692779 X:63958205-63958227 TATACCCTACTTATGTTTTGTGG - Intergenic
1192347278 X:70321311-70321333 AAGACTCAACTTAAGTGTTGGGG + Intronic
1193368754 X:80666896-80666918 AAGGCCTCACATAAGTTTTGGGG - Intergenic
1194847339 X:98826572-98826594 AAGGCACAACTTTTCTTTTTTGG + Intergenic
1195028469 X:100902384-100902406 AATTCCCAACTTATTTTATGAGG + Intergenic
1195806467 X:108776478-108776500 AAGGCCTAAGTCATTTTTTGTGG + Intergenic
1197707957 X:129647574-129647596 AAGGCCCAAATGAAGGTTTGGGG + Exonic
1199225000 X:145363058-145363080 CACGCCCAACTAATTTTTTGTGG + Intergenic
1201499718 Y:14628525-14628547 CAGGGACAAGTTATGTTTTGAGG + Intronic